Molecular identification of vector-borne organisms in Ehrlichia seropositive Nicaraguan horses and first report of Rickettsia felis infection in the horse

Acta Tropica 200 (2019) 105170

Contents lists available at ScienceDirect

Acta Tropica journal homepage: www.elsevier.com/locate/actatropica

Molecular identification of vector-borne organisms in Ehrlichia seropositive Nicaraguan horses and first report of Rickettsia felis infection in the horse

T

⁎

Jeffrey D. Tyrrella, Barbara A. Qurolloa, , Susan J. Tornquistb, Kathryn G. Schlaichb, Jennifer Kelseyb, Ramaswamy Chandrashekarc, Edward B. Breitschwerdta a

Vector Borne Disease Diagnostic Laboratory, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA College of Veterinary Medicine, Oregon State University, Corvallis, OR, USA c IDEXX Laboratories, Inc., Westbrook, ME, USA b

A R T I C LE I N FO

A B S T R A C T

Keywords: Tick-borne disease Equine rickettsiosis Piroplasmosis Babesia caballi Theileria equi Ehrlichia species H7

Certain vector-borne organisms serve as etiological agents of equine disease. After previously identifying a new Ehrlichia species in horses from Mérida, we aimed to determine the infection frequency and screen for a wide range of vector-borne organisms from 93 tick-exposed, Ehrlichia seropositive horses in this region. PCR assays were performed to identify infection by organisms within the following genera: Anaplasma, Babesia, Bartonella, Ehrlichia, Leishmania, Mycoplasma, Neorickettsia, Rickettsia and Theileria. Overall, 90/93 horses (96.8%) were infected with one or more vector-borne organisms. Ninety (96.8%) horses were infected with Theileria equi and 21 (26.8%) with Babesia caballi. Nine (9.7%) horses were infected with the novel Ehrlichia species previously designated H7, reported in horses from Nicaragua and Brazil. Two horses (2.2%) were infected with Rickettsia felis. Anaplasma, Bartonella, Leishmania, Mycoplasma, or Neorickettsia species DNA was not amplified from any horse. Ticks collected from horses infected with vector-borne organisms were identified as Amblyomma cajennense sensu lato and Dermacentor nitens. Horses in Mérida are infected by a range of vector-borne organisms, including B. caballi, T. equi, Ehrlichia species H7, and R. felis. To the authors’ knowledge, this constitutes the first report of molecular detection of R. felis in horses.

1. Introduction Vector-borne diseases (VBDs) affect the health and welfare of horses worldwide. VBDs known to affect horses include: anaplasmosis (Anaplasma phagocytophilum) found worldwide but less commonly in South and Central America (Dzięgiel et al., 2013; Salvagni et al., 2010); piroplasmosis (Babesia caballi/Theileria equi), found worldwide (Onmaz et al., 2012); and Potomac Horse Fever (Neorickettsia risticii) in the United States (Pusterla and Madigan, 2007). Additional vectorborne organisms (VBOs) that have been detected in horses include: Bartonella spp. in the United States (Jones et al., 2008; Cherry et al., 2012) and Italy (Magni et al., 2017), Ehrlichia sp. H7 in Nicaragua (O'Nion et al., 2015) and Brazil (Vieira et al., 2018), Leishmania in endemic regions, worldwide (Aguilar et al., 1984; Rolão et al., 2005; Soares et al., 2013), and hemotropic Mycoplasma spp. in Germany

(Dieckmann et al., 2010, 2012). Rickettsia species seroreactivity has also been reported in horses from Buthan (Tshokey et al., 2018) and Brazil (Souza et al., 2016). Mérida is a rural community located on the island of Ometepe in Lake Nicaragua, adjacent to the western coast of Nicaragua. Horses on the island are an important mode of transport, a source of labor, and also used to entertain tourists. Horses in Mérida are exposed to ticks and may be exposed to other vector arthropod species such as fleas and sandflies. Domestic animals residing on Ometepe, including horses, could serve as reservoirs for VBOs and sentinels for potential zoonotic VBDs. The North Carolina State University – Vector-borne Disease Diagnostic Laboratory (VBDDL) identified a novel species of Ehrlichia in horses from this region, previously designated Ehrlichia sp. H7 (O'Nion et al., 2015). Ehrlichia sp. H7 was subsequently identified in horses in Brazil (Vieira et al., 2018). Using genus- and species-specific

Abbreviations: EDTA, ethylenediaminetetraacetic acid; NCBI, National Center for Biotechnology Information; OSU-CVM, Oregon State University—College of Veterinary Medicine; Tm, melting temperature; VBD, vector-borne disease; VBDDL, North Carolina State University-Vector-borne Disease Diagnostic Laboratory; VBO, vector-borne organism ⁎ Corresponding author. Department of Clinical Sciences College of Veterinary Medicine, North Carolina State University, Research building, office 464, 1060 William Moore Drive, Raleigh, NC 27606, USA. E-mail address: [email protected] (B.A. Qurollo). https://doi.org/10.1016/j.actatropica.2019.105170 Received 17 June 2019; Received in revised form 9 September 2019; Accepted 9 September 2019 Available online 10 September 2019 0001-706X/ © 2019 Elsevier B.V. All rights reserved.

Acta Tropica 200 (2019) 105170

J.D. Tyrrell, et al.

cycles of (i) 98 °C for 15 s, (ii) annealing temperature based on primers (Table 1) for 15 s, and (iii) 72 °C for 15 s. Melting temperature (Tm) measurements were made between 65 and 95 °C at 0.5 s intervals for qPCRs. Hemotropic Mycoplasma cPCR was performed according to a referenced protocol (Maggi et al., 2013).

molecular tests, we aimed to determine the infection frequency of Ehrlichia sp. H7 and identify additional, coinfecting VBOs in a group of tick-exposed horses in Mérida. In particular, we hypothesized that Ehrlichia seropositive horses would have a high frequency of equine Ehrlichia infection relative to a large molecular survey of horses in Brazil (Vieira et al., 2016), establishing Ehrlichia sp. H7 as an important equine VBO in Central and South America.

