Molecular cloning, expression analysis and functional characterization of interleukin-22 in So-iny mullet, Liza haematocheila

Molecular Immunology 63 (2015) 245–252

Contents lists available at ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Molecular cloning, expression analysis and functional characterization of interleukin-22 in So-iny mullet, Liza haematocheila Zhitao Qi a,b,∗ , Qihuan Zhang b , Zisheng Wang a , Weihong Zhao a , Shannan Chen c , Qian Gao c,∗∗ a Key Laboratory of Aquaculture and Ecology of Coastal Pools of Jiangsu Province, Department of Ocean Technology, Yancheng Institute of Technology, Yancheng 224051, Jiangsu, China b School of Chemical and Biological Engineering, Yancheng Institute of Technology, Yancheng 224051, Jiangsu, China c State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, Hubei, China

a r t i c l e

i n f o

Article history: Received 11 April 2014 Received in revised form 4 July 2014 Accepted 5 July 2014 Available online 6 August 2014 Keywords: Liza haematocheila Interleukin-22 ␤-Defensin Expression analysis Recombinant mullet IL-22 Bacterial infection

a b s t r a c t In the present study, interleukin-22 (IL-22) from So-iny mullet (Liza haematocheila) was identified, and its tissue expression in both healthy and Streptococcus dysgalactiae-infected fish was examined. The full length cDNA sequence of mullet IL-22 was 1070 bp, containing an open reading frame of 555 bp. The deduced amino acid sequence shared high similarity (45.1–67.9%) with IL-22 from other fish species. Mullet IL-22 also contained an IL-10 family signature and four cysteine residues that were well conserved in other vertebrate IL-22 molecules. Mullet IL-22 mRNA was highly expressed in kidney, moderately expressed in liver and gut, and relatively weakly expressed in spleen, and its expression was significantly up-regulated in all the examined tissues following S. dysgalactiae infection. Furthermore, recombinant mullet IL-22 protein was shown to promote the expression of ␤-defensin in the four tissues and to increase the survival rate of the fish infected with S. dysgalactiae. Our results suggest mullet IL-22 plays an important role in the immune defense against bacterial infection and has the potential to be used to treat bacterial diseases in fish. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Interleukin-22 (IL-22), a member of the IL-10 family, was initially named IL-10-related T cell-derived inducible factor (IL-TIF) (Dumoutier et al., 2000a; Xie et al., 2000). It has a genomic structure of five exons/four introns and a protein structure of six or seven ␣-helices, that are typical of most of the IL-10 family members (Dumoutier et al., 2000b), but surprisingly shares low sequence identity with other members in the IL-10 family (Qi and Nie, 2008). IL-22 is a secreted cytokine, and can be produced by many immune cells, including T helper (TH ) cells, natural killer (NK) cells, eosinophils, mastocytes and B cells (Gurney, 2004; Wolk and Sabat, 2006; Chung et al., 2006; Liang et al., 2006), suggesting that it has a profound function in immune response. In mammals, IL-22 plays

∗ Corresponding author at: Key Laboratory of Aquaculture and Ecology of Coastal Pools of Jiangsu Province, Department of Ocean Technology, Yancheng Institute of Technology, Yancheng, Jiangsu 224051, China. ∗∗ Corresponding author at: Institute of Hydrobiology, Chinese Academy of Sciences, State Key Laboratory of Freshwater Ecology and Biotechnology, 7 South Donghu Road, Wuchang District, Wuhan 430072, Hubei, China. Tel.: +86 27 68780005; fax: +86 27 68780123. E-mail addresses: [email protected] (Z. Qi), [email protected] (Q. Gao). http://dx.doi.org/10.1016/j.molimm.2014.07.006 0161-5890/© 2014 Elsevier Ltd. All rights reserved.

an important role in the development of chronic inflammatory diseases and in preventing tissue damage, acting as a TH -17 cytokine (Zheng et al., 2007; Ma et al., 2008). Recently, it has been found that IL-22 can enhance mucosal barrier function (Basu et al., 2012; Leung and Loke, 2012), and activate antimicrobial defense in host by inducing the expression of antimicrobial peptides (AMPs), such as ␤-defensins 2 and 3 (Liang et al., 2006). IL-22 has been identified in many lower vertebrate species, such as zebrafish (Danio rerio) (Igawa et al., 2006), rainbow trout (Oncorhynchus mykiss) (Monte et al., 2011), and the amphibian Xenopus tropicalis (Qi and Nie, 2008). Previous studies have shown that IL-22 appeared to be highly expressed in tissues of healthy fish (Igawa et al., 2006; Corripio-Miyar et al., 2009; Monte et al., 2011). Additionally, the infection with gram negative bacterial pathogens can up-regulate IL-22 expression in some tissues and enhance the expression of multiple AMPs, highlighting its role in defense against bacterial diseases (Monte et al., 2011). So-iny mullet (Liza haematocheila) is becoming an economically important fish in China because of its strong disease resistance and rapid growth. However, intensive farming has led to increasing occurrence of bacterial infection in mullet. Streptococcus dysgalactiae, a kind of gram positive bacteria, is one of the emerging bacterial fish pathogens, infecting a wide range of aquatic animals, such as

