Molecular cloning and RNA interference analysis of β-N-acetylglucosaminidase in Mamestra brassicae L.

Journal of Asia-Pacific Entomology 19 (2016) 721–728

Contents lists available at ScienceDirect

Journal of Asia-Pacific Entomology journal homepage: www.elsevier.com/locate/jape

Molecular cloning and RNA interference analysis of β-N-acetylglucosaminidase in Mamestra brassicae L. Huan Zhang, Kuijun Zhao, Dong Fan ⁎ College of Agronomy, Northeast Agricultural University, Harbin 150030, China

a r t i c l e

i n f o

Article history: Received 1 October 2015 Accepted 20 June 2016 Available online 1 July 2016 Keywords: β-N-acetylglucosaminidase Mamestra brassicae L. Cloning Expression RNA interference

a b s t r a c t β-N-acetylglucosaminidase plays an important role in insect chitin degradation. In this study, a novel cDNA sequence encoding β-N-acetylglucosaminidase (MbNAG) was cloned from cabbage moth, Mamestra brassicae L. The cDNA sequence, which was 2445 bp in length, contained an open reading frame of 1782 bp coding for a polypeptide of 594 amino acid residues. The MbNAG open reading frame was cloned into the pET-21b prokaryotic expression vector, and then over-expressed in Escherichia coli BL21 (DE3) cells. After purification and renaturation, the β-N-acetylglucosaminidase enzymatic activity was detected. Transcript analyses on MbNAG sequence during different developmental stages and in specific tissues were carried out by RT-qPCR. The MbNAG mRNA level was significantly higher of the second day in the prepupal stage than at any other time and occurred mainly in the midguts and salivary glands compared with in other tissues, including fat bodies, integuments, malpighian tubules, foreguts and hindguts during the feeding stage of the 5th instar larvae. The highest expression level of MbNAG mRNA occurred 48 h after an in vivo injection of 20-hydroxyecdysone. RNA interference reduced the MbNAG mRNA expression level 60% at 48 h and 67% at 72 h, respectively, and induced both abnormal molting phenotypes and a high mortality rate in M. brassicae larvae. These results suggest that MbNAG plays an essential role in the molting process of M. brassicae. © 2016 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.

Introduction Chitin, a linearly bound polymer of β-1,4-linked 2-acetamido-2deoxy-D-glucopyranoside, is an essential component of cuticular exoskeleton and tracheae of insects, and plays an important role as a physiological barrier throughout their life. The size of exoskeleton restricts the size of insect body, thus, biosynthesis and degradation of chitin is strictly controlled during the molting process. In the beginning of molting, insects secrete a “molting fluid”, which contains hydrolytic enzymes to degrade chitin and cuticlar proteins. Chitin degradation is mediated by two different enzymes, chitinase (EC 3.2.1.14) and β-N-acetylglucosaminidase (NAG; EC 3.2.1.30) (Fukamizo and Kramer, 1985). Chitinase hydrolyzes chitin polymers into oligosaccharides, then, NAG further degrades these oligosaccharides into N-acetylglucosamine monomers from nonreducing end (Zen et al., 1996). In the later phase of molting, these monomeric carbohydrates are reused for the synthesis of cuticlar exoskeleton of outgrown insects (Nagamatsu et al., 1995). NAG is distributed in a wide range of organisms, such as viruses, fungi, bacteria, plants and animals (Lerouge et al., 1998; Li et al., 2002; Tomiya et al., 2004). In insect species such as dipteran, lepidopteran,

⁎ Corresponding author. E-mail addresses: [email protected] (H. Zhang), [email protected] (D. Fan).

coleopteran, and orthopteran insects, several types of NAGs, which may paly distinct roles in chitin metabolism, have been identified and deposited in the public databases. In the previous papers it has been reported that the expression of NAG occur in insects in developmental stage-dependent and tissue-specific fashion. In lepidopteran insects, Choristneura fumiferana, high levels of NAG were detected in the molting fluid, epidermis, trachea, and hemolymph on the last day of 5th instar and the first day of6th instar, followed by a decrease to background levels during late 6th instar (Zheng et al., 2008). In coleopteran insects, Tribolium castaneum, four different NAG genes, TcNAG1, TcFDL (an N-linked glycan-specific NAG), TcNAG2, and TcNAG3, have been identified in the genome. Although all these NAG genes are constitutively transcribed throughout the development, each gene has a distinct spatial and temporal expression pattern. TcNAG1 transcripts are the most abundant, particularly at late pupal stage, while TcNAG3 transcripts are the least abundant, even at the peak levels in late larval stages (Hogenkamp et al., 2008). In lepidopteran insects, Bombyx mori, four BmNAGs and one BmFDL genes have been discovered. The expression level of BmNAG1 is the highest in epidermis, but is decreased in silk glands and malpighian tubules. The expression levels of BmNAG2, BmNAG3 and BmNAG4 are similar and most abundantly expressed in ovary. High level expression of BmFDL high in testis has been reported (Zhai et al., 2014). BmNAG2 is expressed developmental stagedependently in embryos and in certain tissues of molting larvae (i.e.

http://dx.doi.org/10.1016/j.aspen.2016.06.012 1226-8615/© 2016 Korean Society of Applied Entomology, Taiwan Entomological Society and Malaysian Plant Protection Society. Published by Elsevier B.V. All rights reserved.