2.3. Amplicon sequencing and analysis 2. Materials and methods Sequencing was performed on randomly selected PCR amplicons to confirm qPCR results as a quality control measure. Sequencing was performed by GENEWIZ, Inc. (Raleigh, NC), and AlignX software (Vector NTI Suite 6.0, InforMax, Inc., Bethesda, MD, USA) was used to align amplicon DNA sequences with reference sequences from GenBank.

2.1. Equine and tick samples In August of 2013 and 2014, ethylenediaminetetraacetic acid (EDTA)-anti-coagulated whole blood (∼ 6 mL) was collected by jugular venipuncture from horses that were examined for medical conditions (e.g. anorexia, weight loss, lameness, administration of parasiticides) or prior to elective surgery (e.g. castration, wound repair) at a temporary clinic in Mérida. The clinic was operated by the Oregon State University-College of Veterinary Medicine (OSU-CVM) with permission from local authorities and residents, and sample collection was performed in accordance with the OSU Animal Care and Use Committee (Animal Care and Use Proposal no. 4329). The SNAPⓇ4DxⓇPlus Test (IDEXX, Inc), a point-of-care enzyme-linked immunosorbent assay licensed for use in dogs, was used to screen horses at the time of examination in Mérida for seroreactivity to Anaplasma spp., Ehrlichia spp., and Borrelia burgdorferi as previously described (Metcalf et al., 2008; Vieira et al., 2013; Tsachev et al., 2018). Samples seroreactive to Ehrlichia spp. were sent to the VBDDL for Ehrlichia sp. molecular diagnostic testing. Sample collection and submission occurred in August of 2013 (n = 50), in connection with a prior study (O'Nion et al., 2015), and August of 2014 (n = 43). To expand upon the initial Ehrlichia sp. testing, a more comprehensive VBO molecular diagnostic panel was performed on both sets of convenience samples. During the August of 2014 trip, ticks attached to horses were removed and stored in 95% ethanol for identification using illustrated keys (Guzmán-Cornejo et al., 2016; Nava et al., 2014).

2.4. Statistical analysis Statistical analysis was performed with GraphPad Software (La Jolla, CA, USA). Frequency of infection refers to the total number of positive horses divided by the total number of horses tested. Proportions are reported with their 95% confidence intervals (95% CI), calculated by the modified Wald method (Agresti and Coull, 1998).

3. Results Ninety-three equine whole blood samples, all seropositive only to Ehrlichia spp. antibodies by the SNAPⓇ4DxⓇPlus Test, were tested by qPCR and cPCR in the VBDDL (see Table 1). Overall, 90/93 horses (96.8%) were infected with a VBO (Table 2). T. equi was detected in 90/ 93 horses (96.8%) and B. caballi detected in 21/93 (22.6%) horses (Table 2). In 65 horses, T. equi was the sole VBO identified, while 25 were coinfected with one or more other VBOs. Ehrlichia sp. H7 was identified in 9/93 (9.7%) horses. An E. canis-specific qPCR assay was negative in horses infected with Ehrlichia sp H7. Two of 93 (2.2%) horses were PCR positive for Rickettsia felis. Anaplasma, Bartonella, Leishmania, hemotropic Mycoplasma, and Neorickettsia species DNA were not amplified from any of the horses in our study. The Apicomplexa-specific (18 s rRNA gene target) and T. equi species-specific (cox1 gene target) qPCR assays used in this study did not consistently amplify T. equi. Of the 93 samples tested in both qPCRs, 84 (90.3%) were positive in the Apicomplexa 18S rRNA gene assay, 80 (86%) were positive in the T. equi cox1 assay, and 77 (82.8%) were positive in both assays. Amplicon sequencing confirmed T. equi infection in all instances of discordant results among the two PCR assays, resulting in a frequency of infection for T. equi of 90/93 (96.8%). Amplicons from each qPCR assay were randomly selected for sequencing and alignment using National Center for Biotechnology Information (NCBI) Basic Local Alignment Tool nucleotide (BLASTn) (Table 3). Sequencing and alignment performed on samples positive by the Apicomplexa 18S rRNA gene qPCR resulted in three different T. equi sequence groups, outlined in Table 3. Coinfections of one or more VBOs were identified in 25/93 (26.9%) horses. All coinfected horses were PCR positive for B. caballi and T. equi. Fourteen horses (15%) were coinfected with B. caballi and T. equi only. Additional coinfections included (i) five horses (5.4%) with B. caballi, T. equi, and Ehrlichia sp. H7, and (ii) two horses (2.2%) with B. caballi, T. equi, and R. felis. Forty-five ticks were removed for identification on horses examined in August 2014. Twenty ticks distributed across six horses were identified as Amblyomma spp., part of the Amblyomma cajennense complex (A. cajennense sensu lato). Fifteen ticks distributed across four horses were identified as Dermacentor nitens. Ten ticks across five horses were unidentifiable due to structural damage or engorgement.

