Molecular cloning and functional characterization of a unique multipotent polyphenol oxidase from Marinomonas mediterranea

Biochimica et Biophysica Acta 1547 (2001) 104^116 www.bba-direct.com

Molecular cloning and functional characterization of a unique multipotent polyphenol oxidase from Marinomonas mediterranea Antonio Sanchez-Amat a , Patricia Lucas-El|¨o a , Eva Ferna¨ndez b , Jose Carlos Garc|¨a-Borro¨n b , Francisco Solano b; * b

a Department of Genetics and Microbiology, University of Murcia, 30100 Murcia, Spain Department of Biochemistry and Molecular Biology B, School of Medicine, University of Murcia, 30100 Murcia, Spain

Received 23 November 2000; accepted 26 February 2001

Abstract Marinomonas mediterranea is a recently isolated melanogenic marine bacterium containing laccase and tyrosinase activities. These activities are due to the expression of two polyphenol oxidases (PPOs), a blue multicopper laccase and an SDS-activated tyrosinase. The gene encoding the first one, herein denominated M. mediterranea PpoA, has been isolated by transposon mutagenesis, cloned and expressed in Escherichia coli. Its predicted amino acid sequence shows the existence of a signal peptide and four copper-binding sites characteristic of the blue multicopper proteins, including all fungal laccases. In addition, two additional putative copper-binding sites near its N-terminus are also present. Recombinant expression in E. coli of this protein clearly demonstrates its multipotent capability, showing both laccase-like and tyrosinase-like activities. This is the first prokaryotic laccase sequenced and the first PPO showing such multipotent catalytic activity. The expression of several truncated products indicates that the four copper-binding sites typical of blue multicopper proteins are essential for the laccase activity of this enzyme. However, the last two of these sites are not necessary for tyrosine hydroxylase activity as this activity is retained in a truncated product containing the first two sites as well as the extra histidine-rich clusters close to the N-terminus of the protein. ß 2001 Elsevier Science B.V. All rights reserved. Keywords: Polyphenol oxidase; Laccase; Tyrosinase; Copper protein; Pigmentation

1. Introduction Laccases (benzenediol oxygen:oxidoreductase, EC 1.10.3.2) are enzymes that contain at least four cop-

Abbreviations: DMPO, 2,6-dimethoxyphenol oxidase; DO, DOPA oxidase; DOPA, 3,4-dihydroxyphenylalanine; MM, marine medium; NBT/BCIP, nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate; PPO, polyphenol oxidase; SO, syringaldazine oxidase; TH, tyrosine hydroxylase * Corresponding author. Fax: +34-968-364-150; E-mail: [email protected]

per ions directly involved at the active site. According to their spectroscopic properties, these coppers are classi¢ed in three di¡erent types, one copper type I, another copper type II and a pair of type III coppers that are coupled and EPR-silent [1]. These enzymes are widely found in fungi and plants, and a number of laccases have been cloned from these sources [2^5]. They show polyphenol oxidase (PPO) activity and are involved in a series of cellular processes related to secondary metabolism. However, their physiological roles are not de¢nitively clari¢ed yet. They have been proposed to be involved in biosynthetic processes, such as plant ligni¢cation [6,7],

0167-4838 / 01 / $ ^ see front matter ß 2001 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 8 3 8 ( 0 1 ) 0 0 1 7 4 - 1

BBAPRO 36409 25-4-01

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

fungal sporulation [8], pigmentation [3], virulence [9], and formation of fruiting bodies [10]. On the other hand, it has also been proposed that they could be involved in biodegradative processes, such as the deligni¢cation carried out by a series of rot basidiomycetes and other fungi [2,5,11,12]. This last catabolic capability of laccases has attracted industrial interest for bioconversions related to pulp and paper making, degradation of aromatic polyphenols and lignin-like structures [12], etc. Thus, easily obtainable and versatile laccases could be of interest for this type of biotechnological purposes. Tyrosinases (monophenol, L-3,4-dihydroxyphenylalanine (L-DOPA) oxidoreductase, EC 1.14.18.1) are also PPOs involved in melanosynthesis and belong to the group of non-blue copper proteins since they only have a pair of type III coppers. Thus, the most important catalytic di¡erences among laccases and tyrosinases are that laccases show speci¢c oxidase activity for methoxy-activated phenols such as 2,6-dimethoxyphenol and syringaldazine [12], whereas tyrosinases show speci¢c cresolase activity to oxidize monophenols. However, both PPOs are able to oxidize an overlapping range of o- and p-diphenolic compounds, with di¡erent e¤ciency. In bacterial cells, the list of postulated multicopper proteins containing the motifs that bind the three types of coppers is rapidly growing due to systematic sequencing of bacterial genomes [13]. Bacterial multicopper proteins seem to be involved in antibiotic biosynthesis [14], sporulation [15] and copper resistance [16,17]. However, authentic laccase activity has been barely reported. Prokaryotic laccase activity associated to these proteins was ¢rst reported in Azospirillum lipoferum related to melanin formation [18,19], but later it was also related to electronic transfers [20]. As far as we know the cloning of the gene coding for this enzyme has not been reported yet. Our group has detected laccase activity in two marine bacteria, Marinomonas mediterranea and strain 2-40 [21,22], and the enzyme from the ¢rst strain is the only prokaryotic laccase whose primary structure is so far known [23]. M. mediterranea is a melanogenic bacterium isolated from the Mediterranean sea [22,24] and 2-40 is another marine bacterium isolated from a salt marsh grass on the Atlantic coast [25]. The laccases of these

