- Email: [email protected]
Molecular markers for species identification in the Leishmania subgenus Viannia
TRANSACTIONS
OF THE ROYAL
SOCIETY
OF TROPICAL
MEDICINE
Basic molecular
tools
Molecular Viannia
for species identification
markers
Alexis Mendoza-Le6n’ , Luis Luis’ , Octavia de Bioauimica v Biolopia Molecular de Parcisitos. Venezuela; 2Deiartam&to de Medicina Tropical j Brasil. 4Centro Universitario de Medicina Tropical Cochabamba, Bolivia
AND HYGIENE
(2002) 96, SUPPLEMENT
in the Leishmania
1 S1/65-S1170
subgenus
Fernandes ‘, Elisa Cupolillo3 and Lineth Garcia’,4 ‘Laboratorio IBE. Fact&ad de Ciencias. Universidad Central de Venezuela. Caracas. 3Debartamento de Inmunoiogia, Instituto Oswald0 Cruz, Rio de Janeiro; (CUMETRO), Facultad de Medicina, Universidad Mayor de San Sin&,
Abstract We have previously identified a novel genomic sequence of 500 bp, the BSOO-DNA sequence, in the subgenus Leishmania (Ka,nia). This sequence was localized upstream of the f3-tub&in gene. Restriction fragment length polymorphism and hybridization analysis has shown that the @OO-DNA sequence is specific to this subgenus. A polymerase chain reaction (PCR) assay confirmed this specificity. The fi500DNA sequence was apparently absent from the genomic deoxyribonucleic acid of L. colombiensis and L. equator&k. These results indicate that a PCR assay based on the @OO-DNA sequence is likely to be of use to detect and identify Leishmania parasites of this subgenus in clinical samples with high sensitivity, specificity and reliability. The p500-DNA sequence can be considered a molecular marker for the subgenus Viannia. Keywords: diagnosis
leishmaniasis,
Leishmania (Viannia)
spp., @-tubulin gene,
Introduction Parasites of the genus Leishmania are grouped in 2 subnenera. Leishmania (Leishmania) and Leishmania (Kannia), according to the type of development (peripylarian or suprapylarian) in the digestive tract of the sand fly vector (LAINSON & SHAW, 1987; MENDOZALEON et al., 1996). Several species have been described in these subgenera and many of them are pathogenic to humans, promoting a wide spectrum of the diseases known as leishmaniases. Species of the subgenus Viannia are restricted to America and some of them are associated with the mucocutaneous clinical form of the disease (SARAVIA et al., 1985; SANTRICH et al., 1990; MENDOZA-LEON et al., 1996). Various molecular markers have been used to discriminate the species of this group of parasites, but certain species have unusual features not shared with other species of the same group-for example, L. peruviana, L. colombiensis and L. equatoriensis (see CATHANO et al., 1998; CUPOLILLO et al., 1998a, 1998b, 2000). Also, very divergent species within the subgenus have been described, one example being the species L. Zainsoni (see ERESH et al., 1995). Combinations of different molecular techniques, e.g. restriction fragment length polymorphism (RFLP) and the polymeraie chain reaction (PdR), ha;e proiided valuable tools to identifv Leishmaniu narasites at different levels. Thus, the development Lf different PCR assays using kinetoplast deoxyribonucleic acid (kDNA), the mini-exon non-transcribed spacer, genomic repetitive DNA, the tubulin gene, etc., have produced good evidence in support of the classification proposed ”
fi500-DNA
sequence,
molecular
marker,
nia, in order to develop a PCR assay that specifically detects all species of the subgenus Viannia.
,
by LAINSON & SHAG (1987) (DE BRUIJN & BANKER, 1992; RODRIGUEZ et al., 1994: MENDOZA-LEON & BAR&R, 1996; OSMAN et al., ‘1997; HARRIS et al., 1998; KATAKURA et al., 1998; PIRMEZ et al., 1999). In
the present work we used a novel repetitive genomic sequence, the p500-DNA sequence, which is specific to Leishmania species belonging to the subgenus I&n-
Address for correspondence: Alexis Mendoza-Le6n, Laboratorio de Bioquimica y Biologia Molecular de ParLsitos, Instituto de Biologia Experimental (IBE), Universidad Central de Venezuela. Apartado 47577, Caracas 1041A, Venezuela; phone +58 212 751 0111, fax +58 212 753 5897, e-mail [email protected]
Materials and Methods Parasite strains The designation and geographical origin of all Leishmania strains used in this study, including the World Health Organization (WHO) reference strains. are listed in th: Table. For. all s&dies, promastigotes’were grown at room temperature in Schneider’s Drosophila medium (Gibco) supplemented with 10% heat-inactivated fetal calf serum and 40 pg/mL (ERESH et al., 1993; MENDOZA-LEAN
chloramphenicol et al., 1995).
