Molecular cloning and stress-induced expression of paralichthys olivaceus heme-regulated initiation factor 2α kinase

ARTICLE IN PRESS

Developmental & Comparative Immunology

Developmental and Comparative Immunology 30 (2006) 1047–1059 www.elsevier.com/locate/devcompimm

Molecular cloning and stress-induced expression of paralichthys olivaceus heme-regulated initiation factor 2a kinase$ Rong Zhu1, Yi-Bing Zhang1, Yu-Dong Chen, Cai-Wen Dong, Fu-Tie Zhang, Qi-Ya Zhang, Jian-Fang Gui State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Graduate School of Chinese Academy of Sciences, Wuhan 430072, China Received 21 October 2005; received in revised form 5 February 2006; accepted 5 February 2006 Available online 6 March 2006

Abstract The heme-regulated initiation factor 2a kinase (HRI) is acknowledged to play an important role in translational shutoff in reticulocytes in response to various cellular stresses. In this study, we report its homologous cDNA cloning and characterization from cultured flounder embryonic cells (FEC) after treatment with UV-inactivated grass carp haemorrhagic virus (GCHV). The full-length cDNA of Paralichthys olivaceus HRI homologue (PoHRI) has 2391 bp and encodes a protein of 651 amino acids. The putative PoHRI protein exhibits high identity with all members of eIF2a kinase family. It contains 12 catalytic subdomains located within the C-terminus of all Ser/Thr protein kinases, a unique kinase insertion of 136 amino acids between subdomains IV and V, and a relatively conserved N-terminal domain (NTD). Upon heat shock, virus infection or Poly I:C treatment, PoHRI mRNA and protein are significantly upregulated in FEC cells but show different expression patterns in response to different stresses. In healthy flounders, PoHRI displays a wide tissue distribution at both the mRNA and protein levels. These results indicate that PoHRI is a ubiquitous eIF2a kinase and might play an important role in translational control over nonheme producing FEC cells under different stresses. r 2006 Elsevier Ltd. All rights reserved. Keywords: Heme-regulated initiation factor 2a kinase (HRI); Grass carp haemorrhagic virus (GCHV); Flounder (paralichthys olivaceus) embryonic cells (FEC); Inductive expression; Stress responses

1. Introduction

Abbreviations: HRI, the heme-regulated initiation factor 2a kinase; GCHV, grass carp haemorrhagic virus; FEC, flounder embryonic cells $ The nucleotide sequence data is available in the DDBJ/EMBL/ GenBank databases under the accession number DQ193596. Corresponding author. Tel.: +86 27 68780707; fax: +86 27 68780123. E-mail address: [email protected] (J.-F. Gui). 1 The two authors contributed equally to this work.

Protein synthesis in eukaryotic cells is regulated at translational level under various stress conditions, and phosphorylation of the a-subunit of eukaryotic initiation factor 2 (eIF2a) at serine 51 is one of important regulatory mechanisms that lead to the general decrease in the rate of polypeptide chain initiation and the arrest of protein synthesis [1]. Phosphorylation is mediated by a well-characterized family of eIF2a kinases, comprising four

0145-305X/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2006.02.001

ARTICLE IN PRESS 1048

R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

members to date, the heme-regulated initiation factor 2a kinase (HRI) [2], the interferon inducible, double-stranded RNA-dependent protein kinase (PKR) [3], the general control nonderepressible 2 (GCN2) protein kinase, and the endoplasmic reticulum-resident kinase (PERK) [4–6]. These eIF2a kinases possess an extensively conserved catalytic domain at their C-terminus, which contains 12 subdomains characteristic of all eukaryotic Ser/Thr protein kinases, and a kinase insert (KI) domain [7,8]. The kinase insert domain, located between subdomains IV and V, is unique to eIF2a kinases and distinguishes them from other Ser/Thr protein kinases [8]. In contrast to the catalytic domains, there is little similarity in the N-terminal regulatory region, which mediates stress-induced signaling. HRI is regulated by heme through two heme-binding domains [9], whereas PKR, PERK and GCN2 are regulated by dsRNA through two N-terminal dsRNA-binding domains [3], a stress signal from the endoplasmic reticulum (ER) through an ER stress sensor domain [6], and amino acid limitation through a regulatory domain related to histidyl-tRNA synthase [4], respectively. HRI is first discovered in rabbit reticulocytes as an inhibitor of globin synthesis under heme deficiency [2]. Two distinct heme-binding sites have been identified. One site, located in the kinase insertion domain of HRI, appears to bind heme ‘‘reversibly’’ and regulates HRI activity in response to changes in heme concentration [10]. The other site is the N-terminal domain (NTD) of HRI (
165 amino acids) that is responsible for the stable ‘‘constitutive’’ binding of heme to HRI [11] and for nitric oxide (NO)-induced activation of HRI [12]. Additionally, there are two heme regulatory motifs (HRM) located within the C-terminal catalytic domain of HRI proteins but not found in the other three eIF2a kinases [7,9]. Despite a well-established role in the regulation of protein synthesis by the availability of heme in intact reticulocytes and their lysates, little is known about the importance of HRI in stress conditions other than heme deficiency, and the roles of HRI in nonerythroid tissues. It is suggested that activation of HRI, independent of heme, also occurs in intact reticulocytes and nucleated erythroid progenitor cells by various stimuli including heat shock, arsenite treatment and osmotic shock [13], and that HRI exhibits eIF2a kinase activity in mouse liver and cultured NIH 3T3 cell extracts [14]. These reports show that HRI is actually a ubiquitous