105

microorganisms seemed to display unique properties as they were able to oxidize a wide range of substrates characteristic for both tyrosinases and laccases [21]. Their broad substrate speci¢city and the capability to catalyze the hydroxylation of L-tyrosine and other monophenols make those PPOs potentially interesting for the above mentioned biotechnological applications. In addition, as the ¢rst enzymes sharing tyrosinase and laccase activity, their characterization is very helpful to elucidate the speci¢c roles of the di¡erent copper-binding sites and their involvement in the catalytic mechanism of both types of PPO activities. We ¢rst approached these goals by chemical mutagenesis of M. mediterranea with nitrosoguanidine, and several amelanotic mutants were found. The isolation of one of them, termed ng56 [22], suggested the existence of a second tyrosinase-like PPO in this microorganism. This enzyme seemed to be clearly di¡erent from the multipotent laccase as it was strongly activated by addition of SDS, a feature reported in eukaryotic tyrosinases [26,27]. Its existence complicated the demonstration of the multipotent activity attributed to the laccase enzyme on the basis of protein puri¢cation from M. mediterranea extracts and enzymatic measurements [21]. Thus, complete characterization of the multipotent laccase required its cloning and expression in a suitable cellular system. We recently achieved the cloning of the gene by transposon mutagenesis using mini-Tn10 transposons [23,28]. In this paper we describe the sequencing and analysis of the chromosomic region containing the ppoA gene. This gene and several truncated products have been expressed in Escherichia coli BL21(DE3) using the expression vector pET11. The expression has unambiguously demonstrated its membrane location and its multipotency for oxidation of tyrosinase and laccase substrates, as judged by its ability to catalyze tyrosine hydroxylation and L-DOPA, dimethoxyphenol and syringaldazine oxidations. In addition to the four histidine-rich motifs conserved in all laccases and involved in copper binding, two extra histidine-rich clusters putatively involved in copper binding have been found near its N-terminus. These two new motifs seem to be related to the tyrosine hydroxylase rather than to laccase activity.

BBAPRO 36409 25-4-01

106

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

2. Materials and methods 2.1. Strains, plasmids, chemicals and medium The PCR primers, bacterial strains, vectors and plasmids used in this study are listed in Table 1. E. coli strains were grown in LB medium. Peptones and yeast extract were from Oxoid (Basingstoke, UK). When required, this medium was supplemented with ampicillin (50 Wg/ml), gentamicin (5 Wg/ml) or rifampicin (50 Wg/ml). M. mediterranea was usually grown in appropriate marine medium. MM2216 was bought from Difco (Detroit, MI, USA). Complex marine medium (MMC) and the minimum marine medium (MMM) have been previously described [23,29]. Inorganic salts for bu¡ers and culture me-

dium were from Merck (Darmstadt, Germany). All substrates for the enzymatic assays, bicinchoninic acid solution and the antibiotics were from Sigma (St. Louis, MO, USA), except 2,6-dimethoxyphenol, from Fluka Chemie (Bucks, Switzerland). Restriction and other modi¢cation enzymes used in molecular biology protocols and the radioactive products 3 L-[3,5- H]tyrosine (speci¢c activity 50 Ci/mmol) and [K-32 P]ATP (3000 Ci/mmol) were purchased from Amersham Pharmacia Biotech (Buckinghamshire, UK). Other reagents were from New England Biolabs (Hertfordshire, UK), Novagen (Madison, WI, USA), Qiagen (Hilden, Germany), Roche Molecular Biochemicals (Mannheim, Germany) or Stratagene (Heidelberg, Germany), as speci¢ed.

Table 1 PCR primers, bacterial strains and plasmids used in this study Primers Forward fA f1 f2 f3 Reverse rA r1 r2 Bacterial strains E. coli DH5K E. coli BL21(DE3) E. coli S17-1 (Vpir) M. mediterranea MMB-1R ngd67 Tn101 Plasmids pBSL182 pLB1 pPPOA pPPOAP pPPO695 pPPO675 pPPO578 pPPO520 pPPO403

Sequences (engineered restriction site underlined) TTGAAGCTTCCATAGACAGCAATCTAAC (HindIII) CCCGTGTAACATATGACTGAGCCG (NdeI) AGGACTCACATATGCAGACATGCAAA (NdeI) GAGCTAAACTTTCATATGTCTGTCGCA (NdeI) TTTGAATTCATGCACCAGTCTGCTTA (EcoRI) CACCAGGATCCTTATTCTTTGAGTACTAC (BamHI) CAGTATCAGGATCCATTTAAGCAAT (BamHI) Description and/or relevant genotype

Source

Tpr , Smr , recA thi hsdRM‡ , Vpir phage lysogen RP4 : :Mu: :Km Tn7 MMB-1, Gms Rifs MMB-1, Gms , spontaneous Rifr MMB-1, nitrosoguanidine mutant, laccase (3) activities MMB-1R ppoA: :Tn10(Gm)

Commercial Commercial [33] [22] [23] [23] [23]

ori R6K, mob RP4, Apr ; mini-Tn10 Gmr , delivery vector Apr ,Gmr ; pUC19+12.7 kb SphI fragment of genomic DNA from Tn101 Apr , pUC19+ HindIII-EcoRI PCR-generated fragment of genomic MMB-1R DNA (primers fA/rA) Apr , pUC18+ HindIII-EcoRI PCR-generated fragment of genomic MMB-1R DNA (primers fA/rA) Apr , pET11+ NdeI-BamHI PCR-generated fragment of genomic MMB-1R DNA (primers f1/r1) Same as before, but fragment generated (primers f2/r1) Same as before, but fragment generated (primers f3/r1) Same as before, but fragment generated (primers f1/r2) Same as before, but fragment generated (primers f3/r2)