2.2. Equine sample molecular testing DNA was extracted from 200 µL aliquots of equine EDTA-anti-coagulated whole blood using a QIAsymphonyⓇ SP robot (QIAGEN, Valencia, CA, USA) and QIAsymphonyⓇ DNA Mini Kit (QIAGEN, Valencia, CA, USA; catalog no. 931236). All sets of extractions included negative extraction controls of molecular-grade water. DNA was stored at −20 °C prior to PCR testing. The absence (in negative extraction controls) or presence (in equine samples) of equine genomic DNA, and the absence of PCR inhibitors was demonstrated by an internal control quantitative PCR (qPCR) designed to amplify the host GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene (Birkenheuer et al., 2003). Equine DNA samples were tested for presence of VBO-DNA using genus-specific PCR assays (Table 1), and positive samples were further tested by species-specific qPCR assays (Table 1). Theileria equi speciesspecific qPCR assays were performed for all samples, due to certain instances of discordance between genus- and species-specific assay results, as discussed below. All PCR assays included the following controls: (a) molecular-grade water, (b) a known-negative horse DNA sample, and (c) either a DNA plasmid or a known-positive DNA sample. Amplification was performed in CFX96™ Real-Time Detection System combined with C1000™ Thermal Cycler (Bio-Rad, USA) for qPCR and an Eppendorf Mastercycler EPgradientⓇ with aluminum block for cPCR. Reactions contained 12.5 µL SYBRⓇGreen Supermix (Bio-Rad, Hercules, CA, USA) for qPCRs or MyTaq HS Mix (2X) (Bioline, London, U.K. cat: BIO-25,046) for cPCRs, 5 µL or 10 µL DNA template, primers at final concentration ranging from 0.1 µM to 0.6 µM (Table 1) and moleculargrade water to a final volume of 25 µL. Thermocycler conditions consisted of an initial denaturation step at 98 °C for 3 min, followed by 40 2

Acta Tropica 200 (2019) 105170

J.D. Tyrrell, et al.

Table 1 Vector-borne organism PCR targets, primers, assay conditions, expected amplicon size, expected melting temperature, and reference publication. Gene target

Primers (5′ – 3′)

Primer conc. (µM)

Anneal temp. (°C)

Expected amplicon size (bp)

Expected Tm (°C)

Primer reference

qPCR assays: Anaplasma genus

tr1

0.4

57

∼200

80

Hegarty et al., 2015

Babesia genus

LSU4

0.6

60

∼200

76–77.5

Qurollo et al., 2017

Bartonella genus

ssrA

0.4

62

∼210

82–83.5

this study

Ehrlichia genus

sodB

0.5

57

∼300

78–79

Qurollo et al., 2014

Leishmania genus

kDNA

0.3

67

∼130bp

83.5–84.5

this study

Neorickettsia genus Theileria genus

sodB

F: GAAGCAGCGBATCATGAAGG R: CCCTTTTCGTATTTTTGTAC F: ACCTGTCAARTTCCTTCACTAAMTT R: TCTTAACCCAACTCACGTACCA F: GCTATGGTAATAAATGGACAATGAAATAA R: GACGTGCTTCCGCATAGTTGTC F: TTTAATAATGCTGGTCAAGTATGGAATCAT R: AAGCGTGTTCCCATACATCCATAG F: CCTCCGGGTAGGGGCGTTC R: CCT ATT TTA CAC CAA CCC CCA G F: CTCATTTAGCTTATTCACATAACC R: CTACCTTATCACAAAGATGCCC F: GCAGTTAAAAAGCTCGTAGTTGAATT R: GTTAAATACGAATGCCCCCAA F: AGCTCGATTGATTTACTTTGCTG R: CCACCAAGCTAGCAATACAAA F: ATGTTGTTTTTCCAAGGGCAAAC R: CCATCTCCAAATAAACACAAGCT F: TTTAATAATGCTGGTCAAGTATGGAATCAT R: AAGCGTGTTCCCATACATCCATAG F: GAATCATGGACTGGTGGTATCATCCTT R: GCCAATTACCCCTGCAAATCCTAAA F: GCAGTTAAAAAGCTCGTAGTTGAATT R: GTTAAATACGAATGCCCCCAA F: TAATTTTAACGGAACAGACGG T R: GCCTAAACTTCCTGTAACATTAAAG

0.2

60

∼100

79

this study

0.1

60

∼250

81–83

this study

0.4

62

∼300

78

this study

0.4

60

∼90

77–78

this study

0.3

63

∼225

80–80.5

this study

0.3

67

∼112

78

Kidd et al., 2017

0.2

60

∼105

75.5–77

this study

0.6

57

∼100

78.5

Luce-Fedrow et al., 2015

0.2

68

∼700

NA

Maggi et al., 2013

Organism

Rickettsia genus Babesia caballi Ehrlichia sp. H7

18S rRNA 23S-5S ITS cox1

Ehrlichia canis

16S rRNA p30

Theileria equi

cox1

Rickettsia felis

ompB

cPCR assay: Mycoplasma genus

16S rRNA

F: GCCCATATTCCTACGGGAAGCAGCAGT R: CTCCACCACTTGTTCAGGTCCCCGTC

Abbreviations: conc, concentration; cox1, cytochrome c oxidase subunit 1; cPCR, conventional polymerase chain reaction; F, forward; ITS, intergenic transcribed spacer; kDNA, kinetoplast DNA conserved region of minicircle; LSU4, large subunit rRNA gene fragment 4; ompB, outer membrane protein B; qPCR, quantitative polymerase chain reaction; R, reverse; rRNA, ribosomal RNA; sodB, superoxide dismutase B; ssrA, transfer-mRNA; Tm, melting temperature; temp, temperature; tr1, transcriptional regulator 1.