eIF2a kinase that is widely distributed in nonerythroid tissues [12,14,15], and indicate that this kinase might play an important role in the translational regulation of nonerythroid tissues. Nevertheless, there was an argument on the tissue specificity of HRI expression due to the fact that no HRI protein expression was reported in nonerythroid tissues [14,15] and a finding that in HRI knockout mice, only red blood cells (RBCs) and their precursors were directly affected by the lack of HRI [16]. The cloning and characterization of rainbow trout and zebrafish eIF2a indicated that fish, similar to mammals, were also able to regulate protein synthesis through phosphorylation of eIF2a [17]. More recently, a fish PKR-like gene has been identified from crucian carp [18] and zebrafish [19], and its role in translational inhibition has been revealed in zebrafish via a luciferase reporter assay [19]. Using Japanese flounder (Paralichthys olivaceus) as a model organism to study the fish immune system, we have cloned a cDNA homologous to known HRI genes, termed PoHRI, from cultured flounder embryonic cells (FEC). Further, we demonstrate that PoHRI is upregulated in FEC cells in response to various stresses including heat shock, viral infection, and Poly I:C treatment.

2. Materials and methods 2.1. Cell culture and viruses FEC were grown at 24 1C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS, GIBCO), 100 units/ml penicillin and 100 mg/ml streptomycin [20]. Crucian carp (Carassius auratus) blastulae embryonic cells (CAB) and carp (Cyprinus carpio) leucocyte cells (CLC) were maintained at 28 1C in medium 199 supplemented with the same concentration of FCS and antibiotics. Turbot (Scophthalmus maximus) rhabdovirus (SMRV) [21] and grass carp haemorrhagic virus (GCHV), a dsRNA-containing virus in the family Reoviridae [22], were propagated and titred in CLC cells and CAB cells, respectively. Previous studies have found that UV-inactivated GCHV could induce an IFN-like activity in cultured CAB cells; therefore, the expression of PoHRI by the UV-inactivated GCHV was determined as described previously [22].

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

2.2. Construction of a SMART cDNA library and cloning of PoHRI full-length cDNA A SMART cDNA library was constructed with mRNA derived from UV-inactivated GCHV-infected FEC cells [23]. A pair of primers, eIF-F and eIF-R, was designed according to the sequences of two conserved motifs L(F/H)IQM and GDFGLV, located at subdomains V and VII, respectively, within the C-terminal catalytic region of eIF2a kinases (Table 1). A standard PCR was performed to amplify the cDNA fragment homologous to known HRIs from the SMART cDNA library. Based on the cloned fragment sequence, a second pair of primers, PoHRI-F1 and PoHRI-R1, was designed to clone the full-length cDNA of PoHRI by RACE-PCR. Briefly, the 50 -end of PoHRI cDNA was amplified by PoHRI-F1 and universal primer SMART-R, and PoHRI-R1 and primer SMART-F were used to amplify the 30 -end of PoHRI cDNA. All PCR products were ligated into the pMD18-T vector (Takara) and sequenced. The full-length cDNA of flounder HRI was obtained by 50 - and 30 -RACE sequence. 2.3. Treatment of FEC cells by various stresses FEC cells, grown for 2–3 days before use, were washed three times with FCS-free DMEM medium, and then treated with 0.5 ml FCS-free DMEM containing UV-inactivated GCHV (1  109 TCID50/ml exposed to UV irradiation), active SMRV (1  104 TCID50/ml), Poly I:C (100 mg/ml), or 0.5 ml FCSTable 1 Primers used for sequencing and expression analysis Name

Sequence (50 to 30 )

eIF-F eIF-R HRI-F1 HRI-R1 HRI-F2 HRI-R2 HRI-F3 HRI-R3 Smart-F Smart-R Mx-F Mx-R 18s rRNA-F 18s rRNA-R b-actin-F b-actin-R

GTACATTCAGATGGAGCTGTG TAACGAGTCCAAAGTCCCCAA TGTCCGTATGGATGTGTGGA GGCAGTCCTGAGCATGGAG GCCTCAGTCAAGCATCAACA CCACTCTTCGTCGATACAGG TAGAATTCATGTTCAGTTCAACACACAACA TACTCGAGTTTGTTCATAACCTTAAAAACG CAACGCAGAGTACGCGGG TCAACGCAGAGTACT(16) GCCGTCATAGGAGACCAAA TTCCTCGTAGTCCCTGTAGC GAGAAACGGCTACCACATCC CACCAGACTTGCCCTCCAA CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC

1049

free DMEM alone as a control. One hour later, the fluid containing inducer was discarded, and the cells washed three times. After 5 ml of fresh FCS-free DMEM was added, cells were cultured at 24 1C for the indicated times. For heat shock assay, FEC cells were treated with pre-warmed (35 1C) medium, shocked at 35 1C for 1 h and then returned to 24 1C for 10 min. After replacement with pre-warmed (24 1C) medium, the cells were incubated at 24 1C for 1, 2, 4, 8, 12, 24, and 48 h, respectively. Control cells were incubated at 24 1C throughout. 2.4. RNA extraction, reverse transcription and realtime PCR Total cell RNA was extracted using Trizol Reagent (Invitrogen), from different tissues of healthy flounders and FEC cells treated with various stresses. Prior to sampling, fish were maintained under laboratory conditions for 2 weeks, and no clinical signs were observed during this period. The total RNA was reverse-transcribed into cDNA by random primers using a RevertAidTM Minus First Strand cDNA Synthesis Kit (Fermentas). Real-time PCR was performed by DNA Engine Chromo 4 Real-Time System (MJ Research) with SYBR Green I Dye. The primers PoHRI-F2 and PoHRI-R2 were used to detect PoHRI mRNA, and the specificity of the primers to PoHRI was confirmed by sequence analysis of the amplified product. b-actin and 18S rRNA were used as internal control genes in analyses of cell samples and tissue samples, respectively (Table 1). The PCR reaction was performed in a volume of 20 ml, containing 1 ml cDNA, 0.2 mM of each primer, 1U of Taq polymerase (MBI, Fermentas), 0.1 mM of each dNTP, 1  buffer for Taq polymerase (MBI, Fermentas). PCR conditions were as follows: 94 1C for 4 min, 94 1C for 20 s, 56 1C for 20 s, 72 1C for 20 s for 40 cycles, followed by 72 1C for 10 min. All samples were analyzed in triplicate and the results were expressed relative to the expression of b-actin using the 2 (-delta delta C(T)) method [24]. 2.5. Preparation of polyclonal anti-HRI mouse serum and Western blot analysis Because the N-terminal regulatory region was very variable among four eIF2a kinases, the cDNA fragment encoding the N-terminal 200 amino acids

ARTICLE IN PRESS 1050

R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

unique to PoHRI was amplified by primers PoHRIF3 and PoHRI-R3 (Table 1) and ligated into prokaryotic vector pET-32a-c(+) (Novagen). A fusion protein was expressed, purified according to the protocol of the HisBind Purification Kit (Novagen), and used to generate polyclonal mouse anti-PoHRI serum [25]. Western blot analysis was performed to detect the PoHRI protein in different tissues of healthy flounders and FEC cells according to the previous report [25]. In brief, equal amounts of total proteins were separated on 10% SDS-PAGE gels. Proteins were electrophoretically transferred to a nitrocellulose membrane. The membrane was blocked with 5% nonfat dry milk in TBST buffer (25 mM Tris–HCl pH 7.5, 150 mM NaCl and 0.1% Tween 20). The blocked membrane was incubated with the mouse antiserum at a dilution of 1:500 in TBST buffer containing 1% milk at room temperature for 1 h. The membrane was washed three times with TBST buffer, each for 10 min, and then incubated with 1:1000 dilution of alkaline phosphatase-conjugated horse anti-mouse IgG (Sino-American Biotechnology Company). After another three washes with TBST buffer, each for 10 min, detection was performed using BCIP/NBT staining (Ameresco). To confirm the specificity of polyclonal antiPoHRI antibody, the membrane was incubated with either polyclonal anti-PoHRI antibody or antiPoHRI antibody that had been pre-adsorbed against excess antigen (PoHRI N-terminal 200amino-acid peptides, 5 mg/ml) at 4 1C for 16 h in TBST buffer containing 1% milk. 2.6. Database and sequence analysis All generated sequences were used to search for sequence similarity by BLAST analysis using the web servers of the National Center of Biotechnology Information [26]. Multiple sequence alignments were generated by the Vector NTI program, and a phylogenetic tree was constructed by the neighbor joining method based on the full-length kinase

domain alignments of eIF2a kinases using the CLUSTALW 1.8 program [27]. 3. Results 3.1. Isolation of full-length PoHRI cDNA In order to clone the flounder (P. olivaceus) homologues of eIF2a kinases, oligonucleotide primers (eIF-F and eIF-R) were designed according to the sequences of two conserved motifs L(F/H)IQM and GDFGLV, respectively. A 260 bp cDNA fragment was generated, and contained the sequence motifs characteristic of known HRI kinases. Subsequently, the full-length sequence corresponding to this cDNA fragment was cloned by RACEPCR and designated P. olivaceus HRI (PoHRI). The full-length PoHRI cDNA is 2391 bp, flanked by 209 bp of 50 UTR and 229 bp of 30 UTR. The largest ORF encodes a 651-amino-acid protein with a predicted molecular mass of 73.4 kDa. The 30 UTR contains a putative polyadenylation signal (AATAAA) upstream of a poly(A) stretch, and a ATTTA instability motif that may be involved in rapid mRNA degradation [28]. Additionally, the cDNA sequence continuity was confirmed by PCR amplification to generate an identical ORF. 3.2. Analysis of putative PoHRI amino acid sequence Computer search of the conserved domains identified a catalytic domain characteristic of Ser/ Thr protein kinases, which spans 441 amino acid residues from 189 to 599 within the C-terminus of PoHRI. Multiple alignments of PoHRI with other eIF2a kinases including human and mouse PKR, PERK and GCN2, showed that this catalytic domain is composed of 12 conserved subdomains, with invariant amino acid residues in each domain (shaded in black in Fig. 1). All conserved amino acids are located at similar positions in known protein kinases [29]. For example, the amino acid at position 219 in PoHRI is Lys (corresponding to Lys

Fig. 1. The structure features of the PoHRI. (A) Schematic diagram of PoHRI domain structure. The 651 amino acids comprising PoHRI are illustrated by a large box flanked by the N- and C-terminal regions (open boxes). The consensus subdomains of the catalytic domain (shaded box) are indicated by roman numerals I to XI. The two heme eIF2a kinase regulatory motifs (HRM1 and HRM2) are indicated by arrowhead. The numbers refer to the amino acid residues. (B) Multiple alignments of HRI homologues with human and mouse PKR, PERK and GCN2 were generated by the Vector NTI program. Amino acid numbering is shown to the right. Amino acids unique to the N- and C-termini of PERK or GCN2, which are not homologous to HRI, have been deleted. Sequence gaps are represented by dashes. The conserved kinase subdomains are indicated by roman numerals (I–XI) and bars above the alignments. The two heme regulatory motifs are shown as open boxes, and the histidines crucial for heme binding indicated by arrowhead.