BBAPRO 36409 25-4-01

[28] [23] [23] This study This study This This This This

study study study study

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

2.2. Probe labeling and Southern blot hybridization M. mediterranea genomic DNA, after digestion with appropriate restriction enzymes, was electrophoresed in a 0.8% agarose gel and transferred to a Hybond membrane (Amersham Pharmacia Biotech). Hybridizations were carried out overnight in the appropriate medium according to the probe and at temperatures ranging from 55³C to 68³C depending on the degree of stringency required. The membranes were autoradiographed with X-ray ¢lms when radioactive probes (labeled with [K-32 P]ATP using random priming radiolabeling) were used or stained with antibody-linked alkaline phosphatase and nitro blue tetrazolium (NBT)-5-bromo-4-chloro-3-indolyl phosphate (BCIP) according to the manufacturer's instructions when digoxigenin-labeled probes were employed (kit from Roche). 2.3. Mutagenesis and detection of mutants a¡ected in PPO activity M. mediterranea was submitted to transposon mutagenesis by conjugation on agar plates [23,28]. Surviving colonies a¡ected in melanization were detected by visually inspecting its low pigmentation after growing 3 or 4 days in rich medium. Qualitative detection of laccase activity mutants was carried out by the screening test recently reported [23] in plates containing 2 mM 2,6-dimethoxyphenol (DMP) in 0.1 M sodium phosphate bu¡er pH 5.0, solidi¢ed with 0.5% agarose. The mutant Tn101 was obtained and chosen for this study after its PPO activities were determined quantitatively in cell extracts as described below. 2.4. Cloning of the M. mediterranea laccase gene and surrounding genomic region Isolated genomic DNA from M. mediterranea Tn101 was digested with SphI and ligated to pUC19 with T4 DNA ligase according to standard protocols [30]. The ligation mixture was transformed in E. coli DH5K, and transformants selected for ampicillin and gentamicin resistance. The plasmid obtained (LB1, around 15.5 kb size) was subcloned in pBlueScriptKS II(+) using the SacI restriction sites present in the transposon close to both IS10 se-

107

quence edges and di¡erent restriction sites (XhoI or KpnI) in the M. mediterranea chromosomic DNA. The resulting plasmids were used for sequencing the DNA regions adjacent to the transposon insertion point. 2.5. Recombinant expression of the M. mediterranea laccase and truncated products The native ppoA gene without the inserted transposon was ampli¢ed by PCR using genomic DNA of wild type M. mediterranea strain as template (isolated with the Wizard kit from Promega) and the proofreading Pfu DNA polymerase (Stratagene). Two di¡erent strategies were employed for its cloning, expression in E. coli and functional characterization: ¢rst, cloning of a genomic fragment containing the gene plus its putative promoter region in pUC vectors to analyze its heterologous expression under the control of the native promoter; second, cloning of genomic fragments of di¡erent size containing the complete gene or some truncated products in pET11 to analyze its heterologous expression under the control of the T7 promoter contained in that expression vector. Concerning the ¢rst approach, a product with a size of approx. 2.2 kb containing the complete ppoA gene plus an upstream short fragment bearing the putative ribosome binding site and the promoter was ampli¢ed using the appropriate forward and reverse primers, fA and rA (Table 1). HindIII and EcoRI restriction sites were included at the 5P ends of the primers to allow the cloning of the ampli¢ed products in pUC19 and pUC18 to yield the plasmids called pPPOA and pPPOAP. Twenty-¢ve cycles of PCR consisting of 95³C for 45 s, 61³C for 1 min and 72³C during 4 min for extension were performed. The reaction mixture contained 5% dimethyl sulfoxide, 2 mM MgCl2 , 1 mM dNTPs equimolecular mixture, 1 Wg of each primer and 100 ng of template DNA. Concerning the second approach, another set of fragments were obtained by PCR and cloned in the expression vector pET11 (Novagen) using NdeI and BamHI as cloning sites. These ampli¢ed fragments (obtained by PCR with the appropriate primers, see Table 1) were called PPO695, PPO675, PPO578, PPO520 and PPO403 according to the respective

BBAPRO 36409 25-4-01

108

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

amino acid length. The proteins encoded by PPO695, PPO675 and PPO578 start at three di¡erent Met to di¡er in the N-terminus. The protein products encoded by PPO520 and PPO403 are truncated in the C-terminus, around the position where the transposon Tn10 is inserted in the Tn101 strain. PCRs were carried out using 1 Wg of the appropriate pair of primers and other conditions as described above. Twenty-¢ve cycles were run, consisting in 95³C for 45 s, 52³C for 1 min and 72³C for 3 min. All PCR products showing the expected sizes were puri¢ed by electrophoresis in agarose gels, treated with the restriction cloning enzymes, ligated in the appropriate expression vector and transformed in DH5K E. coli. Transformants were selected in ampicillin agar plates and, after veri¢cation, plasmids constructed on the expression vector pET11 were used to transform BL21 DE3 E. coli. Expression was induced by addition of 1 mM IPTG to exponentially growing cultures, according to the standard protocols supplied by the manufacturer (Novagen). Then, cells were harvested by centrifugation at 5000Ug for 5 min at 4³C. Aliquots of samples were mixed with sample bu¡er and frozen until application to SDS-PAGE electrophoresis to visualize protein expression. Electrophoresis was performed according to Laemmli [31] and protein was stained with Coomassie blue R250. Other aliquots were submitted to fractionation by di¡erential centrifugation and the di¡erent PPO activities were determined according to the assays described in Section 2.6. 2.6. Enzymatic determinations in cell extracts Crude cell extracts were obtained by sonication of cell pellets as described elsewhere [22,23]. When appropriate, their fractionation in membrane and soluble fractions was carried out by di¡erential centrifugation as previously described [29]. DMP oxidase (DMPO) activity was determined at 468 nm by the oxidation of 2 mM DMP to 3,3P,5,5Ptetramethoxydiphenylquinone (O = 14 800 M31 cm31 ) in 0.1 M sodium phosphate bu¡er, pH 5.0. Syringaldazine oxidase (SO) was followed at 525 nm by oxidation of 50 WM freshly prepared syringaldazine to tetramethoxy-azo-bis-methylene quinone (O = 65 000 M31 cm31 ) in 0.1 M phosphate bu¡er, pH 6.5, as previously described [21,22,29]. DOPA oxidase (DO)