Clinical samples Clinical samples were obtained from 5 patients from Carrasco village in Cochabamba, Bolivia, an area where an active focus of leishmaniasis has been identified. Three patients had lesions of cutaneous leishmaniasis and 2 had mucosal lesions; all samples were cryopreserved. The Montenegro skin test was positive in all patients; all received treatment with glucantime. Cell fractionation and genomic DNA preparation The total genomic DNA of promastigotes was isolated and purified as described’earlier ~ERESH et aZ., 1993; MENDOZA-LEON et al.. 1995). DNA was nurified with the aid of the QIA&pTM &sue kit (Qia’gen, Chatsworth, California, USA). The DNA samples were ethanol-precipitated and resuspended in sterile water for further analysis. Restriction mapping and Southern blot analysis DNA was digested with the restriction endonuclease PstI (Life Te&nology) under the conditions suggested by the suppliers. The DNA was fractionated bv electrophoresis %G 1% agarose gel, Southern blotted on to a Gene Screen PlusTM membrane (Dunontl and hvbridized with 32P-labelled probes (raLdor& pri6er 1abGiing using the Multiprime TM DNA labelling kit from Amersham) (MENDOZA-LE~)N et al., 1995); the Leishmania @OO-DNA sequence and pLgp4 were used as probes. Construction of the pLgpSO0 and sequence analysis The plasmid pLgfi4, which contains the complete coding region of the fl-tubulin gene from Leishmania
S1166
ALEXIS
Table
1. Details
of strains
Genus and subgenus Species” Leishmania (Leishmaniu) L. m&caAa L. amazonensis L. donovani L. infanturn Leishmania (Kannia) L. brazikensis L. guyanensis L. panamensis L. lainsoni L. na;fJ; L. shawi L. equatoviensis L. colombiensis
of Leishmania
and other
trypanosomatids
Strain designationb MHOM/BZ/82/BELZ MNYClBZl62lM379 IFWBW67PH8 MHOMIINI80IDD8 MHOM/FRi78/LEM75
1
MHOMW75iM2903 MHOM/BR/75/M4147 MHOM/‘PA/71/LS94 MHOM/BR@l/M6426 MDASiBRi70iM5533 MCEBIBRi84lM8408 MCHO/EC/82/Lsp 1 IHAR/CO/S5/CL500 Sauroleishmania and other 1I.eishmania spp. S. tarentolae RTAWSEfXXlLVlO8 RTAWDZI39ILV4 14 L. adleri RLlzIIzEiXXlLv3o L. hoogstraali RLIZkSDlXXlLV3 1 L. gymnodactyli RGECISUIXWLV247 L. hertigi MCOE/PA/‘65/C8; LV42 MCOEIPAI72IC 119; LV43 L. deanei MCOEIBRIXXIM2808; LV402 MCOE/BWOOIM5088 L. herreri IYLEICRI74IO 12; Yleph; LV342 Endotypanum sp .
MENDOZA-LEi)N
ETAL.
studied
Abbreviation
Origin
BEL2 1 M379 PH8C5’ DD8 LEM75
Belize
M2903 M4147 LS94 M6426 M5533 M8408 Lspl CL500
Brazil Brazil
Belize Brazil India
France
Panama
Brazil Brazil Brazil Ecuador Colombia
LV108 LV414 LV30 LV3 1 LV247 LV42 LV43 LV402 M5088 LV342
’
See note
’
d
,
“The nomenclature of Leishmania nrouosed bv LAINSON & SHAW (1987) is followed. “The majority of these strains have-been designated as reference strains by WHO. ‘This is a cloned derivative of L. (L.) amazonensis stock PH8. dDr E. Cupolillo provided these strains.