246

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

seal (Vossen et al., 2004), sturgeon (Acipenser schrenckii) (Yang and Li, 2009), and Nile tilapia (Oreochromis niloticus) (Costa et al., 2013). Our previous study has shown that S. dysgalactiae infection can cause high mortalities in the process of mullet cultivation, with a mortality rate of 80% during seven days post-infection (Qi et al., 2013). Thus, we cloned the IL-22 gene from So-iny mullet and examined its expression following S. dysgalactiae infection. Furthermore, we produced recombinant mullet IL-22 (mrIL-22) using a prokaryotic expression system and determined the expression level of ␤-defensin in vivo after administration of mrIL-22. Our results indicated that fish treated with mrIL-22 had an enhanced immunity against S. dysgalactiae and a higher survival rate than control. 2. Materials and methods 2.1. Experimental fish Healthy mullet (average weight 5.0 ± 0.5 g) were obtained from a local commercial fish farm and transported to the laboratory in an oxygen-supplying tank. The fish were kept in 120 L plastic aquaria supplied with oxygen using electric air compressors, and were maintained in a 14-h light/10-h dark cycle at water temperature of 22 ◦ C. Fish were fed with commercial diet twice daily. Water conditions were controlled as follows: dissolved oxygen >6.0 mg/L, pH = 7.0, total ammonia <0.2 mg/L, and nitrite <0.02 mg/L, and monitored by the YSI multi-probe system (YSI 556). All fish were acclimatized for at least 2 weeks prior to treatment. 2.2. Cloning of the full-length mullet IL-22 cDNA Total RNA was extracted from kidney of healthy mullet with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and was reversetranscribed into first-strand cDNA using SuperScript Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. A mullet IL-22 partial gene sequence was cloned using degenerate primers IL-22dF1/IL-22dR1 from the cDNA template. PCR amplification was performed under the following conditions: 1 cycle of 94 ◦ C for 5 min, 35 cycles of 94 ◦ C for 30 s, 54 ◦ C for 45 s, and 72 ◦ C for 45 s, followed by a final extension of 72 ◦ C

for 10 min. The PCR products were gel-extracted, and ligated into pMD18-T (Takara, Otsu, Japan). Following transformation into competent Escherichia coli DH5␣ cells, positive clones were screened by Ampicilin selection and colony PCR, and then sequenced on an ABI Mode 377 automatic DNA sequencer (Life Technologies, Carlsbad, CA, USA). For cloning of the 3 -untranslated region (UTR) and 5 -UTR by rapid amplification of cDNA ends (RACE) PCR, primers were designed based on the obtained partial sequences. For 3 RACE, the first round of PCR was performed using the primer pair of IL223out/UPM (adaptor primer), under the following conditions: 1 cycle of 94 ◦ C for 5 min, 9 cycles of 94 ◦ C for 30 s, 64 ◦ C for 30 s, and 72 ◦ C for 90 s, 29 cycles of 94 ◦ C for 30 s, 62 ◦ C for 30 s, and 72 ◦ C for 90 s, followed by a final extension of 72 ◦ C for 10 min. The resultant products were diluted (1:10) and re-amplified in the second round PCR using the primer pair of IL22-3in/UPM, under the same reaction conditions. For 5 RACE, the primers of the first round and the second round were IL22-5out/UPM and IL22-5in/UPM, respectively. The PCR products were analyzed as mentioned above. All primers used for this cloning process are listed in Table 1. 2.3. Cloning of mullet IL-22 genomic DNA sequence Genomic DNA was extracted from mullet kidney tissue using the standard phenol-chloroform method. Based on the full-length cDNA sequence of mullet IL-22, a pair of primers (IL22gR1/IL22gF1) was designed to amplify the genomic full sequence. The PCR cycling conditions were as follows: 1 cycle of 94 ◦ C for 5 min, 40 cycles of 94 ◦ C for 30 s, 60 ◦ C for 50 s, and 72 ◦ C for 60 s, followed by a final extension of 72 ◦ C for 10 min. The flanking regions of the IL-22 genomic sequence were obtained using genome walking method. Genome walking libraries were constructed using a Genome Walker kit (Takara, Otsu, Japan) according to the manufacturer’s instructions. Based on the user manual, for cloning the 5 flanking region PCR was performed using genespecific primers (IL22-5g1, IL22-5g2) and adaptor primers (AP1, AP2), and using gene specific primers (IL22-3g1, IL-22-3g2) and adaptor primers (AP1, AP2) for the 3 flanking region. The resultant amplicons were ligated, transformed, cloned and sequenced. The gene exon/intron structure was determined by aligning the

Table 1 Primers used for cloning and expression analysis. Primer name

Sequence (5 –3 )

Application

IL-22dF1 IL-22dR1 UPM

GCCAACATCCTGGACTTCTAC GAAGAGGATGTCVAYCTC Long—CTAATACGACTCACTATAGGGCAAGCAG-TGGTATCAACGCAGAGT Short—CTAATACGACTCACTATAGGGC ACATCCTGAATCACCATGACAGCCAACA TCCACCGGCTGAAGACCAACCTGCACC TTGGTCTTCAGCCGGTGGATG TGTTGGCTGTCATGGTGATTCA GAGGATGTCCGGGTCGTGTC GCAGCGTGGTGATGGTCGTG GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT GGCTGAAGACCAACCTGCACCG TTCAGACTGAGCCGGTGTTTGTTA GGTGGACTCATGGGCTGGTT ACGGAGGACGCTGGAGGAGA AGAGTCACCACCGACCAGG GCGTGGTGATGGTCGTGAT CAGTATTGGACCTGTGGG CTAAGACCGCACCGCACA CAGCCATACTGTGCCCATCT TCCTTGATGTCACGCACGAT GGATCCCACCCGCTGAATCAAC GGTACCTCACTGATTCTTCTTC