(Vieira et al., 2016), the infection frequency of horses in Mérida, Nicaragua was considerably higher, supporting our hypothesis. In fact, the Ehrlichia agent described in the above-mentioned Brazilian study was subsequently identified as Ehrlichia sp. H7 (Vieira et al., 2018). Based on these combined studies, Ehrlichia sp. H7 should be considered an important equine VBO, warranting additional investigations to determine whether and to what extent it causes clinical illness in horses, and whether it can infect and cause clinical illness in other host species, including humans. A recent report documented 0.9% seroreactivity to E. chaffeenesis-specific peptides or serocross-reactivity to a similar pathogen, in a group of people with acute febrile illness residing in León, Nicaragua (Chikeka et al., 2016). Furthermore, reports document persistent human infection with E. chaffeensis and E. canis in Central and South America (Perez et al., 2006; Rojas et al., 2015). Combined, these studies underscore the epidemiological importance of investigating agents causing ehrlichiosis in Central and South America. To the authors’ knowledge, this is the first report of molecular detection of R. felis in horses. While equine seroreactivity to R. felis has been previously reported (Bermúdez et al., 2011), the possibility of cross-reactivity with other rickettsial organisms has precluded certainty that horses could be infected with R. felis. Cross-reactivity occurs in humans between R. felis antigen and spotted fever group and R. typhi antigens by indirect fluorescent antibody assays (Pérez-Arellano et al., 2005). As an emerging rickettsial pathogen with global distribution, R. felis affects a wide range of mammals and humans (Angelakis et al., 2016). R. felis DNA was amplified from two apparently healthy dogs in Rivas, Nicaragua, located on the mainland approximately 45 km west of Mérida, Nicaragua (Wei et al., 2014). Evidence of R. felis infection has been documented throughout Central America. Horses and dogs in Panama were identified as seroreactive to R. felis antigen (Bermúdez et al., 2011), and R. felis DNA was

Table 2 Frequency of infection of vector-borne organisms detected by PCR in horses (n = 93) from Mérida, Nicaragua. Vector-borne organism

PCR+ (%)

95% CI

All B. caballi Ehrlichia sp. H7 T. equi R. felis

90 (96.8) 21 (22.6) 9 (9.7) 90 (96.8) 2 (2.2)

0.9054 – 0.9929 0.152 – 0.3213 0.498 – 0.1758 0.9054 – 0.9929 0.0012 – 0.0797

4. Discussion Using PCR amplification, we detected, B. caballi, Ehrlichia sp. H7, R. felis, and T. equi in tick-exposed, Ehrlichia seropositive horses from Mérida, Nicaragua. Our study represents the first reported molecular identification of R. felis in horses and highlights the infection frequency of a novel, potentially zoonotic tick-borne organism, Ehrlichia sp. H7, known to infect horses in Nicaragua and Brazil (O'Nion et al., 2015; Vieira et al., 2018). By combining Ehrlichia PCR results from samples collected in 2013 (6/50; 12%) with PCR results from samples collected in 2014 (3/43; 7%), we calculated an overall infection frequency of 9.7% (9/93) for Ehrlichia sp. H7. The rate of infection was likely influenced by the Ehrlichia seroreactivity of the horses in our study, initially designed to identify Ehrlichia-infected horses. Interestingly, despite the Ehrlichia seroreactivity, a relatively small percentage of horses were PCR positive when compared to Babesia and Theileria. It is possible some horses exposed to Ehrlichia immunologically cleared the infection or pathogen levels were below the limit of PCR detection. Despite this, when compared to the Ehrlichia PCR prevalence (1.9%) reported from another group of SNAPⓇ 4DxⓇ Ehrlichia seropositive horses in Brazil 3

Acta Tropica 200 (2019) 105170

J.D. Tyrrell, et al.

Table 3 Sequencing results on randomly selected amplicons, including number of amplicons sequenced for each qPCR assay, number of bases aligned to reference sequences, percent identity of alignment, vector-borne organism identified and NCBI accession numbers. qPCR Assay

Number amplicons sequenced

Bases aligned (% identity)

Organism

NCBI Accession Number

B. caballi cox1 T. equi cox1 Apicomplexa 18S rRNA

10 11 13

90/90 (100%) 90/90 (100%) 202/202 (100%)

AB499086 AB499091 KX722511e KX722516, KY952232

Apicomplexa 18S rRNA

3

202/202 (100%)

Apicomplexa 18S rRNA

4

202/202 (100%)

Ehrlichia sodB Ehrlichia sp. H7 16S rRNA Rickettsia 23S-5S R. felis ompB

5 5 2 2

250/250 (100%) 174/174 (100%) 250/250 (100%) 96/96 (100%)

B. caballi T. equi T. equi strains (Group 1) Tunisia-genotype C São Luís Island, Brazil-cluster E T. equi strains (Group 2) Brazil-genotype A São Luís Island, Brazil-cluster H T. equi strains (Group 3) Brazil-genotype A São Luís Island, Brazil-cluster H Cuba-genotype A Ehrlichia sp. H7 Ehrlichia sp. H7 R. felis R. felis

KX722520 KY952226 KX722519, KX722521 KY952227e KY952230 KY111761, KY111762 KJ434180 KJ434178 CP000053, KT374200, KJ796446 CP000053, KF056801, JN366420

Abbreviations: cox1, cytochrome c oxidase subunit 1; NCBI, National Center for Biotechnology Information; ompB, outer membrane protein B; qPCR, quantitative polymerase chain reaction.