722

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

ovary, fat bodies, mid-intestine and skin), but not in pupae (Kokuho et al., 2010). These characteristic patterns of NAG expression may be affected by hormonal regulation during ecdysis. In Manduca sexta, NAG mRNA levels increase N10-fold in epidermis within 2 days after the treatment with 20-hydroxyecdysone (20E) (Zen et al., 1996). It has been reported that, in B. mori, expression levels of all BmNAG genes are significantly upregulated by ecdysone after 48–72 h of injection (Zhai et al., 2014). Because of its unique role in insect metamorphosis, alteration of the function and/or expressional regulation of NAGs could be an alternative target in the development of novel pesticides to control devastating pests, such as Mamestra brassicae L. (Noctuidae). M. brassicae L., which is known as cabbage moth, has a widespread distribution around the world, mainly in Europe and Asia (Finch and Thompson, 1992; Shi et al., 2005). It is a serious polyphagous pest species with a wide species diversity of N120 species within 45 families (Wu, 2009), and causes devastating damages on agricultural production. In the previous study, this pest species causes about 20% of whole vegetables harvest each year (Zhang et al., 2008). In this study, we cloned cDNA sequence of NAG of M. brassicae origin (named MbNAG), and produced the recombinant protein to confirm its enzymatic activity. We also examined the expression patterns and hormonal regulation as well as biological function using RNAi in vivo. The characteristics of MbNAG presented in this report may provide useful information to develop novel strategies for pest control in future.

Table 1 Primers used in this study Usage and primer name RT-PCR and RACE MbNAG-F MbNAG-R MbNAG 3′-RACE-outer MbNAG 3′-RACE-inner MbNAG 5′-RACE-outer MbNAG 5′-RACE-inner Prokaryotic expression exMbNAG-F exMbNAG-R RT-qPCR analysis qMbNAG-F qMbNAG-R qβ-actin-F qβ-actin-R dsRNA construction dsMbNAG1-F dsMbNAG1-R dsMbNAG2-F dsMbNAG2-R

Materials and methods

dsEGFP1-F

Experimental insects

dsEGFP1-R dsEGFP2-F dsEGFP2-R

Adults of M. brassicae were obtained from the Agricultural Experiment Station, Northeast Agricultural University, Harbin, China. Adults were reared in net cages under 70% relative humidity and were routinely fed 5% honey water to provide supplementary nutrition. Eggs were collected from cabbage leaves and kept in insect-rearing cups under 80% relative humidity until hatching. Newly hatched larvae were reared on cabbage leaves under long-day conditions (L:D = 14:10) at 26 ± 1 °C and 70% relative humidity. Larvae were reared to different developmental stages for testing.

Cloning of the full-length MbNAG cDNA sequence Total RNA was isolated from 2-day-old 5th instar larvae using TRIzol reagent (Invitrogen, USA). Contaminating genomic DNA was removed from total RNA using DNAse I (Sigma, USA) following the manufacturer's protocol, and DNA-free RNA served as the template for complementary cDNA synthesis using reverse transcriptase III (Invitrogen) and oligo-(dT)18 according to the manufacturer's instructions. Specific fragment was cloned using primers MbNAG-F and MbNAG-R (Table 1) designed based on other NAGs for PCR. 5′and 3′-RACE was carried out to obtain the 3′- and 5′- end of the cDNA sequence using the SMARTer RACE cDNA amplification kit (Clontech, USA). The PCR primers are shown in Table 1. PCR conditions were as follows: one cycle of denaturation at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 55 °C for 30 s, and primer extension at 72 °C for 2 min, followed by a final extension step at 72 °C for 10 min. The PCR products were purified using purification kit (Takara Biotechnology, China) and cloned into the pEasy-T1 vector (TransGen Biotech, China). After transformation into the competent cells of Escherichia coli DH5a, recombinant bacteria were confirmed by PCR. Three of the positive clones were sequenced in both directions. After the 5′-end and 3′-end sequences were obtained, contigs were assembled to produce putative fulllength sequence of MbNAG.

Primer sequence (5′–3′)

Efficiency

ACCTTCCACTGGCACATCAC AGCCTTGTAAGCCCTATCCT AGGTCAGCGAGCGCTGCTGGAACTCATC TCTTGAAGCTCTGGAACTACTTCCAG AGACGGTGAGGCCGGTGTCCT CCGCGCACCA GCCCGTACTC CACCAC

CCCAAGCTTGGATGAGGTATCACCATGGAGAT GGTC CGCGGATCCTCGGTAGCAGTGGCCTTCGTTC GCCTAAAGCAACTGGAAAAGC CCTGAGCCCAAAGAACGAG CCAACGGCATCCACGAGACCA TCGGCGATACCAGGGTACAT

98% 101%

TAATACGACTCACTATAGGGGCAAAGATTGGC GCTTACTC ATCTGTCAAGGTGCTGGTCC GCAAAGATTGGCGCTTACTC TAATACGACTCACTATAGGGATCTGTCAAGGTGC TGGTCC TAATACGACTCACTATAGGGGACGTAAACGGC CACAAGTT GGGGTGTTCTGCTGGTAGTG GACGTAAACGGCCACAAGTT TAATACGACTCACTATAGGGGGGGTGTTCTGCTG GTAGTG