RT-PCR

IL22-3out IL22-3in IL22-5out IL22-5in IL22gR1 IL22gF1 AP1 AP2 IL22-3g1 IL22-3g2 IL22-5g1 IL22-5g2 IL22-F1 IL22-R1 BD-F1 BD-R1 ␤-Actin F1 ␤-Actin R1 exIL22-F exIL22-R

RACE-PCR

Genome walking

Real-time PCR

Protein expression

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

cDNA sequence with the genome sequence using the WBLAST2 program (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi). Sequences of all primers are listed in Table 1. 2.4. Sequence and phylogenetic analyses The amino acid (a.a.) sequence was predicted using the translate tool, and the molecular weight, the isoelectric point (pI), and the net charge of the peptide were calculated using the ProtParam tool, both available on the ExPASy molecular biology server (http://www.expasy.org/tools). The signal peptide of the protein was identified using the SignalP program (version 3.0) (www.cbs.dtu.dk/services/SignalP) (Bendtsen et al., 2004). Multiple sequence alignments were generated using CLUSTAL W (version 1.83) (Thompson et al., 1994), and annotated using GeneDoc software (http://www.psc.edu/biomed/genedoc). The identities between each pair of the a.a. sequences were calculated using the MatGAT package (version 2.02) (Campanella et al., 2003). The phylogenetic tree was constructed using the Neighbor-Joining (N-J) method in the MEGA 4.1 software (Kumar et al., 2008), with 10,000 bootstrap replicates. 2.5. Analysis of mullet IL-22 expression at the mRNA level in healthy fish The expression of mullet IL-22 mRNA in tissues of healthy fish, including liver, spleen, kidney and gut, was detected by quantitative real-time PCR (qRT-PCR). Total RNA was extracted from different tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and digested by RNase-free DNase I (Takara Bio, Otsu, Japan) incubation for 20 min at 37 ◦ C. First-strand cDNA was synthesized using a PrimeScript® RT reagent kit (Takara, Otsu, Japan) with Oligo dT/random hexamerprimers, according to the manufacturer’s protocol. cDNA was diluted in diethyl dicarbonate (DEPC)-treated water and stored at −20 ◦ C. The fragments of mullet ␤-actin (reference gene) and IL-22 (target gene) were amplified by RT-PCR, and sub-cloned into pMD18-T vector. The cloned amplicons were confirmed by sequencing. The plasmid DNA was extracted with a QIAGEN plasmid mini kit, and the concentration was measured by spectrophotometer at 260 nm wave length. The corresponding copy number was calculated as 1 ␮g of 1000-bp DNA = 9.1 × 1011 molecules. The plasmid solution was diluted in ten-fold (from 10−8 to 10−2 ) in order to generate the standard curve. qRT-PCR experiments were performed using SYBR Green fluorescent dye (Invitrogen, Carlsbad, CA, USA) on an ABI Real-time PCR system (Life Technologies, Carlsbad, CA, USA). Reactions were carried out using a two-step method: 1 cycle of 30 s at 95 ◦ C, followed by 40 cycles of 95 ◦ C for 5 s and 60 ◦ C for 31 s. The reaction system of 20 ␮L contained 1 ␮L cDNA template, 10 ␮L SYBR premix ExTaq, 0.4 ␮L 50 × Rox reference dye, 1 ␮L of each primer and 6.6 ␮L ddH2 O. Each sample was tested in triplicate. The specificity of amplification was analyzed using dissociation curves with temperatures ranging from 60 ◦ C to 95 ◦ C. The relative expression of mullet IL-22 was normalized to the expression level of mullet ␤-actin. Primer sequences are given in Table 1. 2.6. S. dysgalactiae infection and quantitative analysis of mullet IL-22 expression We previously determined that the LD50 of S. dysgalactiae for mullet was 5.4 × 106 CFU (Qi et al., 2013), therefore, the dosage of 2 × 106 CFU was used for the challenge experiment in the present study. Twenty mullet were randomly divided into two groups. One group was injected intraperitoneally with 100 ␮L PBS (control group), while the other group was injected with 100 ␮L live

247

bacteria (challenge group). At 24 h post-injection, liver, spleen, kidney and gut tissues from nine fish in each group were collected for total RNA extraction, respectively. Following the total RNA extraction and DNase I treatment, 2 ␮g of total RNA was transcribed into cDNA using PrimeScript® RT reagent kit. Real-time PCR experiments for quantifying the expression level of mullet IL-22 gene were conducted on an ABI Real-time PCR system as described in Section 2.5. All samples were performed in triplicate. The molecular number of particular gene transcript was calculated based on the standard curve and normalized to the ␤-actin level. The fold changes of target gene after bacterial infection were calculated using the following formula: fold changes = (C of IL-22 in experimental sample)/(C of ␤-actin in