thus, all were certainly exposed to ticks. Other potential influencing variables include differences in frequency of tick infestation, sample collection month (August), and geographic location. Mérida is located on a volcanic island, Ometepe, in the middle of Lake Nicaragua. Potentially, geographic isolation has influenced the tick ecology and transmission foci of any associated tick-borne pathogens. Investigation and comparison of the prevalence of tick- and other vector-borne organisms in nearby mainland Nicaraguan regions may be valuable to evaluate and quantify this effect. Further molecular analysis of the partial T. equi 18S rRNA amplicons obtained in our study revealed three distinct sequence groups. Heterogeneity in T. equi 18S rRNA gene sequences has been noted worldwide, including Brazil and Cuba, among others (Diáz-Sánchez et al., 2018; Peckle et al., 2018; Schein et al., 2018). Genotypic pathogenicity effects are unknown; however, genotypic differences could affect the sensitivity of molecular diagnostic tools that target the 18S rRNA gene. We did not amplify Anaplasma sp., Bartonella sp., Leishmania, hemotropic Mycoplasma or Neorickettsia sp. DNA from the horses in our study. These results may reflect any of the following: (i) pathogen levels below the limit of detection by our PCR assays; (ii) inability of these pathogens to readily infect horses in this region of Nicaragua or in this particular group of horses; and (iii) the absence of these particular VBOs or competent vectors in the study region. Several of these VBOs have been detected in horses in other areas within Central and South America. Anaplasma phagocytophilum DNA was PCR amplified from horses in Guatemala (Teglas et al., 2005), whereas horses from central West Brazil were shown to be Anaplasma sp. seroreactive (Salvagni et al., 2010). Equine leishmaniasis has been reported in Central and South America, primarily in Brazil (Soares et al., 2013; Aguilar et al., 1984). Neorickettsia risticii (formerly Ehrlichia risticii), the causative agent of Potomac Horse Fever in North American horses, was detected by PCR in horses with endemic diarrheal disease (known locally as “churrido equino”) on the Uruguayan and Brazilian shores of Mérin Lake (Dutra et al., 2001). The authors are not aware of published reports of Bartonella or hemotropic Mycoplasma affecting horses in Central or South America. We documented ticks on 74.4% of the 2014 set of horses screened in our study and identified Amblyomma cajennense sensu lato and Dermacenter nitens from the relatively small number of ticks examined. Ticks were also noted on the horses examined in 2013; however, specific information was not recorded. Prevalent tick species throughout South America include A. cajennense sensu lato (including A. cajennense sensu stricto. A. mixtum, and A. sculptum among others) and D. nitens

amplified from wild opossums and various species of wild rodents in the Yucatan region of Mexico (Panti-May et al., 2015). The presence of R. felis DNA was documented in cat fleas in Costa Rica (Hun et al., 2011) and Panama (Bermúdez et al., 2011). While the cat flea (Ctenocephalides felis) is the only confirmed arthropod vector (Angelakis et al., 2016), R. felis has also been detected by PCR in various arthropods including ticks and mites (Reif and Macaluso, 2009). The Anopheles gambiae mosquito, the primary vector of malarial infection in sub-Saharan Africa, was recently demonstrated by an experimental transmission study as a potential vector for R. felis (Dieme et al., 2015). Human infection by R. felis has been reported across the globe, ranging from no clinical illness to severe disease (Angelakis et al., 2016). Febrile illness, with and without cutaneous manifestation, has been linked to R. felis infection in various locations, while reports of severe disease, including central nervous system involvement, alveolar hemorrhage, and hepatosplenomegaly, have thus far been limited to the Yucatan region of Mexico (Angelakis et al., 2016). Contrary to these reports, reasonable arguments have been published suggesting that R. felis may not be a human pathogen (Labruna and Walker, 2014). In light of the broad distribution and zoonotic potential of R. felis, further investigation is warranted to provide greater understanding of the natural life cycle, as well as potential effects upon the health of various species, including equids. B. caballi and T. equi were the most frequently detected VBOs in this group of tick-exposed, Nicaraguan horses. These protozoal pathogens are the etiological agents of equine piroplasmosis and infect horses and other equid species in most countries around the world (PosadaGuzmán et al., 2015; Wise et al., 2013). Transmission by hard tick vectors leads to a broad spectrum of clinical manifestations ranging from asymptomatic (equids often serve as reservoirs) to chronic nonspecific illness, to acutely fatal in naïve horses (Wise et al., 2013). Previous molecular surveys of horses in Central and South America have reported PCR prevalence values ranging from 0–20% and 16–61.8% for B. caballi and T. equi, respectively. Our study has established endemicity of these pathogens in the Mérida region of Nicaragua and supports previous reports of a high prevalence of equine piroplasmosis throughout Central and South America (Posada-Guzmán et al., 2015; Rosales et al., 2013; Schein et al., 2018; Teglas et al., 2005). The frequencies of T. equi infection and B. caballi/T. equi coinfection are notably higher in our group of tick-exposed, Mérida horses compared to other Central and South American regions. A likely explanation for this difference is the sample selection criteria, in that the horses screened by PCR in our study were all seropositive to Ehrlichia, 4

Acta Tropica 200 (2019) 105170

J.D. Tyrrell, et al.

References

(Despins, 1992; Nava et al., 2014). A recent report identified prevalent tick species attached to horses in the Pacific lowland region of Nicaragua as A. mixtum, D. nitens and Rhipicephalus microplus (Düttmann et al., 2016). A. mixtum can transmit T. equi (Scoles and Ueti, 2013), and D. nitens, also known as the tropical horse tick, transmits B. caballi (Schwint et al., 2008). It is possible that A. cajennense sensu lato and D. nitens also transmitted R. felis and Ehrlichia sp. H7. Amblyomma spp., including A. cajennense and A. sculptum, have been reported to carry various spotted fever Rickettsia spp. (Nava et al., 2014; Bitencourth et al., 2017), and A. americanum transmits Rickettsia spp., E. chaffeensis and E. ewingii (Goddard and Varela-Stokes, 2009). One report documented Rickettsia and Ehrlichia DNA in D. nitens parasitizing domestic animals in eastern Panama (Bermúdez et al., 2009). Limitations to our study include only testing horses exposed to Ehrlichia, thus our infection frequency does not represent the larger group of horses in that region. Although the numbering systems used during sample collection in 2013 and 2014 indicate all samples included in our study were drawn from different horses, we cannot exclude the possibility that one or more horses could have been sampled twice (initially in 2013 and then again in 2014).