Sequence characterization and phylogenetic analysis The sequence of MbNAG cDNA was compared with those of other NAG sequences deposited in GenBank using the “BLAST” tool available on the National Center for Biotechnology Information (NCBI) website. The amino acid sequence of MbNAG was deduced from the corresponding cDNA sequence using the translation tool at the ExPASy Proteomics website (http://web.expasy.org/translate/). Motifs were confirmed by scanning the Prosite database (http://prosite.expasy.org/). Signal peptide was predicted with SignalP 4.1 Server (http://www.cbs.dtu. dk/services/SignalP/). The molecular mass and isoelectric point (pI) was predicted with Compute pI/Mw tool (http://web.expasy.org/ compute_pi/). After MbNAG and other insect NAGs were aligned using ClustalW program software (http://www.clustal.org/), a phylogenetic tree was generated using MEGA 6.0 software (http://www.megasoftware.net/) and the neighbor-joining method. To evaluate the branch strengths of the phylogenetic tree, a bootstrap strength analysis of 1000 replications was performed. In vitro prokaryotic expression and the enzyme activity assay The MbNAG open reading frame (ORF) was amplified using primers designed based on the deduced amino acid sequence of MbNAG and the restriction sites for BamHI and NotI were included at the ends of the primers (Table 1). PCR conditions were as described earlier. PCR products were purified using the purification kit and cloned into the pEasy-T1 vector for sequence confirmation. The MbNAG ORF and pET-21b were digested with BamHI and NotI to construct the plasmid pET-MbNAG. The cloning and expression plasmids were confirmed by double-digestion-based identifications and sequence analyses.

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

The recombinant plasmid pET-MbNAG was transformed into E. coli BL21 (DE3) competent cells and cultured in LB medium as described by Sambrook and Russell (2002). The bacterial culture was centrifuged at 5000 × g for 5 min. The supernatant was removed. The precipitate was suspended in PBS, and sonicated on ice for 30 min using the following conditions: 200 W for 10 s with 10 intervals. The solution was centrifuged at 12,000 × g at 4 °C for 20 min, and the supernatant and precipitate were collected separately for SDS-PAGE. 12% separation gel was prepared according to the published protocol (Sambrook and Russell, 2002). The supernatant and pellet samples were mixed or dissolved with loading buffer, the gel was stained by Coomassie brilliant blue R250 as described in the protocol. The pellets prepared as described above were dissolved and denatured in the PBS containing 8 M urea and incubated at room temperature for 30 min. The insoluble material was removed by centrifugation at 12,000 × g for 30 min. The supernatant of solubilized inclusion body was used for purification using a Ni-NTA matrix column. The recombinant protein with a C-terminal 6 × His-tag was purified following the manufacturer's handbook (TransGen Biotech). After adequately washing with the binding buffer, the protein was eluted with a high concentration of imidazole (500 mM). The eluted protein was loaded in a dialysis bag and dialyzed for 24 h at 4 °C to remove excess imidazole. The purified protein was analyzed by 12% SDS-PAGE. For further confirmation, the purified protein was subjected to a western blot analysis. The protein was electrophoretically transferred to polyvinylidene difluoride membrane, blocked with 5% nonfat milk for 1 h, and then incubated with anti-His-tag monoclonal antibody diluted to 1:500 at 4 °C overnight. The membrane was then washed and incubated with an anti-mouse secondary antibody (CLONE: 4A12E4) (Invitrogen) diluted to 1:1000 at room temperature. The result was observed by developing with diaminobenzidine. Purified MbNAG was renatured by dialysis. The dialysis cassette containing the purified MbNAG solution was successively placed into beakers containing 400 ml dialysis buffer I, buffer II, buffer III, buffer IV and buffer V and stirred at 4 °C for 4 h. These five buffers have the same components (100 mM NaH2PO4, 10 mM Tris-base, 0.4 M L-arginine, 5 mM GSH, 1 mM GSSG and 5% saccharose, pH 8.0) except different concentrations of guanidine·HCl (6 M in buffer I, 4 M in buffer II, 2 M in buffer III, 1 M in buffer IV and 0.5 M in buffer V). The solutions were filtered using 0.45-μm membranes to ensure that the solutions were sterile, and active MbNAG was recovered. The protein concentration was determined using the bicinchoninic acid assay (Pierce, USA). Bovine serum albumin was used as the standard protein. The activity of MbNAG was measured based on the methods described by Lin et al. (2003); Kim et al. (2011) and Zhu et al. (2015). 4-nitrophenyl-N-acetyl-β-D-glucosaminide was used as the zymolyte. The effect of pH on NAG activity was determined using different pH buffers (pH 4–10). The concentration of all of the buffers was 0.2 M. The buffer contained sodium citrate at pH 4.0, sodium acetate at pH 5, sodium phosphate at pH 6.0–8.0 and glycineNaOH at pH 9–10. Enzymatic reactions were performed in 0.8-ml reaction mixtures containing 0.2 ml 4-nitrophenyl-N-acetyl-β-D glucosaminide (2 mg/ml), 0.4 ml renatured MbNAG (0.5 μg) solution and 0.2 ml of a buffer with a different pH at 37 °C for 2 h. Then, 0.4 ml of NaOH (0.5 mM) was added to terminate the reaction. Enzymatic activity was determined by measuring the absorbance value of the reaction sample at 405 nm using a UV–visible spectrophotometer. The effect of temperature on enzymatic activity was measured using the same amounts of enzyme, buffer and substrate as used for the pH profile. The pH of the buffer used to measure enzymatic activity was the optimal pH for the enzyme. The temperature range used in the assay was 15–65 °C and the incubation time was 2 h.