experimental sample)] / (C of IL-22 in control sample)/



(C of ␤-actin in control sample , where C is the relative concentration obtained by standard curve. The data of experiment were treated with Microsoft Excel. Results were expressed as mean ± S.E. Two-tailed Student’s t-test was used for the significance evaluation of the expression difference between the challenge group and the control group. A P-value of <0.05 was considered to be statistically significant. 2.7. Prokaryotic expression and purification of recombinant mullet IL-22 (mrIL-22) The production and purification of recombinant mullet IL-22 was performed as described in our previous study (Qi et al., 2010). Briefly, a pair of gene-specific primers (exIL22-F/exIL22-R) containing BamHI and KpnI restriction enzyme sites were designed to amplify the coding region of mullet IL-22, but not including the leader peptide. The PCR products were inserted into the pQE 30 vector (Qiagen, Germantown, USA) to construct the recombinant expression plasmid, named as pQE-30-mIL22. The plasmid was then transformed into E. coli M15 and induced by isopropyl ␤-d-1-thiogalactopyranoside (IPTG) at 37 ◦ C for 4 h. The recombinant protein was purified by affinity chromatography and analyzed using SDS-PAGE, as described by Zou et al. (2007). The bacterial endotoxins were removed by filtration through a polymyxin B column (Sigma, St. Louis, MO, USA). The protein was quantified using the Bradford assay with bovine serum albumin (BSA) as standard and a NanoDrop spectrophotometer (Thermo Scientific). 2.8. Expression analysis of ˇ-defensin after mrIL-22 treatment in vivo Twenty mullet were randomly divided into two groups. Each of the treated group was injected intraperitoneally with 850 ␮L of mrIL-22 0.12 mg/mL solution, containing 100 ␮g mrIL-22 (20 mg/kg body weight), and the other group with the same volume of elution buffer (EB) as control. At 12, 24 and 48 h post treatment, spleen, liver, kidney and gut tissues from three fish in each group were collected for total RNA extraction, respectively. The expression level of mullet ␤-defensin (GenBank accession no. KJ872680) in the four tissues was detected using qRT-PCR and analyzed by the methods described above. 2.9. IL-22 treatment and bacterial challenge experiments Twenty fish were randomly divided into two groups. For the IL-22 treated group, each fish was injected intraperitoneally with 850 ␮L of mrIL-22 solution (20 mg/kg body weight), while fish in the control group with the same volume of EB solution. At 24 h post-injection, all test fish were inoculated by intraperitoneal injection with 100 ␮L of live S. dysgalactiae (2 × 106 CFU). Mortality was recorded daily. The experiments were repeated for three

248

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

times independently. The results were analyzed statistically using Student’s t-test in Microcal Origin 6.0 software package with P < 0.05 considered as significantly different between control and IL-22 treated groups.

isoelectric point of 6.52. At the 3 -end of the mullet IL-22 there was a conserved IL-10 family signature (G-X2-KA -X2-[D,E]-XD[ILV]-[FLY]-[FILMV]-X2-[ILMV][EKQR]). Four conserved cysteine residues existing in IL-22s from other fish species were also found in mullet IL-22 (Fig. 1).

3. Results 3.2. Structure of mullet IL-22 gene 3.1. Molecular characterization of mullet IL-22 cDNA The full-length cDNA sequence of mullet IL-22 was 1070 bp (GenBank accession no. JF960524), including 150 bp of 5 -UTR, 555 bp of open reading frame (ORF), and 365 bp of 3 -UTR. At the 3 UTR there were six mRNA instability motifs (ATTTA) and a polyadenylation signal (AATAAA) 14 bp upstream of the poly (A) tail (Fig. 1). The ORF of mullet IL-22 cDNA coded 184 a.a. The a.a. sequence was predicted to contain a 36 a.a. signal peptide. Thus, the mature peptide of mullet IL-22 was speculated to consist of 148 a.a., with the predicted molecular weight of 17.16 kDa and the theoretical

The amplified genomic DNA fragment of mullet IL-22 was 2670 bp (GenBank accession no. KJ941331), presenting the form of six exons and five introns, which was the same to the gene structure of chicken and trout IL-22s. The length of the six exons and the five introns were 93, 239, 66, 150, 60 and 441 bp, and 92, 224, 87, 481 and 512 bp, respectively. All introns were phase 0 and had typical “GT/AG” intron splice motifs. The mullet IL-22 introns were smaller compared with the counterparts in mammals, frogs, and zebrafish. The 5 -UTR of mullet IL-22 was encoded by exon 1 and part of exon 2 (56 bp), while exon 6 encoded the C-terminus of the peptide and the 3 -UTR (Fig. 1).

Fig. 1. Nucleotide and cDNA-derived amino acid sequences of mullet IL-22. Nucleotides shown in lower cases represent the UTRs, while capital letters represent the ORF. The start codon is marked in grey and the stop codon is boxed. The mRNA instability motifs (attta) are double underlined and the polyadenylation signal (aataaa) is shown in a grey box. The predicted signal peptide of IL-22 is underlined, and the conserved IL-10 family signature motif is shaded. The four conserved cysteine residues are cycled. The intron positions determined from genomic DNA are indicated by arrows.

