Molecular detection of Babesia bovis and Babesia bigemina in white-tailed deer (Odocoileus virginianus) from Tom Green County in central Texas

Veterinary Parasitology 177 (2011) 298–304

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Molecular detection of Babesia bovis and Babesia bigemina in white-tailed deer (Odocoileus virginianus) from Tom Green County in central Texas Patricia J. Holman ∗ , Juliette E. Carroll 1 , Roberta Pugh, Donald S. Davis Department of Veterinary Pathobiology, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843-4467, United States

a r t i c l e

i n f o

Article history: Received 20 September 2010 Received in revised form 24 November 2010 Accepted 26 November 2010 Keywords: Babesia bigemina Babesia bovis White-tailed deer 18S ribosomal RNA gene Intervening transcribed spacer PCR

a b s t r a c t Serologic and molecular evidence suggest that white-tailed deer in South Texas and North Mexico carry the agents of bovine babesiosis, Babesia bovis and Babesia bigemina. To determine if white-tailed deer in central Texas, which is outside the known occurrence of the vector tick at this time, harbor these parasites, blood samples from free-ranging and captive white-tailed deer (Odocoileus virginianus) in Tom Green County were tested by polymerase chain reaction (PCR) assays for B. bovis and B. bigemina 18S rDNA. Of the 25 samples tested, three (12%) were positive by nested PCR for B. bovis. This identity was confirmed by sequence analysis of the cloned 18S rDNA PCR product. Further confirmation was made by sequence analysis of the rRNA internal transcribed spacer (ITS) 1, 5.8S rRNA gene, and ITS 2 genomic region in two (representing samples from two different ranches) of the B. bovis positive samples. Three samples were positive by B. bigemina nested PCR, but sequencing of the cloned products confirmed only one animal positive for B. bigemina; Theileria spp. DNA was amplified from the other two animal samples. In addition to Theileria spp., two genotypically unique Babesia species sequences were identified among the cloned sequences produced by the B. bigemina primers in one sample. Phylogenetic analysis showed no separation of the deer B. bovis or B. bigemina 18S rDNA, or deer B. bovis ITS region sequences from those of bovine origin. Clarification of the possible role of white-tailed deer as reservoir hosts in maintaining these important pathogens of cattle is critical to understanding whether or not deer contribute to the epidemiology of bovine babesiosis. © 2010 Published by Elsevier B.V.

1. Introduction Babesia bovis and Babesia bigemina are causative agents of bovine babesiosis transmitted by Cattle Fever ticks, Rhipicephalus (Boophilus) spp. An intensive 36-year campaign by the Cattle Fever Tick Eradication Program (CFTEP)

∗ Corresponding author. Tel.: +1 979 845 4202; fax: +1 979 862 2344. E-mail address: [email protected] (P.J. Holman). 1 Current address: College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, CO, United States. 0304-4017/$ – see front matter © 2010 Published by Elsevier B.V. doi:10.1016/j.vetpar.2010.11.052

cleared the vector ticks from the U.S. nearly 60 years ago. Since then a permanent Fever Tick quarantine buffer zone has been maintained in Texas along the Rio Grande to prevent re-establishment of the vector tick and concomitant outbreaks of bovine babesiosis in the U.S. (Graham and Hourrigan, 1977; Bram et al., 2002). Fever ticks are one-host ticks that preferentially feed on cattle but will feed on alternate ungulate hosts, such as white-tailed deer (Pound et al., 2010). The role of whitetailed deer in the recent resurgence of Fever Tick outbreaks in Texas is of major concern. As traditional cattle ranches turn increasingly to recreational ventures, the white-tailed

P.J. Holman et al. / Veterinary Parasitology 177 (2011) 298–304

299

Table 1 Details for white-tailed deer blood samples. ID

W1 W2 W3 H1 H2 H3 N3 N4 H4 H5 D1 D2 H6 H7 H8 NR6 NR7 NR8 N9 N10 N11 N12 H9 H10 H11

Collection date

5-20-08 5-20-08 5-20-08 5-20-08 5-20-08 5-20-08 7-7-08 7-7-08 7-7-08 7-7-08 7-7-08 7-7-08 7-28-08 7-28-08 7-28-08 7-28-08 7-28-08 7-28-08 9-9-08 9-9-08 9-9-08 9-9-08 9-9-08 9-9-08 9-9-08