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

1051

ARTICLE IN PRESS 1052

R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

Fig. 1. (Continued)

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

at the position 199 in rabbit HRI) and the motif LYIQMQL is present in subdomain V. These amino acid and motif are essential for kinase activity of HRI [19]. In addition, a kinase insertion of 136 amino acids is found between subdomains IV and V, very similar to the size of the kinase insertions from all known HRI proteins (about 140 amino acids) but different from PKR, PERK and GCN2 proteins (Fig. 1). Apart from the catalytic domains, PoHRI possesses two heme regulatory motifs (HRM1 and HRM2) that are present in hemoproteins [30–34]. A high level of similarity is found within the NTDs of PoHRI and the known HRIs not including the first 5–48 amino acids. Two histidines (at the position 78 and 123 in rabbit HRI), which are essential for heme binding [35], are conserved in the NTD of all HRIs. Although all four kinases contain the conserved C-terminal catalytic domains, there is almost no similarity in the N-terminal regulatory region among HRI, PKR, PERK and GCN2 (Fig. 1). Database searches identified two additional fish sequences from fugu (GenBank accession no. CAG04442) and zebrafish (GenBank accession no. XP_693707), designated TnHRI and DrHRI, respectively. Both proteins are also closest to known HRIs and show the conserved amino acids common to HRI family members (Fig. 1). In accordance with the results of the multiple alignments, amino acid sequence comparison indicates that PoHRI shares similarity to known mammalian HRI proteins with 40–41% identity overall. A somewhat higher identity of 54–58% is seen among the three fish HRI proteins (Table 2). In order to further analyze their evolutionary relationships, a phylogenetic tree was constructed with PoHRI and 26 other known Table 2 Comparison of three fish HRIs with other known HRI proteins Species PoHRI Tetraodon nigroviridis HRI Danio rerio HRI Gallus gallus HRI Mus musculus HRI Rattus norvegicus HRI Homo sapiens HRI Oryctolagus cuniculus HRI Schizosaccharomyces pombe HRI-1 Schizosaccharomyces pombe HRI-2

Identity/similarity TnHRI DrHRI

58.1/72.5 56.8/77.7 41.1/69.9 40.3/69.8 40.4/69.4 40.4/69.1 40.7/71 23/57.2

54.8/64.1 39.1/64.7 39/67.4 37/66.5 37.4/64.4 38.6/63.5 20.8/49.7

43.3/71.6 41.3/70.1 42.6/69.4 40.5/71.1 41.1/68.1 21/54.3

20.8/56.4

20.3/50.9

23.2/57.9

1053

eIF2a kinases. As shown in Fig. 2, this tree generates four basic clades: PKR, HRI, GCN2 and PERK. The three fish HRIs form a subgroup that is clustered within the HRI subfamily with high support values. 3.3. Induction of PoHRI in FEC cells by heat shock A previous report showed that HRI could be activated by heat shock [13]. To detect the expression of PoHRI under heat shock, FEC cells were shocked at 35 1C for 1 h and then maintained at the normal temperature (24 1C) for the indicated times. Real-time PCR analysis showed that there is a basal expression of PoHRI in control FEC cells. Upon heat shock, PoHRI transcripts increase gradually to reach a peak at 4 h after treatment. However, even at 48 h after treatment, HRI transcripts are elevated compared to controls (Fig. 3A). Western blotting was subsequently used to determine whether PoHRI protein was induced by heat shock. As shown in Fig. 3B, a specific protein band about 70 kDa was detected, and was upregulated in heat-shocked FEC cells with a similar kinetics corresponding to PoHRI mRNA. Furthermore, the specificity of the polyclonal anti-PoHRI antibody was confirmed by a pre-adsorption experiment. As shown in Fig. 3C, anti-PoHRI antiserum can detect a 70 kDa protein band in both FEC and head kidney extracts, whereas the same antiserum, pre-adsorbed with recombinant PoHRI peptide, cannot recognize the polypeptide. The data indicate that the anti-PoHRI antibody is specific to PoHRI. 3.4. Induction of PoHRI in FEC cells by virus infection and PolyI:C treatment Subsequently, the inductive expression of PoHRI was analyzed by UV-inactivated GCHV infection. Flounder Mx gene, a hallmark of the interferon response [36], was first evaluated the inducibility. As shown in Fig. 4A, Mx mRNA is significantly induced in FEC cells treated with UV-inactivated GCHV, with a maximum expression at 48 h post infection followed by a sharp decrease. As expected, PoHRI transcripts, although at a relatively low level, also display an expression pattern similar to Mx gene, increasing gradually and peaking at 48 h, and decreasing thereafter. And, Western blotting also detects consistent PoHRI protein contents that correspond with the PoHRI transcript levels after exposure to UV-inactivated GCHV.