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

249

mullet IL -22

53 57

seabass IL-22

60

turbot IL- 22

55

trout IL-22 tilapia IL -22

95 48

haddock IL -22 cod IL- 22

100

60

tetraodonIL -22 93

zebrafishIL-22 frog IL-22 mouse IL- 22 92

human IL -22

99

cow IL- 22

83 48

99

goat IL-22

100 human IL-24 73 100

chimpanzee IL -24 mouse IL -24 cow IL -24 mouse IL -19

99 90 94

human IL-19

98

platypus IL -19 chicken IL -19 platypus IL -20

95

opossum IL -20 61

mouse IL -20

96 99 62

human IL -20 dog IL -20 frog IL -26 platypus IL-26

98 98

99 45 100

human IL-26 dog IL -26 100 cow IL -26 67 fugu IL -10 tetraodonIL- 10 trout IL-10 zebrafishIL-10

chicken IL- 10

85

frog IL -10 89

cow IL -10

51 99 78

human IL-10 mouse IL- 10

0.2 Fig. 2. Phylogenetic tree analysis of the relationship of the mullet IL-22 with other known IL-10 family members. The tree was constructed using MEGA 4.1 software by the N-J method. GenBank accession numbers of the protein sequences used in the analysis are as follows: IL-10: human NP 000563, cow NP 776513, mouse NP 034678, fugu Q802T4, tetraodon Q7ZSY8, trout Q6L8N7, zebrafish AAW78362, chicken NP 001004414, and frog NP 001165400; IL-20: human NP 061194, dog XP 851510, mouse NP 067355, opossum XP 001372605, and platypus XP 001520168; IL-19: chicken XP 425824, platypus XP 001520251, mouse NP 001009940, and human NP 715639; IL-26: human NP 060872, rhesusmacaque XP 001117154, dog XP 851168, cow XP 002687441, platypus XP 001511189, and frog ABU54058; IL-24: human AAH09681, chimpanzee XP 001165501, mouse NP 444325, and cow XP 604649; IL-20L: trout NP 001182115, zebrafish Q4LDR4, tetraodon Q7SX60, and fugu CAE50924; IL-22: mouse AAI16236, rat NP 001178917, human NP 065386, cow NP 001091849, goat ADL28382, frog NP 001135725, zebrafish NP 001018628, haddock CAN84587, cod CAR63747, tetraodon AAP57418, seabass AM951926, tilapia XP 003448179, and turbot JQ349070.

250

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

A Gene expression relative to -actin

0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 Liver

B

7

*

6

Fold changes

Spleen

Kidney

Gut Fig. 4. Production and purification of recombinant mullet IL-22 examined by SDSPAGE. Lane M: protein marker; lane 1: flow-through solution from the column; lane 2: purified mullet IL-22.

* *

5 4

3.5. Tissue expression of Mullet IL-22 post bacterial challenge

*

The results of qRT-PCR examination showed that compared with the control group, the expression of mullet IL-22 transcript in the bacteria-challenged group increased significantly during 24 h post challenge (P < 0.05). The fold changes in liver, spleen, kidney and gut were 3.3, 5.2, 5.8 and 4.9, respectively (Fig. 3B).

3 2 1 0 Liver

Spleen

Kidney

Gut

Fig. 3. Tissue expression of IL-22 in healthy and challenged with S. dysgalactiae mullets. (A) Expression of IL-22 in healthy mullet. Expression of mullet IL-22 transcript was measured using qRT-PCR and normalized to the house-keeping gene ␤-actin. (B) Expression of IL-22 in mullet challenged with S. dysgalactiae. Fish in the challenged group were injected intraperitoneally with 2 × 106 CFU S. dysgalactiae and the control injected with the same volume of PBS solution. Asterisks indicate that the expression level in S. dysgalactiae challenged mullet is significantly higher than that of the control (* P < 0.05).

3.3. Sequence homology and phylogenetic relationships of mullet IL-22 The a.a. sequence identity between mullet IL-22 and mammalian IL-22 was fairly low, ranging from 20.9 to 22.5%, with 20.9% identity to cow IL-22 and 22.5% identity to human IL-22. Mullet IL22 shared 25.4–47.2% a.a. sequence identity with IL-22 from other fish species, with the lowest identity to zebrafish IL-22 and the highest identity to haddock IL-22. Analysis of a.a. sequence similarity showed that mullet IL-22 shared similarity of 48.4–51.1% with mammalian IL-22, and 45.1–67.9% with IL-22 from other fish species. The phylogenetic tree constructed in this study showed that different members of the IL-10 family were clustered together with their counterparts from other species. The tree was separated into four main clusters, corresponding IL-10, IL-26, IL-19/-20/-24, and IL-22. The IL-22 clade was further divided into two sub-clusters, i.e. tetrapod IL-22s and teleost IL-22s. Mullet IL-22 was located in the IL-22 clade and grouped closely with IL-22s of other fish (Fig. 2).

3.4. Tissue distribution of mullet IL-22 transcript The expression of IL-22 in the tissues of healthy mullet, including liver, spleen, kidney and gut, was determined by qRT-PCR. IL-22 mRNA transcript was detected in all of the examined tissues, with the highest level of expression seen in kidney, the moderate expression in liver and gut, and the weakest expression in the spleen of mullet (Fig. 3A).