Ranch

N N N N N N S S S S W W N N N S S S S S S S N N N

Giemsa-stained blood film

18S rDNA PCR

Theileria

Babesia

B. bigemina

B. bovis

Positive Positive Positive Positive Positive Positive Positive Positive Negative Positive Negative Positive Positive Positive Positive Negative Negative Positive Negative Positive Positive Negative Positive Positive Positive

Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative

Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Positivea Negative Negative Negative Negative Negative Negative Negative Negative Positiveb Negative

Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Positive Negative Positive Negative Negative Negative Negative Negative Negative Negative

Positive results are shown in bold type; positive PCR results are in bold type and underlined. a Identified as Theileria sp. by sequence analysis. b Identified as Theileria sp. and Babesia spp. by sequence analysis.

deer population is burgeoning. It is feared that these large numbers of deer not only may serve as hosts for the tick, but also as reservoirs for bovine Babesia spp. (Perez de Leon et al., 2010). Molecular and serologic evidence of bovine Babesia spp. in white-tailed deer in northern Mexico states bordering Texas and in South Texas counties (LaSalle and Webb) was recently documented (Cantu et al., 2007, 2009; Ramos et al., 2010). However, the white-tailed deer in Webb and LaSalle counties in South Texas were infected with B. bovis-like organisms with single nucleotide polymorphisms in 18S rRNA gene that differentiated them from bovine B. bovis isolates (Ramos et al., 2010). In the current study, whitetailed deer in central Texas (Tom Green County) were surveyed molecularly for the presence of B. bovis and B. bigemina using a polymerase chain reaction (PCR) targeting the parasite 18S ribosomal RNA gene. Further molecular and sequence analyses were conducted on the genomic DNA region comprising the rRNA intervening transcribed spacers and the 5.8S rRNA gene in B. bovis PCR-positive samples. 2. Materials and methods Twenty-five white-tailed deer blood samples in ethylenediamine tetraacetic acid–K3 (EDTA) anticoagulant were obtained as shared samples in May, July, and September 2008 from collections in Tom Green County, Texas (Texas Parks and Wildlife Department, Scientific Permit Research, SPR 0807-1416) for another ongoing study on epizootic hemorrhagic fever in deer. The deer

were located on 3 different ranches: one in the northern part of the county (N), one in the southern part (S), and one to the west of San Angelo (W) (Table 1). The deer on ranches N and S were free-ranging, whereas the deer on ranch W were captive. Bovine blood samples (USDA and Merida) from B. bovis natural infections were included as regional isolate controls for 18S rDNA sequences due to the variation found in B. bovis rDNA sequences available in the GenBank database. A Giemsa-stained blood smear from each white-tailed deer sample was examined microscopically under oil immersion at 1000× for the presence of hemoparasites. Genomic DNA was extracted (FlexiGene DNA Kit, Qiagen, Valencia, CA) from the blood samples and the concentration of each was determined by spectrophotometry (NanoDrop ND-1000 Spectrophotometer, NanoDrop Technologies, Wilmington, DE). Nested polymerase chain reactions were used to assay the samples for the presence of B. bovis and B. bigemina 18S rRNA genes. The primary reaction using primers A and B (Sogin, 1990) targeted the hemoparasite full-length 18S rRNA gene as previously described (Ramos et al., 2010) (Table 2). The reaction mixtures, excluding DNA, were composed following manufacturer’s instructions (Platinum High Fidelity Taq, Invitrogen) in a designated DNA-free hood with PCRdedicated equipment and materials. Approximately 50 ng DNA was then added to each reaction tube under a laminar flow hood in another room. Water was included as a negative control and a plasmid containing B. bigemina 18S rRNA gene served as a positive control for the primary PCR. The primary reactions (25 ␮l reaction volume) were cycled

300

P.J. Holman et al. / Veterinary Parasitology 177 (2011) 298–304

Table 2 Oligonucleotide primers for amplification of the 18S rRNA gene and rRNA ITS1-5.8S gene-ITS2 region from Babesia sp. Target