c
3 kb
1
2
3
45
6
4.36
2.32
o-5b
Probe:
pLgS4
PL!$4
pLg/1500
Fig. 1. Identification of the l3500-DNA sequence of Leishmania. Total genomic DNA (c. 5 lag) representative of different the subgenera Leishmania and Viannia was digested with the endonuclease PstI at 37°C and subjected to electrophoresis agarose gel. The gel was Southern blotted and hybridized to probes 32P-pLg134 (panels A & B) or “I’-pLgfi500 (panel C) 2X salineesodium citrate buffer, 2% sodium dodecyl sulphate, 2X Denhardt’s solution, 100 pg/mL calf thymus DNA. (kb) markers derived from Hind111 fragments of h-DNA. Panel A: lane 1, L. (L.&hmania) mexicana BEL 21; lane amazonensis PH8; lane 3, L. (Viannia) braziliensis M2903; lane 4, L. (V.) guyanensis M4147; lane 5, L. (K) panamensis 6, L. (L.) donovani DDS; lane 7, L. (L.) infanturn LEM75. Panels B & C: lanes 1-3, L. (V.) guyanensis; lane 4, L. M5533; lanes 5 & 6, L. (V.) nut% isolates other than M5533.
species of in a 1.0% at 67°C in Kilobase 2, L. (L.) LS94; lane (V.) naiffi
MOLECULAR MARKERS FOR LEISHMANIA
(VIANNIA)
SW.
(Viannia) guyanensis strain M4147 on a 2.6 kb Hind111 fragment, was used to subclone the 500 bp PstI-fragment in the vector pUC18 (MENDOZA-LEON et al., 1995). After electrophoresis, the 500 bp PstI fragment was ietrieved from he agarbse gel and-purified by the PREP-A-GENETM DNA ourification kit (BioRad). cdli DH5&, DNA ligation, transformatidn in Escherichia clone identification and selection were performed according to standard procedures using the fi500 fragment as probe. Partial sequencing of the fi500 fragment was conducted using the forward and reverse primers of the cjoning site of the pUC18 vector acco;ding to standard procedures with the SequenaseTM version 2.0 DNA sequencing kit (USB). The partial sequence was analysed using Mac VectorTM software. Hybridization
Filters containing DNA were prehybridized and hybridized as described previously (MENDOZA-LEON et aZ., 1995). Hybridization was carried out overnight at 67°C in 2X saline-sodium citrate buffer (SSC), 2.0% sodium dodecyl sulphate (SDS), 2X Denhardt’s solution, and 100 kg/mL calf thymus DNA. After hybridization, the filters were washed for one hour under medium stringency conditions (2X SSC, 0.1% SDS) at 65°C with a minimum of 4 changes of buffer. The filters were exposed for autoradiography at -80°C. assay PCR amplification was performed in a final volume of 20 ILL containing the cocktail of PCR-SupermixTM (Gibco BRL), 50pmol of primers AZ (5’- GACACGCGCTTGCGCACTCGT 3’) and Alo (5’ CCCCCTGCCTCGCCTGC 3’) and 5 na of total genomic DNA. The reaction mixtures were covered wi& mineral oil (Sigma) and the PCR reaction was performed in an MT Research PTC-100TM thermocvcler, with 5 min preincubation at 95°C followed by 35 cycles of 1 min at !YY’C, 1 min at 50°C (low stringency] or 60°C (high strineencvl. and 2 min at 72°C. with a final extension at 72°C ‘&r 10 min. The procluct was analysed by electrophoresis on 1.0 % agarose gel in TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM ethylene diami-
PCR
Fig. 2. Specificity of the @OO-DNA sequence of Letihmaniu. Total genomic DNA (5 ng) of different species of Leishmania representative of both subgenera, Leishmania and Viannia, was subjected to PCR amplification of the @SO0 sequence using the oligonucleotide set AZ/Al0 as primers and 60°C as annealing temperature during 35 cycles. The PCR products were separated by electrophoresis in a 1.5% agarose gel and visualized by ethidium bromide staining (panel A). The gel was then Southern blotted and hybridized to the probe ‘*Pfi500 under medium stringency conditions (panel B). Lane 1, L. (Leishmania) mexicana M379; lane 2, L. (L.) amazonensis PH8; lane 3, L. (L.) mexicana BEL 21; lane 4, L. (Viannia) braziliensis M2903; lane 5, L. (V.) panamensis LS94; lane 6, L. (V.) guyanensis M4147; lane 7, pLgfi4-DNA (positive control); lane 8, no DNA (negative control). Expected product size, for species belonging to the subgenus Viannia, was 375 bp.