3.6. Expression of mullet ˇ-defensin after mrIL-22 treatment in vivo To determine the role of mullet IL-22 in the immune regulation, recombinant protein of mullet IL-22 was expressed in E. coli. The induced IL-22 was purified by Ni-NTA metal affinity chromatography under native conditions. SDS-PAGE showed that purified recombinant protein had a molecular weight of about 18.5 kDa (Fig. 4), which was close to the predicted molecular weight, i.e. 17.16 kDa of mIL-22 mature peptide plus 1.3 kDa of N-terminal 6-His tag. The protein concentration of the mrIL-22 solution was 0.12 mg/mL. Mullets were injected intraperitoneally with mrIL-22 and the expression of mullet ␤-defensin was detected by qRT-PCR. The results showed that at 12 h post treatment with mrIL-22 the expression level of the ␤-defensin in kidney, liver, spleen and gut, was significantly up-regulated (P < 0.05). As the time prolong to 24 h, the expression of ␤-defensin in gut and kidney were still higher than the counterparts in control group (P < 0.05), especially in kidney, while the expression of ␤-defensin in liver and spleen had been back to the level of control group. At 48 h post treatment, the expression of ␤-defensin in all examined tissues declined significantly compared with 12 h post treatment, however, the expression level in gut and kidney was still higher than the counterparts in control group (P < 0.05) (Fig. 5). 3.7. Mortality rate post-bacterial challenge of fish treated with mrIL-22 After treatment with mrIL-22, fish were challenged with S. dysgalactiae by intraperitoneal injection. Results clearly showed that the mortality rate greatly decreased in the treated group compared with the control group (P < 0.05). At day 3 post-bacterial challenge, the mortality of the treated group was negligible, while more than 40% of the control group animals had died. At day 4 post-challenge, the fish in the treated group began to die, and the mortality rate of each day from day 4 to day 7 post-challenge was relatively low compared with the control group. Until day 7 most of the fish in the treated group remained mainly healthy, with a

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

3.5

12 h

Fold change

3 2.5 2 1.5

*

*

*

* **

*

24 h 48 h

*

1 0.5 0

Liver

Gut

Spleen

Kidney

Fig. 5. Tissue expression of ␤-defensin in mullets after treatment with mrIL-22 or EB (as control). The IL-22 treated group was injected with mrIL-22 (20 mg/kg body weight) and the control injected with the same volume of EB which was used to elute recombinant IL-22 during purification. The changes of ␤-defensin expression were detected by qRT-PCR and results were presented as mean ± standard error. Asterisks indicate that the difference of the expression level between the IL-22 treated group and the control is statistically significant (* P < 0.05).

Cumulative survival rate (%)

100

*

90

**

80

**

***

70

**

60 50

**

40 30 EB mrIL-22 and bacterial infection EB and bacterial infection

20 10 0 1

2

3

4

5

6

7

Day Fig. 6. Survival rate of fish treated with mrIL-22 post S. dysgalactiae challenge. The treated group was injected with mrIL-22 (20 mg/kg body weight) and the control injected with the same volume of EB solution. At 24 h post-injection, fish from both groups were challenged with 100 ␮L of live S. dysgalactiae (2 × 106 CFU). The mortality was recorded daily. * P < 0.05, ** P < 0.01, *** P < 0.001.

cumulative mortality rate of only about 40%, while 100% of the control fish had died at the same time point (Fig. 6). 4. Discussion In this study, we reported the identification and characterization of IL-22 from the So-iny mullet (L. haematocheila). The mullet IL22 protein sequence shared conserved structures with IL-22s from other species, including an IL-10 family signature at the C-terminus and four conserved cysteine residues. However, the positions of the cysteine residues varied in different species. The four cysteine residues in mullet IL-22 were aligned well with that of haddock and cod IL-22s (Corripio-Miyar et al., 2009), while the positions of two cysteine residues in zebrafish IL-22 were the same as in mammals (Igawa et al., 2006). The four cysteines in fish are suggested to form two inter-chain disulfide bonds (Jones et al., 2008), indicating that the protein structure of mullet IL-22 might differ from that of mammalian IL-22. In addition, the first amino acid in the IL-10 family signature (RVVKAVGEIDILFTYLQ) of mullet IL-22 was occupied by R, rather than by the ordinary G. This site is also different in zebrafish, which is occupied by A. However, in fish IL-22s having been studied, other amino acid residues in the IL-10 family signature motif are well conserved. Whether such a change affects the function or the structure of IL-22 in mullet and zebrafish requires further investigation.