PCR

Primer, sense

Sequence 5 → 3

Annealing ◦ C

18S rRNA gene 18S rRNA gene 18S rRNA gene 18S rRNA gene 18S rRNA gene B. bovis-specific 18S rRNA B. bovis-specific 18S rRNA gene B. bovis-specific 18S rRNA gene Babesia spp. 18S rRNA gene B. bovis-specific 18S rRNA gene B. bovis-specific 18S rRNA gene B. bigemina-specific 18S rRNA gene B. bigemina-specific 18S rRNA gene B. bovis-specific 28S rRNA gene B. bovis-specific 28S rRNA gene

Primary 18S Primary 18S Nested 18S Nested 18S Primary ITS Nested 18S Nested 18S Nested ITS Nested ITS Nested 18S Nested 18S Nested 18S, Nested 18S Primary ITS Nested ITS

A, forward B, reverse AN, forward BN, reverse 528EXTF, forward Bbov700F, forward Bbov750F, forward Bbov1600F, forward Bsp1600F, forward Bbov1400R, reverse Bbov 900F Bbig200F, forward Bbig1400R, reverse BbovLSUR, reverse BbovLSURN, reverse

ACCTGGTTGATCCTGCCAG GATCCTTCTGCAGGTTCACCTAC GCTTGTCTTAAAGATTAAGCCATGC CGACTTCTCCTTCCTTTAAGTGATAAG CGGTAATTCCAGCTCCAATAGC CCC GCT TGG TCC TTT CCC CTTGTATGACCCTGTCGTACCG TGCGCGATCCGTCG CGATTCGTCGGTTTTGCC GGTAAACACGAGGCAAGCAT CGG ACA GAG ACC GAG C GCGTTTATTAGTTCGTTAACC ACAGGACAAACTCGATGGATGC CTTGTCTGCCGCTTAGTTATAGC GGATAGCCTCGTACATCTCAGG

60 60 60 60 56 56 56 56 56 56 56 56 56 56 56

through a 30 s denaturation at 94 ◦ C followed by 45 cycles at 94 ◦ C for 15 s, 60 ◦ C for 15 s, and 68 ◦ C for 2 min, with a final extension at 68 ◦ C for 7 min, then held at 4 ◦ C until use (Labnet MultiGene Thermal Cycler, Woodbridge, NJ). The resulting products (2 ␮l sample) were electrophoresed through a 1% agarose gel alongside a 100 bp DNA marker (Invitrogen), stained with ethidium bromide and visualized by ultraviolet transillumination. Based on the intensity of the bands in the gel, the resulting products were diluted 1:5, 1:10, or 1:20 before direct use as template in the nested PCR. Nested PCR to amplify the B. bovis 18S rRNA gene from the USDA bovine sample utilized primers AN and BN (Schoelkopf et al., 2005; Table 2). For the white-tailed deer samples, the B. bovis or B. bigemina internal fragment of the 18S rRNA gene was targeted in nested PCR using several different species-specific primer sets at the appropriate annealing temperatures as shown in Table 2. Water was included as a negative control and a plasmid containing either the B. bovis or B. bigemina 18S rRNA gene served as positive controls, respectively. The cycling protocol for nested PCR was as above, but reduced to 30 cycles with a 1 min 30 s extension interval. The resulting products were evaluated by agarose gel electrophoresis as above and amplicons of interest were cloned into TOPO PCR 2.1 and TOP 10 E. coli transformed according to manufacturer’s instructions (Invitrogen). Color-selected colonies were verified to contain the cloned insert by colony PCR using m13F and m13R primers, and verified colonies were expanded in overnight broth cultures and plasmid DNA prepared (Qiagen). The plasmid DNA concentration was determined and the inserts from a minimum of 3 clones were sequenced (Davis Sequencing, Davis, CA). To further characterize putative B. bovis isolates from deer, the Babesia sp. genomic DNA region spanning rRNA intervening transcribed spacer (ITS) 1–5.8S rRNA gene ITS2 was amplified as above initially using forward primer 528EXTF and reverse primer BbovLSUR at an annealing temperature of 56 ◦ C and extension time of 2 min. If a band was not visualized by subsequent agarose gel electrophoresis, the primary product was used as template in a nested reaction with primers Bsp1200F and BbovLSURN.