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

1054

BtPKR

SsPKR

(NM_178109)

(AB104654)

HsPKR GgPKR

MmPKR (M93567)

(NM_002759)

RnPKR

(NM_204487)

(NM_019335)

977 RnPERK

TnPKR1

(NM_031599)

MmPERK (NM_010121)

HsPERK

(AJ544919)

1000

984 1000

883 1000

(AF193339)

CaPKR-like (AY293929)

DmPERK

757

(AF193340)

1000 667

949

DrPKR-like (NM_001013299)

951

805 904 973

CePERK

GgHRI

(AF193341)

691

(AF330008)

999

1000 996

HsHRI

1000

1000

(AF181071)

537

AtGCN2 (AJ459823)

999

1000

RnHRI

OcHRI (M69035)

MmHRI (NM_013557)

(NM_013223)

DrHRI

ScGCN2 (P15442)

(XP_693707)

1000 MmGCN2 (NM_013719)

TnHRI PoHRI

HsGCN2

0.1

(CAG04442)

(DQ193596)

(AF193341)

DmGCN2 (AF056302)

Fig. 2. Phylogenetic relationship of PoHRI. Based on the multiple alignments of eIF2a kinase sequences containing full-length kinase domains but excluding the kinase insert domains using the ClustalW 1.8 program, an unrooted tree was constructed by the NeighborJoining method. Four eIF2a kinases, including PKR, PERK, HRI and GCN2, are derived from flounder (Po), zebrafish (Dr), fugu (Tn), human (Hs), rabbit (Oc), rat (Rn), crucian carp (Ca), chicken (Gg), mouse (Mm), cow (Bt), pig (Ss), baker’s yeast (Sc), fruit fly (Dm), nematode (Ce), and thale cress (At). GenBank accession numbers of protein sequences used for analysis are shown in parentheses. The bootstrap confidence values shown at the nodes of the tree are validated by 1000 repetitions.

The expression of PoHRI was also determined in active SMRV-infected FEC cells. SMRV is easily propagated in FEC cells, and results in a cytopathic effect (CPE) and cell death. Unlike UV-inactivated GCHV, SMRV infection yields a delayed but still significant increase of Mx expression, with a top level at 72 h post infection (Fig. 4B). Under the same conditions, PoHRI mRNA also displays a similar kinetics to Mx gene: a low transcriptional level in the early infection period and then up to a maximum level at 72 h. In agreement with mRNA

expression pattern, PoHRI protein expression is also upregulated significantly. Finally, Poly I:C, a synthetic analog of dsRNA, was used to mimic virus induction and to analyze the expression of Mx and PoHRI. As shown in Fig. 4C, the kinetics of Mx transcription is similar to those seen in UV-inactivated GCHV-treated cells. For PoHRI, transcript levels increase fast within 24 h post infection, and then persist at a relatively high level up to 96 h post infection. Simultaneously, a protein expression pattern similar to the mRNA

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

4. Discussion

Relative expression units

12 10 8 6 4 2 0

C

1

12 2 4 8 Times post treatment (h)

C

1

2

(A)

4

8

12

24

24

48

48 h

(B) +Ab

+Pread.Ab

+Ab

+Pread.Ab

70 kDa

(C)

1055

FEC cells

Head kidney

Fig. 3. Induction of PoHRI by heat shock. FEC cells was shocked at 35 1C for 1 h and then cultured at 24 1C for 1, 2, 4, 8, 12, 24 and 48 h. (A) Real-time PCR detection of PoHRI transcripts. The ratio of PoHRI to b-actin in control cells was set to 1, and all treated cells were normalized relative to this value. C ¼ mocktreated FEC cells. Error bars represent standard deviations obtained by measuring each sample three times. (B) Western blot detection of PoHRI protein expression by a polyclonal anti-HRI serum made by immunizing mouse with the N-terminal fragment of PoHRI. (C) Specificity of the anti-HRI antiserum. The antiPoHRI antiserum was pre-adsorbed with the purified recombinant PoHRI peptide for 16 h at 4 1C, and subsequently used in Western blotting.

expression is also detected from the Poly I:C treated FEC cells. 3.5. Tissue distribution of PoHRI Tissue distribution of PoHRI was further analyzed in healthy flounders by real-time PCR and Western blotting. As shown in Fig. 5, the PoHRI is transcribed in all tested tissues, and expressed to varying extents relative to the house keeping gene 18S rRNA (Fig. 5A). PoHRI protein is ubiquitously distributed in all examined tissues (Fig. 5B). Therefore, PoHRI might be a ubiquitous kinase.

The eIF2a kinases belong to a family of evolutionarily conserved Ser/Thr kinases that regulate stress-induced translational arrest [8]. PoHRI identified in this study showed its sequence and structural similarity to mammalian HRI members, including a size similar to HRIs, a kinase insert domain, and the presence of conserved motifs. Moreover, PoHRI was ubiquitously expressed in all tissues tested and upregulated in FEC cells in response to heat shock, virus infection and Poly I:C treatment. It had been thought that neither HRI mRNA nor protein was expressed in nonerythroid cells, and HRI played important roles in regulating protein synthesis of immature erythroid cells and the number of mature erythroid cells [9,37]. However, HRI mRNA was revealed in nonerythroid tissues of mouse [14] and rat [15]. These results suggested a broader participation and functional roles of HRI in various nonerythroid cells. Despite the current argument on the existence of nonerythroid HRI, this study strongly showed a ubiquitous expression of PoHRI at the mRNA and protein levels in cultured FEC cells and all tested tissues of flounders. It must be noted that the specificity of polyclonal anti-PoHRI has been confirmed by an antibody preadsorption test (Fig. 3C), and a good correlation between PoHRI mRNA and protein levels was observed in stress-induced FEC cells (Figs. 3 and 4). In mammals, HRI regulates translational inhibition of erythroid cells under heat shock, arsenite treatment and osmotic stress [13], but the activation of HRI may be regulated through different mechanisms. Besides HRI, PKR is involved in the increased eIF2a phosphorylation upon heat shock in erythorid cells, although HRI is the major eIF2a kinase responsible for this stress response [38]. Similarly to the mammalian homologues, heat shock could activate the expression of PoHRI in FEC cells at mRNA and protein levels (Fig. 3); therefore, PoHRI might play the similar role in heat-shocked FEC cells. Interestingly, our results also showed the upregulation of PoHRI mRNA and protein in FEC cells treated with UV-inactivated GCHV, active SMRV and Poly I:C (Fig. 4). As compared to UVinactivated GCHV and Poly I:C, SMRV induced a delayed expression of PoHRI, and the delay might be related to the low MOI (multiplicity of infection)