723

Tissue- and stage-dependent expression patterns of MbNAG The relative expression of MbNAG in different tissues was evaluated by a reverse transcription quantitative PCR (RT-qPCR) analysis. Ten 2-day-old 5th instar larvae were put into RNA later (Sigma) and dissected for foreguts, midguts, hindguts, fat bodies, salivary glands, malpighian tubules and integuments. Total RNA isolation and cDNA synthesis was as described earlier. The primers used for the RTqPCR analysis are shown in Table 1. β-actin was used as a internal reference gene. The amplification efficiency of the gene was estimated by primer efficiency test. The reaction solution with 1 μl of the reverse- transcription product and 0.4 mM of each primer in a total volume of 20 μl was carried out via qPCR using the THUNDERBIRD SYBR qPCR Mix kit (Toyobo Life Science, Japan) according to the kit instructions. qPCR was performed using an iCycler iq5 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA). The cycling parameters consisted of an initial denaturation at 94 °C for 3 min, followed by 40 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s. A melt curve was performed for each experiment to confirm the amplification specificity. qPCR Cq values were calculated from triplicate independent PCR reactions containing all of the samples, standards and controls. All of these experiments were performed using three biological replicates, each with three technical replicates. The iq5 Optical System software v. 2.0 was used as the analysis software. The 2−ΔΔCT method was used to calculate the relative levels of MbNAG transcripts in different tissues (Pfaffl, 2001). The relative expression of MbNAG at different developmental stages was also evaluated by RT-qPCR. Total RNA from the 2-day-old 1st through 6th instar larvae, prepupae and pupae was isolated independently for RT-qPCR analysis. Hormonal regulation of the MbNAG gene For the in vivo stimulation with 20E, 160 2-day-old 4th instar larvae were divided into three experimental groups and a control group, each containing 40 larvae. Then, 5 mg of 20E was dissolved in 4 ml absolute ethanol, and DEPC water was added to prepare the test solution. Using a manual microinjector, 1 μl of test solution (20E concentrations of 2 μg/μl, 6 μg/μl and 18 μg/μl) was injected into each larva through the abdomen between the seventh and eighth abdominal segment. Three individuals were randomly chosen for analysis at 12 h, 24 h, 48 h and 96 h after injection from each group. The total RNA samples were immediately extracted for RTqPCR analysis. In vivo RNAi targeting the MbNAG gene For dsRNA synthesis, a 498 bp and a 500 bp fragment corresponding to MbNAG and the enhanced green fluorescent protein gene (EGFP) respectively were individually subcloned into pGEMT Easy cloning vector (Invitrogen), and the diluted plasmids were used as templates for amplification by PCR using specific primers (Table 1) conjugated with the T7 RNA polymerase promoter (5′TAATACGACTCACTATAGGG-3′). EGFP was used as a negative control for the non-specific effects of dsRNA. The templates were synthesized using the following PCR protocol: 94 °C for 5 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s and 72 °C for 30 s, followed by a final extension of 72 °C for 10 min. The PCR products of MbNAG and EGFP were separated on agarose gels, purified using the purification kit (Takara Biotechnology) and used for in vivo transcription with the T7 RiboMAXTM Express RNAi System (Promega, USA), according to the manufacturer's instructions. To remove the template DNA and single-stranded RNA, the reaction buffer of the synthesized dsRNA was treated with DNase and RNase. The dsRNA was isopropanol precipitated, dissolved in nuclease-free water and analyzed on a 1.0% agarose gel electrophoresis to determine the purity

724

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

and integrity. To determine an appropriate dosage of dsRNA for the experiments, larvae were divided into three groups, and in each group the larvae were individually injected with 2, 4 or 8 μg of dsRNA. Insects were collected at 72 h after the treatment. The injection of 8 μg could inhibit the expression of interested genes; therefore, this dose was used in the following experiments. Using a manual microinjector, 2-day-old 4th instar larvae were injected with MbNAG and EGFP dsRNA through the abdomen between the seventh and eighth segments. Each group consisted of 24 individual larvae and the experiment was repeated three times. At 24 h, 48 h and 72 h after dsRNA injection, three larvae were collected from each replication and the suppression of MbNAG was analyzed by RT-qPCR. The abnormalities and mortality rates of other 45 larvae were recorded and analyzed.

Statistical analysis All of the statistics were performed using SPSS 18.0 software package (IBM Corp., Armonk, New York, USA). The statistical significances of differences in data were examined using a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test, and p b 0.05 was accepted as statistically significant.

Results Identification of the NAG gene in M. brassicae The full-length MbNAG cDNA sequence was obtained by RT-PCR and RACE. The cDNA sequence consisted of 2445 bp with 94- and 569-bp 5′and 3′-untranslated regions, respectively. The ORF of MbNAG (1782 bp) encodes 594 amino acid residues (Fig. 1). The calculated molecular mass (MM) and isoelectric point (PI) of the predicted protein are ~67.8 kDa and 5.61, respectively. The GenBank accession number is KP730442. A putative signal peptide was predicted using the SignalP 4.0 server, and is located between the 1st and 23rd amino acids at the N-terminal of the sequence. Three potential N-glycosylation sites from amino acids 165 to 168, 336 to 339, and 375 to 378 were predicted using NetNGlyc 1.0 software. There are two highly conserved regions in the amino acid sequence. They extend from positions 204 to 253 and from positions 358 to 374. A part of the second conserved HXGGDEVXXCW motif is considered the catalytic site (Prag et al., 2000). Phylogenetic analysis of MbNAG and other insect NAGs Because MbNAG shared a high sequence similarity with other insect NAGs, a phylogenetic tree was generated using MEGA 6.0 using insect