activity was determined by monitoring the oxidation of 2 mM L-DOPA to L-dopachrome at 475 nm (O = 3700 M31 cm31 ) in 0.1 M sodium phosphate bu¡er, pH 5.0. For tyrosine hydroxylase (TH) activity, a sensitive radiometric assay consisting in measuring the radioactive water released from L-[3,53 H]tyrosine was performed [32]. The radioactive substrate (0.5 WCi per assay) was isotopically diluted with cold L-tyrosine to a ¢nal concentration of 0.2 mM in 0.1 M sodium phosphate bu¡er, pH 5.0 and supplemented with 50 WM of L-DOPA as cofactor [23]. When indicated, DO and TH activities were also assayed in the presence of 0.1 mM CuSO4 or 0.02% SDS (THsds and DOsds, respectively). Reference cuvettes had always the same composition except for the enzymatic preparation. In all cases, one unit was de¢ned as the amount of enzyme that catalyzes the appearance of 1 Wmol of product per minute at 37³C. Speci¢c activities were normalized by mg of protein, measured using the bicinchoninic acid assay. 3. Results 3.1. Location and sequence analysis of the ppoA gene and surrounding DNA region We have recently demonstrated that Tn10 derivatives containing di¡erent antibiotic resistance markers were able to transpose into the M. mediterranea chromosome at a relatively high frequency [23]. Southern blot analysis (not shown) of HindIII digested DNA from a number of M. mediterranea Rifr , Amps , Gmr transconjugants displayed a randomly located single band of di¡erent sizes when probed with a 0.9 kb SacI fragment encompassing the Gmr encoding gene. This indicated that a single insertion of Tn10 in the bacterial genome takes place. We isolated some of those transconjugant mutants speci¢cally a¡ected in the PPO activities. One of them, mutant Tn101, was chosen since it was pigmented, showed a strong activation of tyrosinase-associated activities by SDS, but it was speci¢cally unable to oxidize laccase-speci¢c substrates, such as DMP and syringaldazine (Fig. 1). This behavior suggested that strain Tn101 was a¡ected in the structural gene encoding the presumably multipotent laccase

BBAPRO 36409 25-4-01

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

Fig. 1. PPO activities in crude extracts of M. mediterranea wild type and the Tn101 mutant strain. The data are the mean of three di¡erent cultures.

enzyme rather than in the SDS-activated tyrosinase associated to pigmentation or in other regulatory genes. The chromosomal regions £anking the mini-Tn10 insertion in M. mediterranea Tn101 were cloned by a marker rescue experiment. Chromosomal DNA from this strain was digested with the restriction enzyme SphI, ligated to the corresponding site of pUC19 and transformed into E. coli DH5K. Transformants were selected for gentamicin and ampicillin resistance and a plasmid termed pLB1 containing the transposon and the £anking regions of chromosomal DNA was obtained. The sequencing of around 6 kb of LB1 centered in the gentamicin resistance gene displayed four genomic open reading frames (ORFs) that were blasted against GenBank for homology. The ¢rst ORF1 encodes a protein with a high similarity to a hypothetical chemotactic sensory transducer-related protein of Vibrio cholerae (accession No. AAF96792). The second ORF2 is quite short, 319 bp, and we did not ¢nd any known nucleotide or peptide sequence with signi¢cant similarity. Next, an ORF3 with strong similarity to fungal laccases and other blue copper proteins was identi¢ed. The mini-Tn10 transposon was inserted towards the 3P end of this ORF3; 21 bp downstream from the stop codon, a palindromic sequence was found (aaaagcgagccaaaggctcgctttt) that is very likely an intrinsic transcription terminal signal for this gene. The existence of this signal is in agreement with the opposite reading sense found in the ORF4. This

109

ORF4 showed a very strong similarity with hypothetical proteins from Pseudomonas aeruginosa (AAG08311), Mycobacterium tuberculosis (H70723) and Mycobacterium leprae (AL023591). These data support that only ORF3 was related to PPO activity. When ORF3 plus a short 5P upstream region was ampli¢ed from wild type M. mediterranea genome by PCR with the primer pair fA/rA (Table 1), cloned and resequenced, a Tn10-characteristic 9 bp duplication [33] generated by the transposon insertion at both sites of the insertion sequences was revealed in the Tn101 mutant strain. The wild type ORF3 consists of 2091 bp (Fig. 2), the gene has been denominated ppoA and deposited in GenBank under accession No. AF184209. The site of the Tn10 insertion in the Tn101 strain was located at position 1650, interrupting the ppoA gene. Sequence analysis of this gene from ngd67, a phenotypically similar mutant strain obtained by nitrosoguanidine mutagenesis [22], revealed a nonsense g/a mutation at position 1047 a¡ecting the third base of a tryptophan-encoding codon that changed to a stop codon. The deduced protein encoded by ppoA shows the characteristic four copper-binding sites conserved in all blue multicopper proteins known. The last two of these sites are lost after transposon insertion. This accounts for the null laccase activity found in mutant Tn101 (Fig. 1). The same sites are also lost in the nitrosoguanidine mutant strain ngd67 due to the premature stop codon. In addition to the four laccasecharacteristic copper-binding motifs, the protein found also shows two additional histidine clusters that might also be related to the multipotent PPO activity of this enzyme. One of this clusters is found very close to the N-terminus of the polypeptidic chain and their presence in the mature protein is uncertain, depending on the position of the putative start codon and the cleavage site of the signal peptide. The next series of experiments were performed to show that the ppoA gene actually encodes for a unique multipotent PPO and to de¢ne the actual length of the protein and the structural requirements for enzyme activity. Northern blot indicated that the ppoA mRNA has a length around 2.1 kb. This size rules out that ppoA is part of an operon whose expression as polycystronic RNA is regulated upstream from the region shown in Fig. 2. The ORF3 starts