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

1056

500 400 300 200 100 0

* C

600 500 400 300 200 100 0

* 0.5

6

12

24

48

72

96

* C

* 0.5

* 3

Time post treatment (h)

12 10 8 6 4 2 0

6

12

24

48

72

C

96

0.5

3

(A)

6

12

24

* C

* 0.5

6

6

9

72

96 h

C

0.5

3

6

(B)

9

48

72

96

72

96

PoHRI

12 24 48 60 72

12

24

8 7 6 5 4 3 2 1 0 C

0.5

6

12

24

48

Time post treatment (h)

PoHRI 48

12

Time post treatment (h)

Time post treatment (h)

PoHRI 0.5

* 12 24 48 60 72

PoHRI

9 8 7 6 5 4 3 2 1 0

Time post treatment (h)

C

* 9

Relative expression units

Relative expression units

Relative expression units

PoHRI

0.5

* 6

40 35 30 25 20 15 10 5 0

Time post treatment (h)

14

C

Poly I:C indcution Mx Relative expression units

600

SMRV induction Mx Relative expression units

Relative expression units

UV-inactivatedGCHV induction Mx

PoHRI 24

48

60

72 h

C

0.5

6

12

24

48

72

96 h

(C)

Fig. 4. Induction of PoHRI by UV-inactivated GCHV (A), SMRV (B) and PolyI:C (C). Two groups of FEC cells were treated with UVinactivated GCHV and Poly I:C for 0.5, 6, 12, 24, 48, 72 and 96 h, respectively. The third group was infected with SMRV for 0.5, 3, 6, 9, 12, 24, 48, 60 and 72 h. The Mx mRNA (up) and PoHRI mRNA (middle) were determined by real-time PCR, and PoHRI protein (down) was detected by Western blot analysis with polyclonal anti-PoHRI serum. For real-time PCR, the ratio of PoHRI to b-actin in control cells was set to 1, and all treated cells were normalized relative to this value. For measurements of Mx transcripts, the ratio of Mx to b-actin was set to 1 for the sample in which Mx expression was the lowest, and asterisk indicated the undetectable expression. Error bars represent standard deviations obtained by measuring each sample three times.

because the SMRV titer (1  104 TCID50/ml) used in this study was about 105 times lower than that used for UV-inactivated GCHV (1  109 TCID50/ml). In addition, virus infection and Poly I:C treatment are generally able to elicit an interferon response [39]. In order to address this possibility in treated FEC cells, the transcriptional upregulation of flounder Mx, an interferon responsive gene [36], has been confirmed in FEC cells after treatment with UV-inactivated GCHV, active SMRV and Poly I:C (Fig. 4), indicating that an interferon response was triggered. Actually, previous results have demonstrated an IFN activity that was produced in UV-inactivated GCHV-infected FEC cells [40]. However, it is not clear whether PoHRI upregulation is directly related to interferon response. One of the interesting findings is the interaction between HRI and some heat shock proteins (Hsps)

under some stresses. Matts et al. found that HRI interacted with three heat shock proteins, Hsp90, Hsp70 and p56 (the ECI antigen) in rabbit reticulocyte lysates [41]. Further study showed that Hsp90 and Hsp70 were required for the activation of HRI by several stresses including heat shock. The activation of HRI was dependent on heme [13]. This finding suggested that HRI could respond to stresses in non-heme produced cells. More recently, flounder heat shock protein genes, including Hsp90, Hsp70 and Hsp40, have been isolated, and these Hsp genes were induced in FEC cells by heat shock and UV-inactivated SMRV [42]. These results raised an interest in further clarifying the relationship between PoHRI and flounder Hsps under virus infection. Previous reports showed that the phosphorylation of eIF2a in cultured mammalian cells in

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059

fore, further studies on functional mechanisms of eIF2a kinases will be needed to understand the importance of PoHRI in nonerythroid tissues under virus infection.