The resulting primary or nested amplicons were cloned and sequenced as described above. The obtained sequences were aligned, analysed and contiguous sequences determined using Sequencher 4.2 software (Gene Codes Corporation, Inc., Ann Arbor, MI), then compared to gene sequences in the GenBank database using the NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1990). Pair wise analysis of similar sequences was conducted using William Pearson’s LALIGN (http://www.ch.embnet.org/software/LALIGN form.html) (Huang and Miller, 1991). Putative B. bovis and B. bigemina 18S rDNA sequences from the deer parasites were aligned with corresponding sequences from the GenBank database and trimmed to aligned equivalent lengths of approximately 930–954 bp. A final alignment of parasite 18S rRNA gene sequences from the following taxa was constructed (Clustal W2, Larkin et al., 2007): white-tailed deer B. bovis (this study – H8 clone 11, NR8 clones 3 and 6, and NR6 clones 3, 4, and 5), bovine B. bovis (this study – USDA clones 4 and 6), white-tailed deer B. bigemina (this study – H7 clones 2 and 9); B. bovis-like 18S rDNA sequences previously reported in white-tailed deer from LaSalle and Webb counties in south Texas, GenBank Accession Nos. GU938837–54 (Ramos et al., 2010); bovine B. bovis Merida, Mexico, GU906883–GU906885 (Ramos et al., 2010); 18S rRNA gene copies from chromosome 3 and chromosome 4 of T2Bo strain from the B. bovis genome project (preliminary sequence data obtained from the Washington State University/USDA-ARS B. bovis genome project website at http://www.vetmed.wsu. edu/researchvmp/programin-genomics); bovine B. bigemina (EF458195, EF458193, and FJ4263611); Theileria annulata, EU0838011. A second alignment (Clustal W) was constructed of deer putative B. bovis rDNA ITS1-5.8S gene-ITS2 sequences and corresponding sequences from bovine B. bovis and B. bigemina (GenBank database), trimmed to equivalent aligned lengths of approximately 877 bp. The taxa included whitetailed deer parasites (this study – H8 clones 2, 6, 10 and 14; NR6 clones 3, 4 and 5) and bovine B. bovis Merida clones 3, 4, 8, 10 and 11 (this study); bovine B. bovis (EF458279–82); bovine B. bigemina (EF458245, EF458260–64, EF458267); and Babesia odocoilei, EAY339754.

P.J. Holman et al. / Veterinary Parasitology 177 (2011) 298–304

301

Table 3 White-tailed deer (WTD) and bovine hemoparasite 18S rRNA gene and ITS1-5.8S rRNA gene-ITS2 cloned sequences, size, sequence identity, and inclusion in phylogenetic tree. Host

Clone

Primers

Size (bp)

BLAST highest identity,GenBank Accession Number

Phylogenetic tree

WTD WTD WTD WTD WTD WTD WTD WTD WTD WTD Bovine Bovine Bovine Bovine Bovine WTD WTD WTD WTD WTD WTD WTD

H8 clone 11 NR6 clones 3,4,6,9 NR8 clones 3, 6 NR6 clone 4T H8 clone 2 H8 clones 6,10 H8 clone 14 NR6 clone 3 NR6 clone 4I NR6 clone 5 BboUSDA clones 4, 6 BboMer clone 8 BboMer clones 10, 11 BboMer clone 3 BboMer clone 4 H7 clones 2, 9 H7 clones 6–9 H8 clones 2,3 H8 clone 6 H10 clone 1 H10 clone 2 H10 clone 3

Bbov700F & BN Bbov750F & 1400R Bbov700F & BN Bbov700F & BN Bsp1600F & LSURN Bsp1600F & LSURN Bbov1600F & LSURN 528EXTF & BbovLSUR 528EXTF & BbovLSUR 528EXTF & BbovLSUR AN & BN 528EXTF & BbovLSUR 528EXTF & BbovLSUR Bsp1200F & BbovLSURN Bsp1200F & BbovLSURN Bbi200F & BN Bbi200F & 1400R BN & BNb BN & BNb Bbi200F & 1400R Bbi200F & Bbi1400R Bbi200F & Bbi1400R