251

Mullet IL-22 possessed a six-exon/five-intron gene structure, which is similar to the gene structure of trout and chicken IL-22s (Monte et al., 2011). The extra exon in the 5 -UTR was also found in other IL-10 family members, such as human IL-20, -24 and trout IL20L indicating the genomic structure of IL-22 might not be defined by the five exons/four introns pattern and alternative splicing might also play its role in the forming of IL-10 family members during evolution (Dumoutier et al., 2000a; Wang et al., 2010). Quantitative real-time PCR analysis demonstrated that mullet IL-22 mRNA was constitutively expressed in the lymphoid and mucosal tissues. A similar expression pattern was also observed in other fish species, including zebrafish, trout, cod, and haddock (Igawa et al., 2006; Monte et al., 2011). These results suggest that IL-22 might play an important role in the mucosal immunity of fish. Interestingly, we also detected the expression of mullet IL22 in liver tissues. Similarly, it has been reported that trout and turbot IL-22s were expressed in liver (Monte et al., 2011; Costa et al., 2012). The constitutive expression pattern of IL-22 indicates that multiple tissues or organs are involved in the secretion of this cytokine. Bacterial infection can induce significantly the expression of fish IL-22 in several immune related tissues. Turbot (Scophthalmus maximus) IL-22 was greatly increased in kidney, spleen, and liver following stimulation with Aeromonas salmonicida (Costa et al., 2012), while trout IL-22 was induced in spleen tissue following Yersinia ruckeri infection (Monte et al., 2011). Furthermore, haddock IL-22 expression in gill tissue could be induced by formalin-killed Vibrio anguillarum (Corripio-Miyar et al., 2009). In the present work, we observed that the expression of IL-22 was highly increased in immune-related tissues following S. dysgalactiae infection, confirming that fish IL-22 is involved in the host immune defense against bacterial infection, which is similar to the function of mammalian IL-22 (Aujla et al., 2008; Zheng et al., 2008). Studies in mammals suggest that IL-22 plays an antimicrobial role by enhancing the expression of AMPs (such as ␤-defensins 2 and 3) and pro-inflammatory cytokines (such as IL-6 and IL-8) (Liang et al., 2006; Aujla et al., 2008; Zheng et al., 2008). In vitro recombinant fish IL-22s also enhanced the expression of AMPs, demonstrating IL-22 functions are likely to be conserved. Trout IL-22 could significantly increase the expression of several AMPs including ␤-defensin 3, ␤-defensin 4, leap-2A and hepcidin, but did not affect the expression of TNF-␣1, IFN-␥ and IL-1␤ after 6-h treatment (Monte et al., 2011). In the current study, in vivo administration of mullet IL-22 could increase the expression of mullet ␤-defensin in the tissues, suggesting that mullet IL-22 plays an immune regulatory role to activate antibacterial response in the lymphoid and mucosal tissues. The increase of mullet ␤-defensin expression in the liver after IL-22 treatment suggests that fish IL-22 might provide diverse protective function in the immune defense related tissues. The immune protection elicited by IL-22 is supported by the fact that mullet IL-22 significantly improved the survival rate of fish challenged with S. dysgalactiae. These results imply that IL-22 could be potentially applied as vaccine adjuvant in fish. The present study provides the first demonstration of the in vivo function of IL-22 in fish during bacterial infection. In conclusion, an IL-22 homolog was identified from So-iny mullet in the present study. The mullet IL-22 mRNA was expressed primarily in immune related organs and up-regulated by challenge with S. dysgalactiae. Furthermore, recombinant mullet IL-22 protein improved the expression level of mullet ␤-defensin and increased the survival rate of fish infected with S. dysgalactiae. The results demonstrate that IL-22 plays an important role in promoting the innate antibacterial immunity in vivo, and provide new insights into the functions of fish IL-22 and its application in treatment of fish bacterial diseases.

252

Z. Qi et al. / Molecular Immunology 63 (2015) 245–252

Acknowledgments This study was financially supported by the National Natural Science Foundation of China (Grant nos. 31302221 and 31272666) and Jiangsu Province (Grant no. BK2011418), and the Natural Science Foundation of the Jiangsu Higher Education Institutions of China (Grant no. 10KJB24001). We thank Dr. Aihua Li, State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, the Chinese Academy of Sciences, for kindly providing S. dysgalactiae, and Dr. Jun Zou, Scottish Fish Immunology Research Center, University of Aberdeen, for his help in designing the degenerate primers and his comments on the manuscript. References Aujla, S.J., Chan, Y.R., Zheng, M., Fei, M., Askew, D.J., Pociask, D.A., Reinhart, T.A., McAllister, F., Edeal, J., Gaus, K., Husain, S., Kreindler, J.L., Dubin, P.J., Pilewski, J.M., Myerburg, M.M., Mason, C.A., Iwakura, Y., Kolls, J.K., 2008. IL-22 mediates mucosal host defence against Gram-negative bacterial pneumonia. Nat. Med. 14, 275–281. Basu, R., Oquinn, D.B., Silberger, D.J., Schoeb, T.R., Fouser, L., Ouyang, W., Hatton, R.D., Weaver, C.T., 2012. Th22 cells are an important source of IL-22 for host protection against Enteropathogenic Bacteria. Immunity 37, 1061–1075. Bendtsen, J.D., Nielsen, H., Heijne, G.V., Brunak, S., 2004. Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340, 783–795. Campanella, J.J., Bitincka, L., Smalley, J., 2003. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinf. 4, 29. Chung, Y., Yang, X., Chang, S.H., Ma, L., Tian, Q., Dong, C., 2006. Expression and regulation of IL-22 in the IL-17-producing CD4+ T lymphocytes. Cell Res. 16, 902–907. Corripio-Miyar, Y., Zou, J., Richmond, H., Secombes, C.J., 2009. Identification of interleukin-22 in gadoids and examination of its expression level in vaccinated fish. Mol. Immunol. 46, 2098–2106. Costa, F.A., Leal, C.A., Leite, R.C., Figueiredo, H.C., 2013. Genotyping of Streptococcus dysgalactiae strains isolated from Nile tilapia, Oreochromis niloticus (L.). J. Fish Dis., http://dx.doi.org/10.1111/jfd.12125. Costa, M.M., Pereiro, P., Wang, T., Secombes, C.J., Figueras, A., Novoa, B., 2012. Characterization and gene expression analysis of the two main Th17 cytokines (IL-17A/F and IL-22) in turbot, Scophthalmus maximus. Dev. Comp. Immunol. 38, 505–516. Dumoutier, L., Louahed, J., Renauld, J.C., 2000a. Cloning and characterization of IL10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. J. Immunol. 164, 1814–1819. Dumoutier, L., Van Roost, E., Ameye, G., Michaux, L., Renauld, J.C., 2000b. IL-TIF/IL22: genomic organization and mapping of the human and mouse genes. Genes Immun. 1, 488–494. Gurney, A.L., 2004. IL-22, a Th1 cytokine that targets the pancreas and select other peripheral tissues. Int. Immunopharmacol. 4, 669–677. Igawa, D., Sakai, M., Savan, R., 2006. An unexpected discovery of two interferon gamma like genes along with interleukin (IL)-22 and -26 from teleost: IL-22 and -26 genes have been described for the first time outside mammals. Mol. Immunol. 43, 999–1009.