Fig. 3. The BSOO-DNA sequence in the subgenus Leishmaniu (Vianniu). Total genomic DNA (5 ng) of different species of Leishmania and Endonypanum was subjected to PCR amplifias described cation of the @SO0 sequence and electrophoresis for Fig. 2. Lane 1, L. (Vianniu) braziliensis M2903; lane 2; L. (V.) guyanensis M4147; lane 3, L. (V.) panamensis LS94; lane 4, L. (V.) lainsoni M6426; lane 5, L. (V.) equatoriensis Lspl; lane 6, L. (I’.) shawi M8408; lane 7, L. (V.) na$ M5533; lane 8, L. (V.) colombiensis CL500; lane 9, Endotypanum sp.; lane 10, L. (V.) guyanensis M4147; lane 1 lT L. (Leishmania) mexicana BEL 21. Lane 12, no DNA (negatwe control). Lane M contained the 1.0 kb DNA ‘ladder’ molecular size marker.
netetraacetic acid, pH 8.3). Samples were recorded as positive when a 375 bp PCR product could be detected. Results Identification subgenus
of a novel genomic
sequence
specific
to the
Leishmania (Viannia) strains Genomic DNA from different Leishmania representative of the subgenera Leishmania and Viannia was digested with the endonuclease PstI and a Southern blot transfer carried out using the fi-tubulin pLgfi4 clone as probe (Fig. 1A). Species of the subgenus Leishmania produced patterns which differed between species of ‘New World’ Leishmania, represented by L. mexicana BEL21 (lane 1) and L. amazonensis PH8C5 (lane 2), and ‘Old World’ Leishmania, such as L. donovani DD8 (lane 6) and L. infanturn LEM75 (lane 7), suggesting intra-subgeneric variation. Different patterns could also be distinguished among species of the subgenus Viannia, represented by L. braziliensis M2903 (lane 3), L. guyanensis M4147 (lane 4) and L. panamensis LS94 (lane 5). A common PstI fragment of c. 500 bp (0500) was present in all species of the subgenus Viannia. This sequence was subcloned from pLgfi4, as described in the Materials and Methods section, and the resulting pLgfl500 clone was used to determine similarly the presence and specificity of the sequence in natural isolates of Leishmania. As an example, we detected the presence of the 500 bp PstI band in the species of Leishmania previously characterized by isoenzyme analysis as L. guyanensis and L. naiffi (Fig. 1B) . The 500 bp DNA subgenus Viannia
sequence
as a molecular
marker
of the
The presence and specificity of the 8500 sequence in the genomic DNA of Leishmania was evaluated by PCR amplification and hybridization of the PCR products to the fi500 probe. The pLgfi500 clone was partially sequenced and a set of oligonucleotides was designed for use in a PCR assay. Genomic DNA of Leishmania strains representative of both subgenera was amplified at an annealing temperature of 60°C with the set of primers Alo/A2 (Fig. 2). Under these conditions, no signal was found in L. mexicana strain M379 (lane 1); however, some PCR products were detected in L. amazonensis PH8 (lane 2) and L. mexicana BEL21 (lane 3), both strains belonging to the subgenus Leish-
S1168
ALEXIS
7
8
9
1011
Fig. 5. Detection of Leishmaniu (Vianniu) species in clinical samples by the /3500-PCR assay. Crude DNA from biopsies obtained from patients with active cutaneous or mucocutaneous leishmaniasis lesions was prepared as described in the Material and Methods section and amplification of the BSOODNA sequence was carried out as described for Fig. 3. As an internal control of the PCR reaction, primers for amplification of an internal region of the coding sequence of the f3-tubulin gene which generate a PCR product of 900 bp were included. Lane 1, L. (Viannia) braziliensis M2903; lane 2, L. (L.) mexicana EEL 21; lane 3, L. (L.) amazonensis PH8; lane 4, L. (L.) donovani DD8; lane 5, L. (V.) guyanensis M4147; lane 6, no DNA (negative control); lanes 7 & 10, patients with mucosal lesions; lanes 8, 9 & 11, patients with cutaneous lesions. The molecular size marker (lane M and between lanes 6 and 7) was a 100 bp DNA ‘ladder’.