Fig. 1. Full length nucleotide and deduced amino acid sequences of MbNAG. The start codon (ATG), stop codon (TGA) and putative polyadenylation (AATAAA) site are highlighted in black. The putative signal peptide is underlined. The three potential N-glycosylation sites are boxed. Both the 5′- and 3′-untranslated regions are shown without amino acids. The conserved motifs among the 20 glycosyl hydrolases are highlighted in gray areas indicate. The nucleotide sequence is available in GenBank (Accession no. KP730442).

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

725

Fig. 2. Phylogenetic analysis of MbNAG and other known insect NAGs. MEGA 6.0 was used to construct the consensus phylogenetic tree with the Neighbor-Joining method. Bootstrap analyses of 1000 replications are shown. GenBank accession numbers are as follows: AiNAG, Agrotis ipsilon (ADF56765); XcNAG, Xestia c-nigrum (ACR57832); MbNAG, Mamestra brassicae (KP730442); TnNAG, Trichoplusia ni (AAL82580); MsNAG, Manduca sexta (AAQ97603); CfNAG, Choristoneura fumiferana (AAX94571); DmNAG1, Drosophila melanogaster (NM_079200); LmNAG, Locusta migratoria (AFZ76982); AgNAG2, Anopheles gambiae (XP_307483); AaNAG2, Aedes aegypti (EAT40440); DmNAG2, Drosophila melanogaster (NM_080342); AmFDL, Apis mellifera (XP_394963); TcFDL, Tribolium castaneum (NM_001098826); DmFDL, Drosophila melanogaster (NP_725178); AaFDL, Aedes aegypti (EAT36388); AgFDL, Anopheles gambiae (XP_308677); AaHEX, Aedes aegypti (EAT43655); AgHEX, Anopheles gambiae (XM_319210); BmHEX, Bombyx mori (AAT99455); SfHEX1, Spodoptera frugiperda (ABB76924); SfHEX2, Spodoptera frugiperda (ABA27427).

NAGs and related hexosaminidases (Fig. 2). All of the NAGs and hexosaminidases were classified into four major classes: NAG group I, NAG group II, N-glycan processing NAGs (group III) and hexosaminidases (group IV) (Leonard et al., 2006; Hogenkamp et al., 2008). MbNAG belonged to group I, which included NAGs from M. sexta, Drosophila melanogaster, Locusta migratoria, C. fumiferana, T. ni, Agrotis ipsilon and Xestia c-nigrum. MbNAG was most similar to those from A. ipsilon and X. c-nigrum, sharing 84% and 85% sequence identity, respectively.

Expression and enzymatic activity of the recombinant MbNAG Recombinant MbNAG was expressed in E. coli. The bacterial cells were broken by ultrasonic and the supernatant and pellet were analyzed by 12% SDS-PAGE. The specific band of recombination protein only existed in the pellet, this result indicated that the expressed protein mainly accumulated in the form of inclusion body. After the purification and western blot analysis, the SDS-PAGE gel showed that the recombinant protein was the protein of interest with a molecular mass of ~68 kDa (data not shown), which was similar to the predicted protein molecular mass. The purity of the fusion protein was very high with few other contaminating proteins (data not shown). After denaturation, the activity of the expressed MbNAG was investigated at different pH values, ranging from 4.0 to 10.0, and at different temperatures, ranging from 15 to 65 °C. The results showed that this enzyme had a broader optimum pH range. From pH 4.0 to 8.0, the enzymatic activity increased gradually and the highest activity was observed between pH 7.0 and 8.0. At pH 9.0, the enzymatic activity decreased suddenly (Fig. 3A). The effect of temperature on MbNAG activity was investigated at temperatures between 15 and 65 °C at the optimal pH 8.0. The optimal

temperature for enzymatic activity was 35 °C, but the enzyme retained obvious activity even at 55 °C. At 65 °C, the enzymatic activity was hardly detectable (Fig. 3B). Tissue- and developmental stage-specific expression of MbNAG The MbNAG mRNA transcripts could be detected at varied levels in seven tissues. The MbNAG expression levels in midguts and salivary glands were significantly higher: ~3-fold more than in foreguts, integuments and malpighian tubules (Fig. 4). The MbNAG expression levels in different developmental stages were also determined. MbNAG was constitutively expressed at all eight of the examined developmental stages; however, the expression levels varied significantly. MbNAG mRNA increased gradually from the 1st instar larval stage to the prepupal stage, and it was at a high level during the prepupal stage, while it declined to a low level at the pupal stage (Fig. 5). Hormonal regulation of MbNAG The effect of a morphogenetic hormone on MbNAG expression was analyzed by the injection of 20E. At the 2 μg/μl concentration, the MbNAG expression level was the same as that of the control. At the 6 μg/μl and 18 μg/μl concentrations, the MbNAG expression levels increased to their maximums, 3.92- and 6.56-fold higher than the control, respectively, at 48 h and then decreased (Fig. 6). Effect of dsRNA on MbNAG mRNA expression level The RT-qPCR results of MbNAG RNAi silencing showed clearly that MbNAG was greatly down-regulated, while there was no significant