Jones, B.C., Logsdon, N.J., Walter, M.R., 2008. Structure of IL-22 bound to its highaffinity IL-22R1 chain. Structure 16, 1333–1344. Kumar, S., Dudley, J., Nei, M., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief Bioinf. 9, 299–306. Leung, J.M., Loke, P., 2012. A role for IL-22 in the relationship between intestinal helminthes, gut microbiota and mucosal immunity. Int. J. Parasitol., http://dx.doi.org/10.1016/j.ijpara.2012.10.015. Liang, S.C., Tan, X.Y., Luxenberg, D.P., Karim, R., Dunussi-Joannopoulos, K., Collins, M., Fouser, L.A., 2006. Interleukin (IL)-22 and IL-17 are co-expressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J. Exp. Med. 203, 2271–2279. Ma, H.L., Liang, S., Li, J., Napierata, L., Brown, T., Benoit, S., Senices, M., Gill, D., Dunussi-Joannopoulos, K., Collins, M., Nickerson-Nutter, C., Fouser, L.A., Young, D.A., 2008. IL-22 is required for Th17 cell-mediated pathology in a mouse model of psoriasis-like skin inflammation. J. Clin. Invest. 118, 597–607. Monte, M.M., Zou, J., Wang, T.H., Carrington, A., Secombes, C.J., 2011. Cloning, expression analysis and bioactivity studies of rainbow trout (Oncorhynchus mykiss) interleukin-22. Cytokines 55, 62–73. Qi, Z.T., Nie, P., 2008. Comparative study and expression analysis of the interferon gamma gene locus cytokines in Xenopus tropicalis. Immunogenetics 60, 699–710. Qi, Z.T., Nie, P., Secombes, C.J., Zou, J., 2010. Intron-containing type I and type III IFN coexist in amphibians: refuting the concept that a retroposition event gave rise to type I IFNs. J. Immunol. 184, 5038–5064. Qi, Z.T., Tian, J.Y., Zhang, Q.H., Shao, R., Qiu, M., Wang, Z.S., Wei, Q.J., Huang, J.T., 2013. Susceptibility of soiny mullet (Liza haematocheila) to Streptococcus dysgalactiae and physiological response to formalin inactivated S. dysgalactiae. Pak. Vet. J. 33, 234–236. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. ´ Wang, T.H., Dlaz-Rosales, P., Martin, S.A.M., Secombes, C.J., 2010. Cloning of a novel interleukin (IL)-20-like gene in rainbow trout Oncorhynchus mykiss gives an insight into the evolution of the IL-10 family. Dev. Comp. Immunol. 34, 158–167. Vossen, A., Abdulmawjood, A., Lämmler, C., Weiß, R., Siebert, U., 2004. Identification and molecular characterization of beta-hemolytic streptococci isolated from harbor seals (Phoca vitulina) and grey seals (Halichoerus grypus) of the German North and Baltic seas. J. Clin. Microbiol. 42, 469–473. Wolk, K., Sabat, R., 2006. Interleukin-22: a novel T- and NK-cell derived cytokine that regulates the biology of tissue cells. Cytokine Growth Factor Rev. 17, 367–380. Xie, M.H., Aggarwal, S., Ho, W.H., Foster, J., Zhang, Z., Stinson, J., Wood, W.I., Goddard, A.D., Gurney, A.L., 2000. Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor related proteins CRF2-4 and IL-22R. J. Biol. Chem. 275, 31335–31339. Yang, W.M., Li, A.H., 2009. Isolation and characterization of Streptococcus dysgalactiae from diseased Acipenser schrenckii. Aquaculture 294, 14–17. Zheng, Y., Danilenko, D.M., Valdez, P., Kasman, I., Eastham-Anderson, J., Wu, J.F., Ouyang, W., 2007. Interleukin-22, a Th 17 cytokine, mediates IL-23-induced dermal inflammation and acanthosis. Nature 445, 648–651. Zheng, Y., Valdez, P.A., Danilenko, D.M., Hu, Y., Sa, S.M., Gong, Q., Abbas, A.R., Modrusan, Z., Ghilardi, N., de Sauvage, F.J., Ouyang, W., 2008. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat. Med. 14, 282–289. Zou, J., Tafalla, C., Truckle, J., Secombes, C.J., 2007. Identification of a second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. J. Immunol. 179, 3859–3871.