BBAPRO 36409 25-4-01

110

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

Fig. 2. Nucleotide sequence and predicted translation products of the ppoA gene from M. mediterranea. The putative translation initial codons are marked in bold. The most plausible initial Met yields a protein 675 amino acids long. The promoter region is underlined (335 and 310 regions double-underlined), and the ribosome binding-site dotted underlined. Assuming translation of the longest ORF3 from the initial Met (no. 1), a PPO of 696 amino acids results. The extra N-terminus region is marked with question marks. Upstream the initiation point of ORF3, the 109 bp fragment contained in the plasmids pPPOA/pPPOAP constructed on pUC19/ pUC18 is also shown. Transcription terminal palindromic sequence is in italics. The possible cleavage sites of the signal peptide and the site of transposon insertion at position 1651 are also marked by arrows. The four histidine-rich binding copper sites characteristic of all multicopper blue-proteins are in bold and the two additional histidine clusters speci¢c of this multifunctional PPO are boxed.

BBAPRO 36409 25-4-01

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

with two consecutive ttg and atg codons that could encode the initial Met of a protein product of 696^ 695 amino acids respectively. However, neither a putative ribosome binding site nor a promoter region could be detected upstream from these two possible start codons. Alternatively, the next putative initial Met codon could occur at position 22 in the ORF (Fig. 2). This Met seemed to be a more likely candidate for the transductional start of ppoA, as it is preceded by a region resembling the promoter consensus, as well as by a putative Shine-Dalgarno sequence. In that case, the postulated protein should be 675 amino acids long and the ¢rst 63 bp of ORF3 would contain the promoter and ribosome binding site regions. 3.2. Expression of the multipotent PPO enzyme and related products in E. coli In order to explore the correlation between actual amino acid length of PpoA, protein domains and PPO enzymatic activities, we proceeded to the recombinant expression in E. coli of several products. The ¢rst constructions generated were made with an approx. 2.2 kb fragment from the M. mediterranea genome. This fragment consisted of the complete ppoA gene plus 109 bp upstream from the longest ORF3. In this way, the putative native promoter region preceding the gene should be present in the construction. The fragment was cloned in pUC19 and pUC18, in order to obtain equivalent plasmids with opposite orientations of the same insert, and E. coli DH5K were transformed with both plasmids. Cells containing the pUC19 derived plasmid yielded a low DMPO activity (14.3 mU/mg of protein), but showed an aberrant growth. Other PPO activities were not clearly detected, presumably because the lower levels of sensitivity of these assays in comparison to DMPO. On the other hand, cells transformed with the pUC18 derived plasmid gave no PPO activity at all but grew normally. These observations indicate that the product encoding the ppoA gene was noticeably expressed in the orientation of pUC19, but it was not expressed at all in the opposite orientation on pUC18. In addition, the expression of PpoA had some toxic e¡ect, at least for cultures of the E. coli DH5K strain grown overnight. Finally, they also suggest that the low DMPO activ-

111

ity observed in the plasmid made with pUC19 is very likely due to residual expression of the ppoA protein product under the control of the L-lactamase gene promoter contained in the pUC19 vector. Thus, these data point out that the putative native promoter contained in the 5P upstream region of M. mediterranea is not e¤ciently recognized in E. coli. Due to the ine¤cient expression obtained with the pUC-derived plasmids, we constructed other plasmids using a pET11 expression vector and several fragments derived from the ppoA gene (Fig. 3) and ampli¢ed with appropriate primers. These fragments have been named according to the amino acid length of the encoded protein product. PPO695 and PPO675 correspond to the two most likely protein products starting respectively at Met 2 and 22 of ORF3. PPO578 corresponds to initiation at Met 98, and it lacks the N-terminus of the protein, including the signal peptide and the ¢rst H-rich cluster. PPO520 lacks the C-terminus of the protein, beyond

pET11 Amp T7 Promoter pPPO

695 675 578 520 403 Fig. 3. Constructions of di¡erent inserts related to the ppoA gene in pET11. Primers used to obtain the di¡erent inserts are described in Table 1. Full boxes indicate the position of the four copper-binding sites characteristic for laccases. Empty boxes indicate the two extra copper-binding sites detected in M. mediterranea PpoA.

BBAPRO 36409 25-4-01

112

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

the point of transposon insertion in the Tn101 strain. Finally, PPO403 is truncated at both ends, lacking the N-terminal and C-terminal peptides missing in PPO578 and PPO520 respectively. Using this approach and pET11, an expression vector with its own T7 promoter, all these fragments are expressed as such, and the complete fragment after the NdeI ligation site is translated to yield the respective protein products. All these plasmids were transformed into E. coli BL21(DE3) and their expression was assessed by SDS-PAGE followed by protein staining and, more speci¢cally, by determination of the PPO activities in crude extracts. It was noted that these activities were greatly increased by addition 0.1 mM of copper ions to the assay medium, suggesting that some copper chaperone present in M. mediterranea and needed to drive copper binding and yield the mature functional enzyme was missing in E. coli. The enzymatic activities were followed for 3 h after IPTG induction (Fig. 4). Maximal PPO activities were observed at short times after induction, 30 min, suggesting rapid modi¢cation and degradation of the recombinant protein products in E. coli BL21(DE3). Extracts from the host bacterial strain transformed with the expression vector pET11 without any insert were used as a negative control for the PPO determinations. These control extracts did not show any

Fig. 4. Time course of the DMPO activity in cellular extracts of E. coli transformed with pPPO695 after induction of expression by 1 mM IPTG. Activities are shown in the absence (b) and in the presence (F) of 0.1 mM cupric sulfate in the assay reaction medium.