Agresti, A., Coull, B.A., 1998. Approximate is better than “exact” for interval estimation of binomial proportions. Am. Stat. 52, 119–126. Aguilar, C.M., Fernandez, E., Fernandez, R.D., Deane, L.M., 1984. Study of an outbreak of cutaneous leishmaniasis in Venezuela: the role of domestic animals. Mem. Inst. Oswaldo Cruz 79, 181–195. Angelakis, E., Mediannikov, O., Parola, P., Raoult, D., 2016. Rickettsia felis: the complex journey of an emergent human pathogen. Trends Parasitol. 32, 554–564. Bermúdez, S.E., Eremeeva, M.E., Karpathy, S.E., Samudio, F., Zambrano, M.L., Zaldivar, Y., et al., 2009. Detection and identification of rickettsial agents in ticks from domestic mammals in eastern Panama. J. Med. Entomol. 46, 856–861. Bermúdez, C.S.E., Zaldívar, A.Y., Spolidorio, M.G., Moraes-Filho, J., Miranda, R.J., Caballero, C.M., et al., 2011. Rickettsial infection in domestic mammals and their ectoparasites in El Valle de Antón, Coclé, Panamá. Vet. Parasitol. 177, 134–138. Birkenheuer, A.J., Levy, M.G., Breitschwerdt, E.B., 2003. Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni (asian genotype) and B. canis DNA in canine blood samples. J. Clin. Microbiol. 41, 4172–4177. Bitencourth, K., Amorim, M., De Oliveira, S.V., Caetano, R.L., Voloch, C.M., Gazêta, G.S., 2017. Amblyomma sculptum: genetic diversity and rickettsias in the Brazilian Cerrado biome. Med. Vet. Entomol. 31, 427–437. Cherry, N.A., Jones, S.L., Maggi, R.G., Davis, J.L., Breitschwerdt, E.B., 2012. Bartonella spp. infection in healthy and sick horses and foals from the southeastern United States. J. Vet. Intern. Med. 26, 1408–1412. Chikeka, I., Matute, A.J., Dumler, J.S., Woods, C.W., Mayorga, O., Reller, M.E., 2016. Use of peptide-based enzyme-linked immunosorbent assay followed by immunofluorescence assay to document Ehrlichia chaffeensis as a cause of febrile illness in Nicaragua. J. Clin. Microbiol. 54, 1581–1585. Despins, J.L., 1992. Effects of temperature and humidity on ovipositional biology and egg development of the tropical horse tick, Dermacentor (Anocentor) nitens. J. Med. Entomol. 29, 332–337. Diáz-Sánchez, A.A., Pires, M.S., Estrada, C.Y., Cañizares, E.V., Domínguez, S.L.D.C., Cabezas-Cruz, A., 2018. First molecular evidence of Babesia caballi and Theileria equi infections in horses in Cuba. Parasitol. Res. 117, 3109–3118. Dieckmann, S.M., Hoelzle, K., Dieckmann, M.P., Straube, I., Hofmann-Lehmann, R., Hoelzle, L.E., 2012. Occurrence of hemotropic mycoplasmas in horses with correlation to hematological findings. Vet. Microbiol. 160, 43–52. Dieckmann, S.M., Winkler, M., Groebel, K., Dieckmann, M.P., Hofmann-Lehmann, R., Hoelzle, K., et al., 2010. Hemotropic mycoplasma infection in horses. Vet. Microbiol. 145, 351–353. Dieme, C., Bechah, Y., Socolovschi, C., Audoly, G., Berenger, J., Faye, O., et al., 2015. Transmission potential of Rickettsia felis infection by Anopheles gambiae mosquitoes. Proc. Natl. Acad. Sci. U S A 112, 8088–8093. Dutra, F., Schuch, L.F., DeLucchi, E., Curcio, B.R., Coimbra, H., Raffi, M.B., et al., 2001. Equine monocytic ehrlichiosis (Potomac horse fever) in horses in Uruguay and southern Brazil. J. Vet. Diagn. Invest. 13, 433–437. Düttmann, C., Flores, B., Kadoch, N.Z., Bermúdez, S.C., 2016. Hard ticks (Acari: Ixodidae) of livestock in Nicaragua, with notes about distribution. Exp. Appl. Acarol. 70, 125–135. Dzięgiel, B., Adaszek, Ł., Kalinowski, M., Winiarczyk, S., 2013. Equine granulocytic anaplasmosis. Res. Vet. Sci. 95, 316–320. Goddard, J., Varela-Stokes, A.S., 2009. Role of the lone star tick, Amblyomma americanum (L.), in human and animal diseases. Vet. Parasitol. 160, 1–12. Guzmán-Cornejo, C., Robbins, R.G., Guglielmone, A.A., Montiel-Parra, G., Pérez, T.M., 2016. The Dermacentor (Acari, Ixodida, Ixodidae) of Mexico: hosts, geographical distribution and new records. ZooKeys 569, 1–22. Hegarty, B.C., Qurollo, B.A., Thomas, B., Park, K., Chandrashekar, R., Beall, M.J., et al., 2015. Serological and molecular analysis of feline vector-borne anaplasmosis and ehrlichiosis using species-specific peptides and PCRs. Parasit. Vectors 8, 320. Hun, L., Troyo, A., Taylor, L., Barbieri, A.M., LaBruna, M.B., 2011. First report of the isolation and molecular characterization of Rickettsia amblyommii and Rickettsia felis in Central America. Vector Borne Zoonotic Dis. 11, 1395–1397. Jones, S.L., Maggi, R., Shuler, J., Alward, A., Breitschwerdt, E.B., 2008. Detection of Bartonella henselae in the blood of 2 adult horses. J. Vet. Intern. Med. 22, 495–498. Kidd, L., Qurollo, B., Lappin, M., Richter, K., Hart, J.R., Hill, S., et al., 2017. Prevalence of vector-borne pathogens in southern California dogs with clinical and laboratory abnormalities consistent with immune-mediated disease. J. Vet. Intern. Med. 31, 1081–1090. Labruna, M.B., Walker, D., 2014. Rickettsia felis and changing paradigms about pathogenic rickettsiae. Emerg. Infect. Dis. 20 (10), 1768–1769. Luce-Fedrow, A., Mullins, K., Kostik, A.P., St John, H.K., Jiang, J., Richards, A.L., 2015. Strategies for detecting rickettsiae and diagnosing rickettsial diseases. Future Microbiol. 10, 537–564. Maggi, R.G., Chitwood, M.C., Kennedy-Stoskopf, S., DePerno, C.S., 2013. Novel hemotropic Mycoplasma species in white-tailed deer (Odocoileus virginianus). Comp. Immunol. Microbiol. Infect. Dis. 36, 607–611. Magni, E., Bertelloni, F., Sgorbini, M., Ebani, V.V., 2017. Bartonella infection in asymptomatic horses and donkeys from Tuscany, Central Italy. Asian Pac. J. Trop. Med. 10, 1077–1079. Metcalf, K.B., Lilley, C.S., Revenaugh, M.S., Glaser, A.L., Metcalf, E.S., 2008. The prevalence of antibodies against Borrelia burgdorferi found in horses residing in the Northwestern United States. JEVS. 28, 587–589. Nava, S., Beati, L., Labruna, M.B., Cáceres, A.G., Mangold, A.J., Guglielmone, A.A., 2014. Reassessment of the taxonomic status of Amblyomma cajennense (Fabricius, 1787) with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma

5. Conclusions Tick-exposed, Ehrlichia seropositive horses in Mérida, Nicaragua are coinfected with several different VBOs. We report the first molecular detection of R. felis in horses, which is an emerging zoonotic global pathogen. Moreover, we highlight the infection frequency of a newly recognized VBO, Ehrlichia sp. H7, which may represent an emerging pathogen in Central and South America, and warrants further investigation into its zoonotic potential. We demonstrate that horses in Mérida are routinely exposed to VBOs and should be considered as sentinels of potential zoonotic, vector-transmitted diseases, informing regional clinicians and veterinarians. High frequencies of vector-borne infection in sentinel species should prompt local health authorities to evaluate improved strategies for integrated vector management. Declaration of Competing Interest None. Acknowledgments The authors would like to thank: the technicians in the VBDDL, for sample handling and assistance with PCR assays; the veterinary students, veterinarians and team members from OSU-CVM who traveled to Nicaragua; and Alvaro Molina, local Ometepe resident and Nicaraguan citizen, for organization and guidance regarding services provided to the community. Funding This work was supported in part by NC State Vector-Borne Disease Diagnostic Laboratory and the Carlson College of Veterinary Medicine, Oregon State University. Availability of data The datasets generated during the current study are available in the Mendeley repository, https://data.mendeley.com/submissions/evise/ edit/tr395tt4pj?submission_id=S0001-706X(19)30782X&token=e7b9d295-2e19-47e6-94e3-c8fd9e610b8c. Supplementary material Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.actatropica.2019.105170. 5

Acta Tropica 200 (2019) 105170

J.D. Tyrrell, et al.

West Brazil. Rev. Bras. Parasitol. Vet. 19, 135–140. Schein, F.B., Maia, M.O., Witter, R., Marcili, A., Camargo, L.M.D., Dutra, V., et al., 2018. Molecular survey and genetic diversity of piroplasmids in equids from Midwestern Brazil. Braz. J. Vet. Parasitol. 27, 464–472. Schwint, O.N., Knowles, D.P., Ueti, M.W., Kappmeyer, L.S., Scoles, G.A., 2008. Transmission of Babesia caballi by Dermacentor nitens (Acari: Ixodidae) is restricted to one generation in the absence of alimentary reinfection on a susceptible equine host. J. Med. Entomol. 45, 1152–1155. Scoles, G.A., Ueti, M.W., 2013. Amblyomma cajennense is an intrastadial biological vector of Theileria equi. Parasit. Vectors 6, 306. Soares, I.R., Silva, S.O., Moreira, F.M., Prado, L.G., Fantini, P., Maranhão, R.D., da Silva Filho, J.M., Melo, M.N., Palhares, M.S., 2013. First evidence of autochthonous cases of Leishmania (Leishmania) infantum in horse (Equus caballus) in the Americas and mixed infection of Leishmania infantum and Leishmania (Viannia) braziliensis. Vet. Parasitol. 197, 665–669. Souza, C.E., Camargo, L.B., Pinter, A., Donalisio, M.R., 2016. High seroprevalence for Rickettsia rickettsii in equines suggests risk of human infection in silent areas for Brazilian spotted fever. PLoS ONE 11. Teglas, M., Matern, E., Lein, S., Foley, P., Suman, M.M., Foley, J., 2005. Ticks and tickborne disease in Guatemalan cattle and horses. Vet. Parasitol. 131, 119–127. Tsachev, I., Pantchev, N., Marutsov, P., Petrov, V., Gundasheva, D., Baymakova, M., 2018. Serological Evidence of Borrelia burgdorferi, Anaplasma phagocytophilum and Ehrlichia Spp. Infections in Horses from Southeastern Bulgaria. Vector Borne Zoonotic Dis. 18, 588–594. Tshokey, T., Stenos, J., Tenzin, T., Drukpa, K., Gurung, R.B., Graves, S.R., 2018. Serological evidence of Rickettsia, Orientia, and Coxiella in domestic animals from Bhutan: preliminary findings. Vector Borne Zoonotic Dis. 2336. Vieira, T.S., Vieira, R.F., Krawczak, F.S., Soares, H.S., Guimarães, A.M., Barros-Filho, I.R., Marcondes, M., Labruna, M.B., Biondo, A.W., Vidotto, O., 2016. Ehrlichia sp. infection in carthorses of low-income owners, Southern Brazil. Comp. Immunol. Microbiol. Infect. Dis. 48, 1–5. Vieira, T.S.W.J., Qurollo, B.A., Mongruel, A.C.B., Baggio, R.A., Vidotto, O., Breitschwerdt, E.B., et al., 2018. Potentially same novel Ehrlichia species in horses in Nicaragua and Brazil. Emerg. Infect. Dis. 24, 953. Vieira, R.F., Vieira, T.S., Nascimento, D.do A., Martins, T.F., Krawczak, F.S., Labruna, M.B., et al., 2013. Serological survey of Ehrlichia species in dogs, horses and humans: zoonotic scenery in a rural settlement from southern Brazil. Rev. Inst. Med. Trop. Sao Paulo. 55, 335–340. Wei, L., Kelly, P., Ackerson, K., Zhang, J., El-Mahallaway, H.S., Kaltenboeck, B., et al., 2014. First report of Babesia gibsoni in Central America and survey for vector-borne infections in dogs from Nicaragua. Parasit. Vectors 7, 126. Wise, L.N., Kappmeyer, L.S., Mealey, R.H., Knowles, D.P., 2013. Review of equine piroplasmosis. J. Vet. Intern. Med. 27, 1334–1346.