726

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

Fig. 5. The MbNAG mRNA expression pattern at different developmental stages. Total RNA was isolated from whole bodies of 1st to 6th instar larvae, prepupae and pupae. L1: 1st instar larvae, L2: 2nd instar larvae, L3: 3rd instar larvae, L4: 4th instar larvae, L5: 5th instar larvae, L6: 6th instar larvae, PPu: prepupae, and Pu: pupae. This experiment was performed in triplicate, and the mean ± SE was calculated to measure the relative transcript level using the 2−△△CT &&method. The relative expression levels are the ratios of relative copy numbers in specific developmental stages of individuals. The statistical significances of differences in data were examined using a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test. The averages marked with the same lowercase letter are not statistically different at p b 0.05.

the mortality rate of larvae injected with the dsRNA of EGFP was 10%, and they did not show abnormal molting phenotypes (Fig. 8). Discussion Fig. 3. Effects of pH and temperature on MbNAG enzymatic activity. MbNAG enzymatic reactions were performed for 2 h in 0.8 ml reaction mixtures, containing 0.2 ml 4nitrophenyl-N-acetyl-β-D-glucosaminide (2 mg/ml), 0.4 ml renatured MbNAG (0.5 μg) solution and 0.2 ml buffer (0.2 M) at A) different pH levels at 37 °C or B) different temperatures at pH 8.0. Enzymatic activity was determined by measuring the absorbance value of the reaction sample using a UV–visible spectrophotometer at 405 nm. The statistical significances of differences in data were examined using a oneway analysis of variance (ANOVA) followed by Duncan's multiple range test. The averages topped with the same letters are not statistically different at p b 0.05. These experiments were performed in triplicate.

decrease in the EGFP transcript level. The MbNAG expression level was reduced by 60% at 48 h and 67% at 72 h compared with the control (Fig. 7). Of the 45 5th instar larvae injected with dsRNA of MbNAG, 21 larvae died before they developed into pupae. These larvae expressed abnormal phenotypes and failed to molt. Two larvae molted to adults but died soon afterward. The total mortality rate was 52%. However,

Fig. 4. The MbNAG mRNA expression pattern in different tissues. Graphic representation of relative MbNAG transcript levels measured in different tissues of 5th instar larvae using RT-qPCR. All of the tissues were dissected from 2-day-old 5th instar larvae. The abbreviations on the x-axis: FG: foreguts; MG: midguts; HG: hindguts; FB: fat bodies; IN: integuments; MT: malpighian tubules; and SG: salivary glands. This experiment was performed in triplicate, and the mean ± SE was calculated to measure the relative transcript level using the 2−△△CT method. The relative expression levels are the ratios of relative copy numbers in different tissues of individuals. The statistical significances of differences in data were examined using a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test. The averages marked with the same lowercase letter are not statistically different at p b 0.05.

Insect NAGs have been documented in several coleopteran, orthopteran, and lepidopteran insect species in recent years (Hogenkamp et al., 2008; Rong et al., 2013; Zhai et al., 2014). NAG was studied in N-glycan processing and complex-type N-linked glycan synthesis in cell lines (Aumiller et al., 2006; Geisler and Jarvis, 2010; Nagata et al., 2013). However, information on the sequence and basic functions of NAG in M. brassicae were still unknown. In this paper, a novel full-length cDNA sequence of NAG in M. brassicae was reported, and its biological functions were studied. Four major groups, NAG group I, NAG group II, N-glycan processing NAGs (group III), and hexosaminidases (group IV) (Hogenkamp et al., 2008), were identified in the NAG phylogenetic constructed using the neighbor-joining method. MbNAG belonged to the chitinolytic NAG group I. The phylogenetic tree indicated that there might be more than one NAGs in insects. In 2008, Hogenkamp and his colleagues identified four NAGs in T. castaneum. These four NAG genes have only 40–50% similarity between each other at amino acid level. In 2014, four BmNAGs and one BmFDL genes were discovered in B. mori. We deduce that there might be other NAG genes in the M. brassicae. This hypothesis requires further research.

Fig. 6. Effect of 20E on the expression level of MbNAG mRNA. This experiment was performed to measure the relative transcript level at different concentration and different time of treatment using the 2−△△CT method. Each bar represents means ± SE from data obtained from three individuals having three technical replicates each. The statistical significances of differences in data were examined using a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test. Different lowercase letters above the bar graphs indicate significant differences (p b 0.05) between the 20Etreatment group and the control group.

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

Fig. 7. Effect of RNAi on the transcript level of MbNAG. Relative transcript levels of MbNAG were analyzed by RT-qPCR 24 h, 48 h and 72 h after being injected with dsRNA of MbNAG. Control larvae were injected with equivalent amounts of EGFP dsRNA. Data are shown as means ± SE from three independent experiments. The statistical significances of differences in data were examined using a one-way analysis of variance (ANOVA) followed by Duncan's multiple range test. Significant differences (p b 0.05) are indicated by different lowercase letters.