1030 675 1030 1042 692 692 692 1764–71 1764–71 1764–71 1587–88 1771 1779 1043 1044 1467 1212 1671 1289 1246 1219 1217

99% Babesia bovis 18S rDNA, L19077 99% B. bovis 18S rDNA, L19077 99% B. bovis18S rDNA, L19077 95% Theileria ovis18S rDNA, L19077 97% B. bovis rRNA ITS, EF458300 99% B. bovis rRNA ITS, EF458301 97% B. bovis rRNA ITS, EF458301 92% B. bovis rRNA ITS, EF458301 96% B. bovis rRNA ITS, EF458301 94% B. bovis rRNA ITS, EF458301 99% B. bovis18S rDNA, L19078 93%a B. bovis rRNA ITS EF458301 93%a B. bovis rRNA ITS, EF458298 96%a B. bovis rRNA ITS, EF458276 93%a B. bovis rRNA ITS, EF458276 99% Babesia bigemina 18S rDNA, AY603402 99% B bigemina 18S rDNA, EF458195 98% Theileria cervi 18S rDNA, AY735114 98% T. cervi 18S rDNA, AY735126 93% Theileria sp., AY735137 94% Babesia sp RD63, AF411338 95% Babesia sp Madang, DQ155071

Fig. 1 No Fig. 1 No Fig. 2 Fig. 2 Fig. 2 Fig. 2 Fig. 2 Fig. 2 Fig. 1 Fig. 2 Fig. 2 Fig. 2 Fig. 2 Fig. 1 No No No No No No

a b

BLAST search of the ITS1-5.8S gene-ITS2 rDNA region only. Primer set used was Bbi200F & BN, but BN primed on both strands.

Phylogenetic trees were generated from the two alignments using the neighbor-joining algorithm in PAUP* version 4.0b10 (Swofford, 2002). Molecular distances were estimated by the Kimura two-parameter model (Kimura, 1980) and the robustness of the branches was determined by 1000 bootstrap replications. The sequences obtained in this study were assigned Genbank Accession Numbers HQ264105–HQ264136. 3. Results No Babesia piroplasms definitively identifiable by piriforms in joined pairs were observed by microscopic examination (1000× under oil immersion) of the Giemsastained blood films. Theileria piroplasms were detected in 19 of the 25 samples (Table 1) as rings, and piriform and oval forms less than 2 ␮m in length (data not shown). Three deer blood samples (H8, NR6 and NR8) from two ranches produced amplicons in B. bovis PCR (Table 1). Three deer blood samples (H7, H8, and H10) from one ranch yielded amplicons in B. bigemina PCR (Table 1). As shown in Table 3, both B. bovis nested primer sets, Bbov700F/BN and Bbov750F/Bbov1400R, resulted in products with high identity to bovine B. bovis 18S rDNA from the three deer samples. One Theileria species clone was identified among the cloned sequences from the NR6 Bbov700F/BN product (Table 3). Although three animal blood samples tested positive in the B. bigemina PCR, only the H7 product produced cloned sequences with high sequence identity to B. bigemina (six clones sequenced; Table 3). The H8 product resulted from BN priming both strands (Bbi200F/BN PCR) with Theileria spp. 18S rDNA identified in three clones (Table 3). The primer set Bbi200F/Bbi1400R also amplified Theileria 18S rDNA and non-target Babesia spp., as evidenced by the three