TH, DO or SO activities, but they showed a residual DMPO activity. The same residual activity was also shown by E. coli extracts devoid of any plasmid. It is very likely due to the expression of a 54.3 kDa blue multicopper protein postulated from the systematic sequencing of the E. coli chromosome [34]. Further experiments are underway to clarify this point. However, the low DMPO activity detected in negative controls was clearly discernible from the authentic PPO activity derived from ppoA gene expression since: (i) it was rapidly inactivated (half-life around 2 min), whereas the recombinant M. mediterranea DMPO activity showed a linear activity during prolonged reaction times; (ii) it was located in the cytosolic fraction of E. coli, but the activity due to the recombinant PPO was mostly membrane-bound. The products encoded by plasmids pPPO695 and pPPO675 showed all tyrosinase and laccase activities, demonstrating the multipotent capacity of the protein encoded by the ppoA gene. DMPO was the activity showing the highest speci¢c activity and sensitivity in comparison to the other PPO assays. TH and DO activities were not activated by SDS, con¢rming that this feature is associated to the other PPO present in M. mediterranea. The di¡erent PPO activities measured in crude extracts of E. coli transformed with the appropriate constructions are plotted in Fig. 5. It can be observed that the activities obtained after transformation with pPPO695 were much higher than those observed after transformation with pPPO675. Regarding constructions with the truncated fragments of ppoA, tyrosinase-associated activities were also measurable in E. coli transformed with pPPO520, lacking the 3P-end of the gene and thus the C-terminal region of the protein. However, this construction was devoid of laccase-like activities, DMPO and SO. Bacteria transformed with pPPO578 and pPPO403 were negative for all tyrosinase and laccase activities except the residual DMPO activity also occurring in control cells. SDS-PAGE clearly revealed that the respective protein products were expressed and accumulated in the cells (gels not shown), so that they are enzymatically inactive. Finally, the distribution of tyrosinase and laccase activities between the soluble and the membranebound fractions was also studied in E. coli cells transformed with pPPO675 and pPPO695 and com-

BBAPRO 36409 25-4-01

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

Fig. 5. PPO activities in crude extracts of E. coli BL21(DE3) transformed with the expression vector pET11 (control) and other constructions containing inserts related to the ppoA gene in that vector. The data are the mean of a variable number of experiments, from n = 2 for pPPO520 to n = 6 for pPPO695.

pared to those found in M. mediterranea wild type (Table 2). Firstly, in both cases, the activities were predominantly located in the membrane fraction. This clearly indicates the presence of signal peptides in both forms of PpoA, the presumably native PPO675 and the longer version PPO695 extended in the N-terminus with the amino acids marked in Fig. 2 with a question mark. The membrane/soluble ratio for the DMPO activity was similar for both products (around 15), but the ratio of the DMPO to TH membrane-bound activities presented by the pPPO675 product (around 40) was higher than the one of the pPPO695 product and similar to the ratio in the native bacterial strain, M. mediterranea. 4. Discussion M. mediterranea is a marine bacterium showing a strong pigmentation during the stationary phase of growth. Previous biochemical characterizations [21,22] suggested the existence of two di¡erent PPOs: an unusual multipotent PPO able to oxidize substrates characteristic for both laccases and tyrosinases, and an SDS-activated tyrosinase devoid of laccase activity and involved in bacterial pigmentation. We obtained a mutant named Tn101 by transposon mutagenesis a¡ected in the multipotent ppoA gene that allowed its cloning, the con¢rmation of its

113

wide enzymatic activity, and the study of the structural requirements for its multipotency. As we were unable to get mutants in the SDS-activated tyrosinase gene, we used alternative techniques, but we also failed to detect the corresponding genes by Southern blot using as probes the prokaryotic tyrosinase from Rhizobium [35] and Streptomyces [36] or a fungal laccase [2]. This failure is very probably related to the low similarities among the PPO genes from di¡erent microorganisms. In fact, the overall similarity between the tyrosinase genes from Streptomyces and Rhizobium is as low as 17%. The ppoA gene showed a high similarity to blue multicopper laccases. Blast analysis versus GenBank and other public databases clearly indicates that the protein contains the four copper-binding sites characteristic of all laccases. However, the recognition of other motifs related to the tyrosinase-associated activities (TH and DO) attributed to this protein remained to be determined. Early attempts to express the ppoA gene by cloning in pUC vectors failed, presumably because the native promoter is not e¤ciently recognized in E. coli and the deleterious e¡ect of even low expression levels on the overnight culture growth. Therefore, we made several constructions of ppoA-derived fragments using the expression vector pET11, to measure the activity associated to each insert after transformation and induction in E. coli. The complete ORF3 for ppoA comprises 2091 bp and predicts a protein of 696 amino acids. Since Northern blot indicated that the size of mRNA is around 2.1 kb, the promoter region should be in the sequence shown at Fig. 2. However, no ribosome binding sites or promoter consensus could be detected immediately upstream from the ORF3 beginning. A putative ribosome binding site and sequences with signi¢cant similarity to the 310 and 335 regions' promoter consensus were detected inside ORF3 (Fig. 2). This suggests that the start codon of the native gene could correspond to the Met at position 22, and the predicted protein could be only 675 amino acids long. In that case, the ¢rst 63 bp of the ORF3 sequence contain the promoter and ribosome binding region and do not belong to the coding region. In addition, although in both cases the deduced polypeptidic chains of PPO695 and PPO675 showed a membrane-directed signal sequence with