interandinum n. sp. and Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum Koch, 1844, and Amblyomma sculptum Berlese, 1888 (Ixodida: Ixodidae). Ticks Tick Borne Dis. 5, 252–276. O'Nion, V.L., Montilla, H.J., Qurollo, B.A., Maggi, R.G., Hegarty, B.C., Tornquist, S.J., et al., 2015. A potentially novel Ehrlichia species identified in Nicaraguan horses. Emerg. Infect. Dis. 21, 335–338. Onmaz, A.C., Beutel, R.G., Schneeberg, K., Pavaloiu, A.N., Komarek, A., van den Hoven, R., 2012. Vectors and vector-borne diseases of horses. Vet. Res. Commun. 37, 65–81. Panti-May, J.A., Torres-Castro, M., Hernandez-Betáncourt, S., Dzul-Rosado, K., ZavalaCastro, J., López-Avila, K., et al., 2015. Detection of Rickettsia felis in wild mammals from three municipalities in Yucatan, Mexico. EcoHealth 12, 523–527. Peckle, M., Pires, M.S., da Silva, C.B., da Costa, R.L., Vitari, G.L.V., Senra, M.V.X., et al., 2018. Molecular characterization of Theileria equi in horses from the state of Rio de Janeiro, Brazil. Ticks Tick Borne Dis. 9, 349–353. Pérez-Arellano, J., Fenollar, F., Angel-Moreno, A., Bolaños, M., Hernández, M., Santana, E., et al., 2005. Human Rickettsia felis infection, Canary Islands, Spain. Emerg. Infect. Dis. 11, 1961–1964. Perez, M., Bodor, M., Zhang, C., Xiong, Q., Rikihisa, Y., 2006. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann. N Y Acad. Sci. 1078, 110–117. Posada-Guzmán, M.F., Dolz, G., Romero-Zúñiga, J.J., Jiménez-Rocha, A.E., 2015. Detection of Babesia caballi and Theileria equi in blood from equines from four indigenous communities in Costa Rica. Vet. Med. Int. https://doi.org/10.1155/2015/ 236278. Pusterla, N., Madigan, J.E., 2007. Neorickettsia risticii. In: Sellon, D.C., Long, M.T. (Eds.), Equine Infectious Diseases. Saunders Elsevier, Philadelphia, pp. 357–376. Qurollo, B.A., Archer, N.A., Schreeg, M.E., Marr, H.S., Birkenheuer, A.J., Haney, K., et al., 2017. Improved molecular detection of Babesia infections in animals using a novel quantitative real-time PCR diagnostic assay targeting mitochondrial DNA. Parasit. Vectors 10, 128. Qurollo, B.A., Riggins, D., Comyn, A., Zewde, M.T., Breitschwerdt, E.B., 2014. Development and validation of a sensitive and specific sodB-based quantitative PCR assay for molecular detection of Ehrlichia species. J. Clin. Microbiol. 52, 4030–4032. Reif, K.E., Macaluso, K.R., 2009. Ecology of Rickettsia felis: a review. J. Med. Entomol. 46, 723–736. Rojas, N., Castillo, D., Marin, P., 2015. Molecular detection of Ehrlichia chaffeensis in humans, Costa Rica. Emerg. Infect. Dis. 21, 532–533. Rolão, N., Martins, M.J., João, A., Campino, L., 2005. Equine infection with Leishmania in Portugal. Parasite 12, 183–186. Rosales, R., Rangel-Rivas, A., Escalona, A., Jordan, L.S., Gonzatti, M.I., Aso, T.P., et al., 2013. Detection of Theileria equi and Babesia caballi infections in Venezuelan horses using competitive-inhibition ELISA and PCR. Vet. Parasitol. 196, 37–43. Salvagni, C.A., Dagnone, A.S., Gomes, T.S., Mota, J.S., Andrade, G.M., Baldani, C.D., 2010. Serologic evidence of equine granulocytic anaplasmosis in horses from central

6