clones sequenced from H10. In this case, no mis-priming occurred. The two H10 Babesia sp. clones (clones 2 and 3) shared 96.6% identity, with clone 2 being most similar to a reindeer Babesia sp. isolate, RD63, and clone 3 most similar to a sheep isolate (Table 3). The ITS1-5.8S rRNA gene-ITS2 region was amplified from white-tailed deer B. bovis-PCR positive DNA samples to further investigate the identity of the deer parasites. Primary ITS PCR successfully amplified this genomic region from sample NR6 and the resulting clones showed identity ranging from 92–96% to corresponding B. bovis sequences in the GenBank database (Table 3). Nested ITS PCR produced an amplicon from H8, and the cloned sequences showed high identity (97–99%) to corresponding B. bovis sequences in the GenBank database (Table 3). The neighbor-joining phylogenetic tree generated from 18S rDNA sequences approximately 930 base pairs long separated the B. bovis and B. bigemina into two well-supported respective clades (Fig. 1). Within the B. bovis clade, the previously reported white-tailed deer B. bovis-like sequences from South Texas (LaSalle and Webb counties) clustered separately from the bovine B. bovis sequences and the central Texas (Tom Green County) white-tailed deer B. bovis sequences. The latter formed a separate cluster along with two bovine B. bovis sequences, T2BoChr3 from the B. bovis genome sequencing project (http://www.vetmed.wsu.edu/researchvmp/program-ingenomics) and bovine B. bovis USDA clone 6 produced in this study. The white-tailed deer H7 B. bigemina sequences obtained in this study clustered with corresponding bovine B. bigemina sequences from the GenBank database. The neighbor-joining phylogenetic tree derived from the rRNA ITS1-5.8S gene-ITS2 genomic region clearly shows no distinction between bovine and cervine B. bovis isolates (Fig. 2).

302

P.J. Holman et al. / Veterinary Parasitology 177 (2011) 298–304

Fig. 1. Neighbor-joining phylogenetic tree of relationships among 18S ribosomal DNA cloned sequences from bovine and cervine Babesia spp. isolates. The clusters containing Babesia cf. bovis 18S rDNA sequences from white-tailed deer in central Texas (Tom Green County) and consensus cervine I and consensus cervine II previously reported from white-tailed deer Babesia isolates from Webb and LaSalle Counties in south Texas (Ramos et al., 2010) are designated. Sequences obtained in this study from infected deer in Tom Green County (central Texas) are in bold type.

4. Discussion The role of white-tailed deer and other ungulates in the epidemiology of bovine babesiosis is a critical consideration as the U.S. deals with the increased incidence of vector tick outbreaks in south Texas, especially in areas outside of the permanent Fever Tick quarantine buffer zone (Hillman, 2008; Perez de Leon et al., 2010). Outbreaks of babesiosis have not been associated with recent Fever Tick (Rhipicephalus Boophilus spp.) outbreaks in Texas although the possible re-emergence of bovine babesiosis in the southern U.S. is a real threat as vector tick control measures fail. Molecular and serologic evidence suggest that whitetailed deer in north Mexico and south Texas may harbor bovine Babesia spp. (Cantu et al., 2007, 2009; Ramos et al., 2010). However, in the absence of knowledge of the full scope of Babesia spp. that may infect white-tailed deer, possible serologic cross-reactivity or amplification of closely

related Babesia spp. cannot be ruled out as a source of false positive reactions. In fact, in this study, a genotypically unique Babesia sp. was amplified using a pair of primers designed to be specific for B. bigemina based on available sequences in the GenBank database. A recent detailed analysis showed single nucleotide polymorphisms in the 18S rRNA gene of Babesia cf. bovis isolates from white-tailed deer in south Texas distinguishing them from cattle isolates (Ramos et al., 2010), and from the Tom Green County white-tailed deer isolates (Fig. 1). Mis-priming during PCR resulted in the production of Theileria species amplicons in this study that were similar in size to the expected B. bigemina amplicons (Table 3). This current study was undertaken to determine if bovine Babesia spp.-like organisms were carried by whitetailed deer remote from the tick quarantine region. In this study, as in the previous study in South Texas (Ramos et al., 2010), both B. bovis- and B. bigemina-specific PCR identified

P.J. Holman et al. / Veterinary Parasitology 177 (2011) 298–304

303

Fig. 2. Neighbor-joining phylogenetic tree of relationships among cloned ribosomal RNA intervening transcribed spacer 1–5.8S rRNA gene-transcribed spacer 2 regions from bovine and cervine Babesia bovis isolates and bovine Babesia bigemina. Sequences obtained in this study from infected deer in Tom Green County (central Texas) are in bold type. Boostrap support (1000 repetitions) is shown.