BBAPRO 36409 25-4-01

114

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

two putative cleavage sites, computational analysis [37] of the predicted putative peptide signal sequence strongly supported the shortest version for ppoA. The length of these signal peptides would be respectively 46^51 or 25^30 amino acids depending on the cleavage site located between 46A and 47C and between 51Q and 52T. According to the mean length of the signal peptides in proteins from Gram-negative bacteria, which is 25.1 [37], a length of around 50 amino acids corresponding to the larger protein product is very unlikely in native enzymes. Finally, the DMPO/TH activity ratio in the membrane-bound fraction of PPO675 expressed in E. coli is about 40 (Table 2), very similar to the ratio observed in M. mediterranea extracts, but this ratio is around 15, much lower for PPO695 expressed in E. coli. These ratios also support that PPO675 is the native form of PPO in the marine bacteria. The expression in E. coli of di¡erent fragments indicates that the blue multicopper protein encoded by the ppoA gene is really a unique and multipotent PPO, as it is able to oxidize tyrosinase-speci¢c substrates, such as L-tyrosine, and laccase-speci¢c substrates, such as DMP or syringaldazine. In turn, the activity is higher for laccase substrates, such as DMP, in agreement with the higher similarity to laccases versus tyrosinases. TH and DO were not activated by SDS, con¢rming that this feature is associated to the second PPO present in M. mediterranea.

Although the levels of tyrosinase-associated activities expressed in E. coli were lower than in the native system, M. mediterranea, the activities measured were usually higher for the PPO695 product than for the PPO675 one. Although the e¡ect of such a long signal peptide in E. coli is unknown, it might be related to the higher activities found in cells transformed with pPPO695. So far, we cannot correlate this higher activity with a greater stability of the corresponding mRNA or the translated protein. E. coli transformed with pPPO578, lacking the Nterminal region of the protein and the ¢rst H cluster, but still containing the four characteristic copperbinding sites of fungal laccases, was devoid of enzymatic activities and undistinguishable from the control cells. These data point out that the signal peptide in the ppoA gene is surely involved not only in the translocation of the protein to the membrane but also in the correct folding of the molecule essential for laccase activity. Once established that M. mediterranea ppoA di¡ers from all other laccases reported so far in being also able to catalyze tyrosine hydroxylation, the domains speci¢cally involved in this extra tyrosinase activity were explored. Related to that, we found that the pPPO520 expression product, lacking the C-terminal region of the native protein, showed a signi¢cant TH but no laccase activity. This clearly points out that the PPO multiactivity resides in the whole molecule,

Table 2 Subcellular distribution of PPO activities (mU/mg, in the cytosolic and membrane-bound fractions) in M. mediterranea wild type (wt) and E. coli transformed with plasmids pPPO695 and pPPO675 wt Soluble fraction Tyrosine hydroxylase (TH) DOPA oxidase (DO) Dimethoxyphenol oxidase (DMPO) Syringaldazine oxidase (SO) Membrane-bound fraction TH DO DMPO SO DMPO/TH Membrane/soluble ratio TH DO DMPO SO

PPO695

20.1 106.0 226.5 51.3

2.3 4.3 41.1 4.0

88.5 839.0 3572.3 895.5 40.3

44.3 45.9 682.5 86.5 15.4

4.40 7.91 15.77 17.46

BBAPRO 36409 25-4-01

19.42 10.67 16.61 21.62

PPO675 7.3 1.9 5.6 not detected 2.1 0.3 82.0 9.2 39.0 0.28 0.05 14.64 ^

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

but tyrosinase activities imply the N-terminal region, whereas the C-terminal region is absolutely required only for laccase activity. Note that the N-terminal region contains two extra histidine-rich motifs that are speci¢c for this PPO but are not found in standard fungal laccases. This clearly suggests the involvement of at least one of these motifs in conferring the tyrosinase activity to this multipotent laccase. In agreement to these data, E. coli transformed with pPPO403, truncated at both ends, did not show any PPO activity. The distribution of PPO activities between the cytosolic and the membrane-bound fractions indicates that the signal peptide is recognized in E. coli, and that the peptide leads the protein to the membrane, as it occurs in the native M. mediterranea cells [23]. Related to the two possible cleavage sites for the signal peptide in the E. coli system, the ¢rst site (between 46A and 47C, analogous to other similar blue multicopper proteins [6,17]) would allow the conservation of the histidine cluster close to the N-terminus. However, provided that the preferred cleavage site might be the second one (51Q-52T), this histidine cluster would be partially lost in the mature protein. In that case, the histidine cluster located at positions 167^170 of the predicted protein should also be involved in the tyrosinase activity of the multipotent PpoA. Site-directed mutagenesis studies are planned in the near future to correlate the presence of these H clusters with the tyrosinase activity, similar to the mutagenesis studies recently carried out by other groups in the fourth copper-binding site of laccases [38]. The prokaryotic blue multicopper proteins constitute a group of proteins with di¡erent functions. Their putative PPO activities have not been characterized. Streptomyces phenoxazinone synthase is involved in antibiotic synthesis [14], CotA is expressed during the sporulation of Bacillus subtilis [15], the proteins from Pseudomonas and Xanthomonas are involved in copper resistance [16,17], and the laccase activity in A. lipoferum is under the same control as the synthesis of components of the respiratory chain [20] and it seems to be also involved in the pigmentation [18]. In M. mediterranea, the SDS-activated PPO seems to be su¤cient for pigmentation, and the involvement of the multipotent PPO in this process is uncertain. Aside bacteria, laccases are also

115

involved in the pigmentation of fungi producing dopamine [9] and dihydroxynaphthalene melanins [3]. In the last case, two multicopper PPOs seem to be involved in the melanin pathway, plus a tyrosinase also described in this microorganism, so that the presence of three PPOs is still an enigma concerning their respective functions. Our data suggest that melanization in M. mediterranea is regulated by tyrosinase. At this point it is unclear what kind of physiological role can be assigned to PpoA. In any case, its unusual multipotent PPO capacity makes it potentially interesting for the numerous biotechnological applications assigned to this type of enzymes. Acknowledgements This work has been supported by grant PB97-1060 from the DGICYT, Spain. P.L.-E. and E.F. were recipients of predoctoral fellowships respectively from Se¨neca Foundation `Comunidad Auto¨noma de Murcia' and `Ministerio de Educacio¨n y Cultura', Spain.