MbNAG was successfully over-expressed in E. coli, and the protein was simply purified and detected using western blotting. The enzymatic activities of MbNAG at different pH values and different temperatures were determined. In the following studies, baculovirus expression system will be used to express MbNAG to produce a secreted protein as studied of endo-β-N-acetylglucosaminidase H in silkworm–baculovirus protein expression system (Masuda et al., 2015). Future work will focus on how the expressed MbNAG degrade the chitin in the integument and PM of M. brassicae. Temporal and spatial expression analyses showed that MbNAG was widely expressed in all of the developmental stages. Consistent with these results, all four of the NAGs are transcribed during most of the developmental stages in T. castaneum (Hogenkamp et al., 2008). The expression levels in the 6th instar larvae and prepupae were significantly higher than those expressed in the 1st, 2nd, 3rd, 4th and 5th instar larvae. Originally NAG expression was identified in M. sexta molting fluid, integument, midgut and hemolymph (Koga et al., 1983; Zen et al.,

727

1996). In this study, the relative expression levels of MbNAG in fat bodies, integuments, malpighian tubules and foreguts were similar. However, the expression of MbNAG in midguts and salivary glands was significantly higher than in the other tissues. In the midgut, NAG participates in the degradation of chitin in the PM, but its function in the salivary glands is still unknown. The effects of exogenous 20E on MbNAG expression in the 5th instar larvae 12 h, 24 h, 48 h and 96 h after injection were monitored. Different MbNAG expression levels occurred at different times. At the 2 μg/μl 20E concentration, the expression of MbNAG did not change obviously compared with the control. At the 6 μg/μl and 18 μg/μl 20E concentrations, MbNAG transcription increased sharply, 3.92- and 6.56-fold, respectively, when compared with the control 48 h after injection. Moreover, the 18 μg/μl 20E concentration significantly increased the expression of MbNAG. The data clearly showed that the MbNAG expression in the larvae could be regulated by 20E. In previous reports, successful RNAi studies were performed in silkworm. RNAi successfully reduced the BmFDL transcript level, and the proportion of GlcNAc-type N-glycan increased to 4.3% in the RNAitransgenic silkworm (Nagata et al., 2013; Nomura et al., 2015). In T. castaneum, RNAi-treated insects died because they failed to completely shed their old cuticles (Hogenkamp et al., 2008). In this study, injecting the dsRNA of MbNAG resulted in a significant downregulation of the transcript level in the 5th instar larvae. After the injection, most larvae could not molt, and adults failed to undergo eclosion. Although MbNAG is mainly expressed in the midgut, it is still expressed in the integument. The MbNAG enzyme involved in the molting process might be derived from MbNAG expression-related products in the integument or MbNAG expression-related products transferred from the midgut or other tissues. When RNAi inhibited the MbNAG expression, the MbNAG enzyme transported to integument decreased, apparently inducing molting disturbances. Further studies are required to confirm these results. In summary, MbNAG was essential for the growth and development of M. brassicae. MbNAG could potentially be a target for developing a novel insect pest control strategy. Acknowledgments The work was supported by The Project Sponsored by the Scientific Research Foundation for the Returned Overseas Chinese Scholars of the State Education Ministry, China (Grant No. 2013693) and the Natural Science Foundation of Heilongjiang Province of China (Grant No. C201415). References

Fig. 8. Effects of RNAi on the development of Mamestra brassicae. Representative phenotypes of the larvae after injecting the dsRNA of MbNAG or EGFP were examined, revealing two obvious M. brassicae phenotypes. The controls were normal and could molt into pupae and adults (A, B). The treated prepupae were trapped in the old cuticle, leading to death (C) and the treated pupae could not emerge normally and finally died (D). This experiment was performed in triplicate.

Aumiller, J.J., Hollister, J.R., Jarvis, D.L., 2006. Molecular cloning and functional characterization of β-N-acetylglucosaminidase genes from Sf9 cells. Protein Expr. Purif. 47 (2), 571–590. Finch, S., Thompson, A.R., 1992. Pests of cruciferous crops. In: McKinlay, R.G. (Ed.), Vegetable Crop Pests. McMillan Press, New York, pp. 87–138. Fukamizo, T., Kramer, K.J., 1985. Mechanism of chitin hydrolysis by the binary chitinase system in insect moting fluid. Insect Biochem. 15 (2), 141–145. Geisler, C., Jarvis, D.L., 2010. Identification of genes encoding N-glycan processing beta-Nacetylglucosaminidases in Trichoplusia ni and Bombyx mori: implications for glycoengineering of baculovirus expression systems. Biotechnol. Prog. 26 (1), 34–44. Hogenkamp, D.G., Arakane, Y., Kramer, K.J., 2008. Characterization and expression of the beta-N-acetylhexosaminidase gene family of Tribolium castaneum. Insect Biochem. Mol. Biol. 38 (4), 478–489. Kim, Y.K., Kim, K.R., Kang, D.G., Jang, S.Y., Kim, Y.H., Cha, H.J., 2011. Expression of β-1,4galactosyltransferase and suppression of β-N-acetylglucosaminidase to aid synthesis of complex N-glycans in insect drosophila S2 cells. J. Biotechnol. 153, 145–152. Koga, D., Mai, M.S., Kramer, K.J., 1983. Comparative biochemistry of insect exo-β-Nacetylglucosaminidase: characterization of a third enzyme from pupal hemolymph of the tobacco hornworm, Manduca sexta L. Comp. Biochem. Physiol. 74 (3), 515–520. Kokuho, T., Yasukochi, Y., Watanabe, S., Inumaru, S., 2010. Molecular cloning and expression profile analysis of a novel beta-D-N-acetylhexosaminidase of domestic silkworm (Bombyx mori). Genes Cells 15 (5), 525–536. Leonard, R., Rendic, D., Rabouille, C., Wilson, I., Préat, T., Altmann, F., 2006. The Drosophila fused lobes gene encodes an N-acetylhexosaminidase involved in N-glycan processing. J. Biol. Chem. 281 (8), 4867–4875.