16 14 12 10 8 6 4

Acknowledgments Testis

Posterior kidney

Gill

Liver

Muscle

Skin

Head kidney

Intestine

Heart

Eye

Spleen

Posterior kidney

Gill

Liver

Muscle

Skin

Head kidney

Intestine

Heart

Eye

Spleen

Brain

0

Testis

2 Brain

Relative expression units

1057

Fig. 5. Distribution of PoHRI in different tissues. (A) Real-time PCR detection of PoHRI transcripts in flounder tissues. The samples were normalized on the basis of 18S rRNA expression. The ratio of PoHRI to 18S rRNA in liver was set to 1, and all tissues were normalized relative to this value as the relative expression units of PoHRI. Error bars represent standard deviations obtained by measuring each sample three times. (B) Western blot detection of PoHRI protein in different tissues. Protein extracts prepared from different tissues were separated by electrophoresis in 10% SDS-PAGE gels, and transferred to nitrocellulose membranes. Protein was detected by polyclonal anti-HRI serum as described above.

response to heat shock is apparently due to the activation of eIF2a kinases including HRI and PKR [43]. This implies that the eIF2a kinases, including HRI and PKR, are redundant and can functionally replace one another under some conditions [14,44]. Actually, which kinase is involved in the stress response depends on the particular tissue and the specific cell and virus system. For example, PKR activation is a response to arsenite treatment in nonerythroid cells, while HRI is the only arseniteactivated eIF2a kinase in erythroid cells [13]. Hence, apart from PoHRI, other eIF2a kinases including PoPKR might play similar roles in FEC cells in response to heat shock and virus infection. In addition, these kinases might exhibit a new uncharacterized, heme-independent function other than translational shutoff under virus infection, because mammalian NF-kB can be activated by HRI through phosphorylation of inhibitor IkB [45] or by PKR through degradation of IkB [46]. There-

This work was supported by grants from the National Basic Research Program of China (2004CB117404), the National Natural Science Foundation of China (30200207, 30471333), and the Innovation group project of Hubei Province (2004ABC005).

References [1] Jackson RJ. Binding of Met-tRNA. In: Trachsel H, editor. Translation in eukaryotes. Boca Raton, FL: CRC Press Inc; 1991. p. 193–229. [2] Chen JJ, Throop MS, Gehrke L, Kuo I, Pal JK, Brodsky M, et al. Cloning of the cDNA of the heme-regulated eukaryotic initiation factor 2a (eIF-2a) kinase of rabbit reticulocytes: homology to yeast GCN2 protein kinase and human doublestranded-RNA-dependent eIF-2a kinase. Proc Natl Acad Sci USA 1991;88:7729–33. [3] Meurs E, Chong K, Galabru J, Thomas NSB, Kerr IM, Williams BRG, et al. Molecular cloning and characterization of the human double-stranded RNA-activated protein kinase induced by interferon. Cell 1990;62:379–90. [4] Hinnebusch AG. Translational regulation of yeast GCN4. A window on factors that control initiator-trna binding to the ribosome. J Biol Chem 1997;272:21661–4. [5] Shi Y, Vattem KM, Sood R, An J, Liang J, Stramm L, et al. Identification and characterization of pancreatic eukaryotic initiation factor 2a-subunit kinase, PEK, involved in translational control. Mol Cell Biol 1998;18:7499–509. [6] Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 1999;397:271–4. [7] de Haro C, Mendez R, Santoyo J. The eIF-2a kinases and the control of protein synthesis. FASEB J 1996;10:1378–87. [8] Hanks SK, Hunter T. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J 1995;9:576–96. [9] Chen JJ, London IM. Regulation of protein synthesis by heme-regulated eIF-2a kinase. Trends Biochem Sci 1995; 20:105–8. [10] Rafie-Kolpin M, Chefalo PJ, Hussain Z, Hahn J, Uma S, Matts RL, et al. Two heme-binding domains of hemeregulated eukaryotic initiation factor-2a kinase. N terminus and kinase insertion. J Biol Chem 2000;275:5171–8. [11] Uma S, Matts RL, Guo Y, White S, Chen JJ. The Nterminal region of the heme-regulated eIF2a kinase is an autonomous heme binding domain. Eur J Biochem 2000; 267:498–506. [12] Uma S, Yun BG, Matts RL. The heme-regulated eukaryotic initiation factor 2a kinase. A potential regulatory target for

ARTICLE IN PRESS 1058

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059 control of protein synthesis by diffusible gases. J Biol Chem 2001;276:14875–83. Lu L, Han AP, Chen JJ. Translation initiation control by heme-regulated eukaryotic initiation factor 2a kinase in erythroid cells under cytoplasmic stresses. Mol Cell Biol 2001;21:7971–80. Berlanga JJ, Herrero S, de Haro C. Characterization of the hemin-sensitive eukaryotic initiation factor 2a kinase from mouse nonerythroid cells. J Biol Chem 1998;273: 32340–6. Mellor H, Flowers KM, Kimball SR, Jefferson LS. Cloning and characterization of cDNA encoding rat hemin-sensitive initiation factor-2a (eIF-2a) kinase. Evidence for multitissue expression. J Biol Chem 1994;269:10201–4. Han AP, Yu C, LU L, Fujiwara Y, Browne C, Chin G, et al. Heme-regulated eIF2a kinase (HRI) is required for translational regulation and survival of erythroid precursors in iron deficiency. EMBO J 2001;20:6909–18. Garner JN, Joshi B, Jagus R. Characterization of rainbow trout and zebrafish eukaryotic initiation factor 2a and its response to endoplasmic reticulum stress and IPNV infection. Dev Comp Immunol 2003;27:217–31. Hu CY, Zhang YB, Huang GP, Zhang QY, Gui JF. Molecular cloning and characterisation of a fish PKR-like gene from cultured CAB cells induced by UV-inactivated virus. Fish Shellfish Immunol 2004;17:353–66. Rothenburg S, Deigendesch N, Dittmar K, Koch-Nolte F, Haag F, Lowenhaupt K, et al. A PKR-like eukaryotic initiation factor 2a kinase from zebrafish contains Z-DNA binding domains instead of dsRNA binding domains. Proc Natl Acad Sci USA 2005;102:1602–7. Chen SL, Ren GC, Sha ZX, Shi CY. Establishment of a continuous embryonic cell line from Japanese flounder Paralichthys olivaceus for virus isolation. Dis Aquat Organ 2005;60:241–6. Du CS, Zhang QY, Li CL, Miao DL, Gui JF. Induction of apoptosis in a carp leucocyte cell line infected with turbot (Scophthalmus maximus L.) rhabdovirus. Virus Res 2004; 101:119–26. Zhang YB, Hu CY, Zhang J, Huang GP, Zhang QY, Gui JF. Molecular cloning and characterization of crucian carp (Carassius auratus L.) interferon regulator factor 7. Fish Shellfish Immunol 2003;15:453–66. Chen YD, Zhang YB, Zhu R, Zhang FT, Jiang J, Shi Y, et al. Inductive expression and characterization analysis of Paralichthys olivaceus pigment epithelium-derived factor in a virally infected cell line. Biochem Biophys Res Commun 2005;335:799–809. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 2001;25:402–8. Dong CH, Yang ST, Yang ZA, Zhang L, Gui JF. A C-type lectin associated and translocated with cortical granules during oocyte maturation and egg fertilization in fish. Dev Biol 2004;265:341–54. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389–4302. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39] [40]