infected deer in Tom Green County, located in central Texas. Several different primer sets were employed to confirm the amplification of these two Babesia species in this study. Interestingly, the SNPs previously reported in the South Texas white-tailed deer B. bovis-like 18S rRNA genes were not found in the Tom Green County isolates and, in fact, the Tom Green isolates clustered separately from the south Texas isolates in the phylogenetic tree (Fig. 1). Moreover, phylogenetic analysis based on the 18S rRNA gene placed both B. bovis and B. bigemina isolates from white-tailed deer within the clades holding cattle isolates (Fig. 1). To further clarify the identity of the putative B. bovis isolates from Tom Green County, the sequence spanning the ITS1, 5.8S rRNA gene, and ITS2 region was analysed. Because the ITS regions are not under the structural constraints imposed on the ribosomal genes, these regions may provide finer distinction among closely related species (Collins and Allsopp, 1999). In fact, again phylogenetic analysis showed no separation of the deer or cattle B. bovis isolates (Fig. 2). Despite these compelling molecular data supporting conspecificity of the B. bovis and B. bigemina parasites found in white-tailed deer and cattle, questions remain. How these Babesia species, which as blood parasites would have been naturally transmitted by Cattle Fever Ticks or artificially transmitted by mechanical means, infected deer in central Texas is a major quandary. The background of the

animals in this study is not known, thus possible translocation from South Texas to central Texas cannot be ruled out. At this time, the only documented occurrence of the vector tick is in South Texas, at least 150 miles distance from Tom Green County. Transmission by tick bite in Tom Green County is unlikely because this area has been considered fever tick-free since the Cattle Fever Tick Eradication Program was declared a success in 1942. Moreover, predictive analysis shows that suitable habitat for the vector ticks ˜ and Venzal, does not extend into this area (Estrada-Pena 2006). Further study is needed to resolve the questions surrounding these parasites in white-tailed deer. The B. bovis and B. bigemina documented in deer to date are based on serologic or molecular detection, and no definitive forms of these parasites have yet been visualized, leaving the morphology unknown. In vitro cultures of these parasites might resolve this since Babesia spp. can be cultured from carrier animals with parasitemias too low to detect microscopically (Holman et al., 2005; Malandrin et al., 2004). It is unknown whether the deer parasites are in fact infectious to cattle, which could be addressed by experimental subinoculation of infected deer blood into splenectomized and spleen-intact cattle. It is unknown whether deer are dead-end or competent hosts in the life cycle of the agents of bovine babesiosis. Early reports are contradictory and were conducted without the benefit of modern molecu-

304

P.J. Holman et al. / Veterinary Parasitology 177 (2011) 298–304

lar techniques (Spindler et al., 1958; Callow, 1965; Kuttler et al., 1972). It is also unknown whether another vector tick might be involved in the transmission of these parasites found in white-tailed deer. Tick transmission studies could be used to study both of these issues. The first could be tested by experiments to complete the life cycle of B. bovis and B. bigemina on white-tailed deer using fever ticks. Ideally, tick transmission studies using ticks associated with infected herds could be conducted to identify or rule out other tick vectors. Clarification of the possible role of white-tailed deer as reservoir hosts in maintaining these important pathogens of cattle is critical to understanding whether or not deer contribute to the epidemiology of bovine babesiosis. Acknowledgements The authors thank the ranchers who generously made the sample collections possible. Funding for this study was provided by Texas A&M AgriLife Research Project 8987. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Bram, R.A., George, J.E., Reichard, R.E., Tabachnick, W.J., 2002. Threat of foreign arthropod-borne pathogens to livestock in the United States. J. Med. Entomol. 39, 405–416. Callow, L.L., 1965. Babesia bigemina in ticks grown on non-bovine hosts and its transmission to these hosts. Parasitology 55, 375–381. Cantu, A.C., Ortega, A.S., Garcia-Vazquez, Z., Mosqueda, J., Henke, S.E., George, J.E., 2009. Epizootiology of Babesia bovis and Babesia bigemina in free-ranging white-tailed deer in northeastern Mexico. J. Parasitol. 95, 536–542. Cantu, A., Ortega, -S., Mosqueda, J.A., Garcia-Vazquez, Z., Henke, S.E., George, J.E., 2007. Immunologic and molecular identification of Babesia bovis and Babesia bigemina in free-ranging white-tailed deer in Northern Mexico. J. Wildl. Dis. 43 (3), 504–507. Collins, N.E., Allsopp, B.A., 1999. Theileria parva ribosomal internal transcribed spacer sequences exhibit extensive polymorphism and mosaic evolution: application to the characterization of parasites from cattle and buffalo. Parasitology 118, 541–551. ˜ A., Venzal, J.M., 2006. High-resolution predictive mapping Estrada-Pena, for Boophilus annulatus and B. microplus (Acari: Ixodidae) in Mexico and Southern Texas. Vet. Parasitol. 142 (3/4), 350–358.