References [1] E.I. Solomon, T.E. Machonkin, U.M. Sundaram, in: A. Messerschmidt (Ed.), Multicopper Oxidases, World Scienti¢c, River Edge, NJ, 1997, pp. 103^128. [2] P.M. Coll, C. Tabernero, R. Santamar|¨a, P. Pe¨rez, Appl. Environ. Microbiol. 59 (1993) 4129^4135. [3] H.F. Tsai, M.H. Wheeler, Y.C. Chang, K.J. Kwon-Chung, J. Bacteriol. 181 (1999) 6469^6477. [4] M. Mansur, T. Sua¨rez, J.B. Ferna¨ndez-Larrea, M.A. Brizuela, A.E. Gonza¨lez, Appl. Environ. Microbiol. 63 (1997) 2637^2646. [5] P.R. LaFayette, K.E.L. Eriksson, J.F. Dean, Plant Physiol. 107 (1995) 667^668. [6] R. Sterjiades, J.F.D. Dean, K.E.L. Eriksson, Plant Physiol. 99 (1992) 1162^1168. [7] D.M. O'Malley, R. Whetten, W. Bao, C. Chen, R.R. Sedero¡, Plant 4 (1993) 751^757. [8] W.E. Timberlake, E.C. Barnard, Cell 26 (1981) 29^37. [9] P.R. Williamson, K. Wakamatsu, S. Ito, J. Bacteriol. 180 (1998) 1570^1572. [10] G. Leatham, M.A. Stahman, J. Gen. Microbiol. 125 (1981) 147^157. [11] C. Eggert, U. Temp, K.E.L. Eriksson, Appl. Environ. Microbiol. 62 (1996) 1151^1158. [12] C.F. Thurston, Microbiology 140 (1994) 19^26.

BBAPRO 36409 25-4-01

116

A. Sanchez-Amat et al. / Biochimica et Biophysica Acta 1547 (2001) 104^116

[13] G. Alexandre, I.B. Zhulin, Trends Biotechnol. 18 (2000) 41^ 42. [14] C.J. Hsieh, G.H. Jones, J. Bacteriol. 177 (1995) 5740^5747. [15] W. Donovan, L.B. Zheng, K. Sandman, R. Losick, J. Mol. Biol. 196 (1987) 1^10. [16] Y.A. Lee, M. Hendson, N.J. Panopoulos, M.N. Schroth, J. Bacteriol. 176 (1994) 173^188. [17] M.A. Mellano, D.A. Cooksey, J. Bacteriol. 170 (1988) 2879^ 2883. [18] D. Faure, M.L. Bouillant, R. Bally, Appl. Environ. Microbiol. 60 (1994) 3413^3415. [19] A. Givaudan, A. E¡osse, D. Faure, P. Potier, M.L. Bouillant, R. Bally, FEMS Microbiol. Lett. 108 (1993) 205^210. [20] G. Alexandre, R. Bally, B.L. Taylor, I.B. Zhulin, J. Bacteriol. 181 (1999) 6730^6738. [21] A. Sanchez-Amat, F. Solano, Biochem. Biophys. Res. Commun. 240 (1997) 787^792. [22] F. Solano, E. Garc|¨a, E. Pe¨rez de Egea, A. Sanchez-Amat, Appl. Environ. Microbiol. 63 (1997) 3499^3506. [23] F. Solano, P. Lucas-El|¨o, E. Ferna¨ndez, A. Sanchez-Amat, J. Bacteriol. 182 (2000) 3754^3760. [24] F. Solano, A. Sanchez-Amat, Int. J. Syst. Bacteriol. 49 (1999) 1241^1246. [25] G. Andrykovitch, I. Marx, Appl. Environ. Microbiol. 54 (1988) 1061^1062. [26] B.M. Moore, W.H. Flurkey, J. Biol. Chem. 265 (1990) 4982^ 4988.

[27] C. Wittenberg, E.L. Triplett, J. Biol. Chem. 260 (1985) 12535^12541. [28] M.F. Alexeyev, I.N. Shokolenko, Gene 160 (1995) 59^62. [29] E. Ferna¨ndez, A. Sanchez-Amat, F. Solano, Pigment Cell Res. 12 (1999) 331^339. [30] J. Sambrook, E.J. Fritsch, T. Maniatis, Molecular Cloning : a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [31] U.K. Laemli, Nature 227 (1970) 680^685. [32] J.R. Jara, F. Solano, J.A. Lozano, Pigment Cell Res. 1 (1988) 332^339. [33] V.M. de Lorenzo, K.N. Timmis, Methods Enzymol. 235 (1994) 386^405. [34] F.R. Blattner, G. Plunkett, C.A. Bloch, N.T. Perna, V. Burland, M. Riley, J. Collado-Vides, J.D. Glasner, C.K. Rode, G.F. Mayhew, J. Gregor, N.W. Davis, H.A. Kirkpatrick, M.A. Goeden, D.J. Rose, B. Mau, Y. Shao, Science 277 (1997) 1453^1474. [35] J. Mercado-Blanco, F. Garcia, M. Fernandez-Lopez, J. Olivares, J. Bacteriol. 175 (1993) 5403^5410. [36] M. Herrero, V. de Lorenzo, K.N. Timmis, J. Bacteriol. 172 (1990) 6557^6567. [37] H. Nielsen, J. Engelbrecht, S. Brunak, G. von Heijne, Protein Eng. 10 (1997) 1^6. [38] F. Xu, R. M Berka, J.A. Wahleithner, B.A. Nelson, J.R. Shuster, S.H. Brown, A.E. Palmer, E.I. Solomon, Biochem. J. 334 (1999) 63^70.

BBAPRO 36409 25-4-01