728

H. Zhang et al. / Journal of Asia-Pacific Entomology 19 (2016) 721–728

Lerouge, P., Cabanes-Macheteau, M., Rayon, C., Fischette-Lainé, A.C., Gomord, V., Faye, L., 1998. N-glycoprotein biosynthesis in plants: recent developments and future trends. Plant Mol. Biol. 38 (1–2), 31–48. Li, H., Morimoto, K., Katagiri, N., 2002. A novel beta-N-acetylglucosaminidase of Clostridium paraputrificum M-21 with high activity on chitobiose. Appl. Microbiol. Biotechnol. 60 (4), 420–427. Lin, J.C., Chen, Q.X., Shi, Y., Li, S.W., Zhao, H., 2003. The chemical modification of the essential groups of beta-N-acetyl-D-glucosaminidase from Turbo cornutus Solander. IUBMB Life 55 (9), 547–552. Masuda, A., Xu, J., Mitsudome, T., Morokuma, D., Mon, H., Banno, Y., Kusakabe, T., Lee, J.M., 2015. Improvement of endo-β-N-acetylglucosaminidase H production using silkworm–baculovirus protein expression system. J. Asia Pac. Entomol. 18 (2), 175–180. Nagamatsu, Y., Yanagisawa, I., Kimoto, M., 1995. Purification of a chitooligosaccharidolytic beta-N-acetylglucosaminidase from Bombyx mori larvae during metamorphosis and the nucleotide sequence of its cDNA. Biosci. Biotechnol. Biochem. 59 (2), 219–225. Nagata, Y., Lee, J.M., Mon, H., Imanishi, S., Hong, S.M., Komatsu, S., Oshima, Y., Kusakabe, T., 2013. RNAi suppression of β-N-acetylglucosaminidase (BmFDL) for complex-type Nlinked glycan synthesis in cultured silkworm cells. Biotechnol. Lett. 35 (7), 1009–1016. Nomura, T., Suganuma, M., Higa, Y., Kataoka, Y., Funaguma, S., Okazaki, H., Suzuki, T., Kobayashi, I., Sezutsu, H., Fujiyama, K., 2015. Improvement of glycosylation structure by suppression of β-N-acetylglucosaminidases in silkworm. J. Biosci. Bioeng. 119 (2), 131–136. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29 (9), e45. Prag, G., Papanikolau, Y., Tavlas, G., Vorgias, C.E., Petratos, K., Oppenheim, A.B., 2000. Structures of chitobiase mutants complexed with the substrate di-N-acetyl-D-glucosamine: the catalytic role of the conserved acidic pair, aspartate 539 and glutamate 540. J. Mol. Biol. 300 (3), 611–617.

Rong, S., Li, D.Q., Zhang, X.Y., Li, S., Zhu, K.Y., 2013. RNA interference to reveal roles of β-Nacetylglucosaminidase gene during molting process in Locusta migratoria. Insect Sci. 20 (1), 109–119. Sambrook, J., Russell, D.W., 2002. Molecular Cloning, a Laboratory Manual. third ed. Science Press, Beijing (in Chinese). Shi, B.C., Gong, Y.J., Lu, H., 2005. The identification and control of Mamestra brassicae (L.) (Lepidoptera: Noctuidae). China Veget. 9, 56. Tomiya, N., Narang, S., Lee, Y.C., 2004. Comparing N-glycan processing in mammalian cell lines to native and engineered lepidopteran insect cell lines. Glycoconj. J. 21 (6), 343–360. Wu, J. (Ed.), 2009. Vegetable pests. In: Agricultural Entomology. China Agricultural Press, Beijing, p. 295. Zen, K.C., Choi, H.K., Krishnamachary, N., Muthukrishnan, S., Kramer, K.J., 1996. Cloning expression, and hormonal regulation of an insect beta-N-acetylgucosaminidase gene. Insect Biochem. Mol. Biol. 26 (5), 435–444. Zhai, Y.F., Huang, M.X., Wu, Y., Zhao, G.D., Du, J., Li, B., Shen, W.D., Wei, Z.G., 2014. The expression profile and promoter analysis of β-N-acetylglucosaminidases in the silkworm Bombyx mori. Mol. Biol. Rep. 41 (10), 6667–6678. Zhang, X.X., Lian, M.L., Li, T., Zhou, Y.N., 2008. Investigation on occurrence regulations and damage characteristics of Mamestra brassicae (L.) (Lepidoptera: Noctuidae) in the center area of Shanxi. J. Shanxi Agric. Univ. Nat. Sci. 28 (4), 442–447. Zheng, Y.P., Krell, P.J., Doucet, D., 2008. Cloning, expression, and localization of a moltrelated beta-N-acetylglucosaminidase in the spruce budworm, Choristoneura fumiferana. Arch. Insect Biochem. Physiol. 68 (1), 49–59. Zhu, H., Ma, Q.B., Liu, X.Y., 2015. The differential expression of BmGlcNAcase2 in strains of Bombyx mori (Lepidoptera: Bombycidae) with different susceptibility to Bombyx mori (Lepidoptera: Bombycidae) Nucleopolyhedrovirus infection. J. Insect Sci. 15 (1), 1–4.