[41]

[42]

[43]

[44]

penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673–80. Shaw G, Kamen R. A conserved AU sequence from the 30 untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 1986;46:659–67. Hanks SK, Quinn AM, Hunter T. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 1998;241:42–52. Triggs-Raine BL, Doble BW, Mulvey MR, Sorby PA, Loewen PC. Nucleotide sequence of katG, encoding catalase HPI of Escherichia coli. J Bacteriol 1988;170:4415–9. Zhang L, Guarente L. Heme binds to a short sequence that serves a regulatory function in diverse proteins. EMBO J 1995;14:313–20. Lathrop JT, Timko MP. Regulation by heme of mitochondrial protein transport through a conserved amino acid motif. Science 1993;259:522–5. Dumont ME, Ernst JF, Hampsey DM, Sherman F. Identification and sequence of the gene encoding cytochrome c heme lyase in the yeast Saccharomyces cerevisiae. EMBO J 1987;6:235–41. McCoubrey WK, Huang TJ, Maines MD. Heme oxygenase2 is a hemoprotein and binds heme through heme regulatory motifs that are not involved in heme catalysis. J Biol Chem 1997;272:12568–74. Inuzuka T, Yun BG, Ishikawa H, Takahashi S, Hori H, Matts RL, et al. Identification of crucial histidines for heme binding in the N-terminal domain of the heme-regulated eIF2a kinase. J Biol Chem 2004;279:6778–82. Leong JC, Trobridge GD, Kim CH, Johnson M, Simon B. Interferon-inducible Mx proteins in fish. Immunol Rev 1998;166:349–63. Crosby JS, Chefalo PJ, Yeh I, Ying S, London IM, Leboulch P, et al. Regulation of hemoglobin synthesis and proliferation of differentiating erythroid cells by hemeregulated eIF-2a kinase. Blood 2000;96:3241–8. Zhao M, Tang D, Lechpammer S, Hoffman A, Asea A, Stevenson MA, et al. Double-stranded RNA-dependent protein kinase (pkr) is essential for thermotolerance, accumulation of HSP70, and stabilization of ARE-containing HSP70 mRNA during stress. J Biol Chem 2002;277: 44539–47. Samuel CE. Antiviral action of interferons. Clin Microbiol Rev 2001;14:778–809. Chen YD, Zhang YB, Zhu R, Jiang J, Zhang QY, Gui JF. Construction of a subtractive cDNA library from the Paralichthys olivaceus embryonic cells induced by a double-stranded RNA virus. Virol Sin 2005;20:168–72 (in Chinese). Matts RL, Xu Z, Pal JK, Chen JJ. Interactions of the hemeregulated eIF-2a kinase with heat shock proteins in rabbit reticulocyte lysates. J Biol Chem 1992;267:18160–7. Dong CW, Zhang YB, Zhang QY, Gui JF. Differential expression of three Paralichthys olivaceus Hsp40 genes in responses to virus infection and heat shock. Fish Shellfish Immunol 2006; available online. Duncan R, Hershey JWB. Heat shock-induced translational alterations in HeLa cells. Initiation factor modifications and the inhibition of translation. J Biol Chem 1984;259:11882–9. Dever TE, Chen JJ, Barber GN, Cigan AM, Feng L, Donahue TF, et al. Mammalian eukaryotic initiation factor 2a kinases functionally substitute for GCN2 protein kinase

ARTICLE IN PRESS R. Zhu et al. / Developmental and Comparative Immunology 30 (2006) 1047–1059 in the GCN4 translational control mechanism of yeast. Proc Natl Acad Sci USA 1993;90:4616–20. [45] Ghosh S, Baltimore D. Activation in vitro of NF-kB by phosphorylation of its inhibitor Ik B. Nature 1990;344: 678–82.

1059

[46] Zamanian-Daryoush M, Mogensen TH, DiDonato JA, Williams BR. NF-kB activation by double-stranded-RNAactivated protein kinase (PKR) is mediated through NF-kBinducing kinase and IkB kinase. Mol Cell Biol 2000;20: 1278–90.