Graham, O.H., Hourrigan, J.L., 1977. Eradication programs for the arthropod parasites of livestock. J. Med. Entomol. 13, 629–658. Hillman, B.D., 2008. Stakes High in Fight Against the Cattle Fever Tick; Pest Could Spread Coast-to-Coast, Texas Animal Health Commission. TAHC News Press Release, April. Holman, P.J., Spencer, A.M., Droleskey, R.E., Goethert, H.K., Telford III, S.R., 2005. In vitro cultivation of a zoonotic Babesia sp. isolated from eastern cottontail rabbits (Sylvilagus floridanus) on Nantucket Island, Massachusetts. J. Clin. Microbiol. 43, 3995–4001. Huang, X., Miller, M., 1991. A time-efficient, linear-space local similarity algorithm. Adv. Appl. Math. 12, 337–357. Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Kuttler, K.L., Graham, 0.H., Johnson, S.R., Trevino, J.L., 1972. Unsuccessful attempts to establish cattle Babesia infections in white-tailed deer. J. Wildl. Dis. 8, 63–64. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. ClustalW and ClustalX version 2. Bioinformatics 23, 2947–2948. Malandrin, L., L’Hostis, M., Chauvin, A., 2004. Isolation of Babesia divergens from carrier cattle blood using in vitro culture. Vet. Res. 35, 131–139. Pound, J.M., George, J.E., Kammlah, D.M., Lohmeyer, K.H., Davey, R.B., 2010. Evidence for role of white-tailed deer (Artiodactyla: Cervidae) in epizootiology of cattle ticks and southern cattle ticks (Acari: Ixodidae) in reinfestations along the Texas/Mexico border in South Texas: a review and update. J. Econ. Entomol. 103 (2), 211–218. Perez de Leon, A.A., Strickman, D.A., Knowles, D.P., Fish, D., Thacker, E., de la Fuente, J., Krause, P.J., Wikel, S.K., Miller, R.S., Wagner, G.G., Almazan, C., Hillman, R., Messenger, M.T., Ugstad, P.O., Duhaime, R.A., Teel, P.D., Ortega-Santos, A., Hewitt, D.G., Bowers, E.J., Bent, S.J., Cochran, M.H., McElwain, T.F., Scoles, G.A., Suarez, C.E., Davey, R., Howell Freeman, J.M., Lohmeyer, K., Li, A.Y., Guerrero, F.D., Kammlah, D.M., Phillips, P., Pound, J.M., 2010. One health approach to identify research needs in bovine and human babesioses: workshop report. Parasite Vector 3, 36–63. Ramos, C.M., Cooper, S.M., Holman, P.J., 2010. Molecular and serologic evidence for Babesia bovis-like parasites in white-tailed deer (Odocoileus virginianus) in south Texas. Vet. Parasitol. 172, 214–220. Schoelkopf, L., Hutchinson, C.E., Bendele, K.G., Goff, W.L., Willette, M., Rasmussen, J.M., Holman, P.J., 2005. New ruminant hosts and wider geographic range identified for Babesia odocoilei (Emerson and Wright 1970). J. Wildl. Dis. 41 (4), 683–690. Sogin, M.L., 1990. Amplification of ribosomal RNA genes for molecular evolution studies. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.H. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, pp. 307–314. Spindler, L.A., Allen, R.W., Diamond, L.S., Lotze, J.C., 1958. Babesia in a white-tailed deer. J. Protozool. 5, 8. Swofford, D.L., 2002. PAUP. Phylogenetic Analysis Using Parsimony (and Other Methods), 4th ed. Sinauer Associates, Sunderland, MA.