>
Fig. 4. Cross-homology of the Leishlnaniu PCR products to the b500-DNA sequence. Panel A. Total genomic DNA (5 ng) of different Leishmania species belonging to the subgenus V&&z was examined by PCR amplification of the B500 sequence as described for Fig. 3, but under low stringency conditions (50°C as annealing temperature). The PCR products were separated by electrophoresis through a 2.0% agarose gel and visualized by ethidium bromide staining. Panel A: lane 1, L. (Viannia) braziliensis M2903; lane 2; L. (V.) guyanensis M4 147; lane 3, L. (V.) panamensis LS94; lane 4, L. (V.) shawi M8408; lane 5, L. (V.) na$fi M5533; lane 6, L. (V.) lainsoni M6426; lane 7, L. (V.) colombiensis CL500; lane 8, L. (V.) equatoriensis Lspl; lane 9, no DNA (negative control). Panel B: a similar analysis was carried out using different species of Leishmaniu; after ethidium bromide staining (upper section), the gel was Southern blotted and hybridized to 32P-B500 under medium stringency conditions and washed as described under Materials and Methods (lower section); some species not belonging to the subgenus Viannia were included. Lane 1, L. (V.) bruziliensis M2903; lane 2, L. (V.) colombiensis CL500; lane 3, L. (V.) equatoriensis Lspl; lane 4, L. (Leishmania) mexicana BEL21; lane 5, Endotypanum sp.; lanes 6 & 7, L. her& lanes 8 & 9, L. deanei; lanes 10-12, L. herreti; lane 13, L. adleri; lane 14-17, Sauroleishmania. Lane 18, no DNA (negative control). The molecular size marker was a 100 bp DNA ‘ladder’.
mania. In contrast, was visualized
ETA.
MENDOZA-LEON
a unique
by ethidium
fragment
of about 375 bp
bromide staining in 3 different species of the subgenus Viannia-L. braziliensis (lane 4), L. panarnensis (lane 5) and L. guyanensis (lane
6). Also, the positive control, pLgp4, (lane 7) showed the same fragment. Southern transfer of the PCR products was carried out and the filter was hybridized to the 8500 probe. A positive signal was found in species of the subgenus I&nniu only, confirming the specificity of the sequence for this subgenus. In order to demonstrate the presence of the @OODNA sequence in the subgenus Viunniu, the same PCR assay under the conditions described above was evaluated with genomic DNA (5 ng) from 8 different species in this subgenus. As shown in Fig. 3, the PCR assay was positive with the WHO reference strains of L. bruziliensis M2903 (lane l), L. guyanensis M4147 (lanes 2 & lo), L. punurnensis LS94 (lane 3), L. Zuinsoni M6426 (lane 4), L. shuwi M8408 (lane 6) and L. naiffi’ M5533 (lane 7); all of them yielded products of the expected size range (375 bp). No PCR product was found when L. equatoriensis Lspl (lane 5) and L. colombiensis CL500 (lane 8) were used. Similar results were found when Lsp2, another strain of L. equatorknsis and E582.34, another strain of L. colombiensis, obtained from the Fiocruz reference bank (Rio de Janeiro, Brazil), were used (data not shown). These results suggest the absence of the p500-DNA sequence from these 2 species. Also, no product was obtained from genomic DNA of L. mexicana BEL 21 (lane 11) or the related kinetoplastid Endotypunum sp. (lane 9). These results suggest that the @OO-PCR assay can unambiguously identify Leishmunia parasites belonging to the subgenus Viannia. Thus, the J3500-DNA sequence can be considered a molecular marker of this subgenus. The subgeneric
status of L. colombiensis
and
L.
equatoriensis L. equutoriensis and L. colombiensis have been classified as members of the subgenus Viunniu (see I-UTZER et al., 1991; GRIMUDI et al., 1992). Since both species gave anomalous results in the (3500-PCR assay, we decided to perform the PCR amplification at low stringency (50°C) to evaluate by hybridization the cross-homology of the PCR products to the J3500 sequence. As shown in Fig. 4A, the PCR assay produced products in the expected size range (375 bp) for
MOLECULAR
MARKERS
FOR LEISHMANIA
(VIANNIA)
genomic DNA of L. bruziliensis M2903 (lane I), L. guyanensis M4147 (lane 2), L. panarnensis LS94 (lane 3), L. shawi M8408 (lane 4), L. naiffi M5533 (lane 5), and L. lainsoni M6426 (lane 6). L. colombiensis CL500 (lane 7) and L. equatoriensis Lspl (lane 8) gave similar oatterns which differed from those of the L. 0Gnnia) species, and none of the bands had the expected size of 375 bp. A similar experiment was performed in order to estimate the homology of these bands to the fi500DNA seauence, using L. braziliensis strain M2903 as a positive dontrol (Fig.“4B, lane 1). A distinct pattern of bands was obtained with strains of the subgenus Leishmania, different from that of the subgenus I&n&, after ethidium bromide staining. L. colombiensis (lane 2) and L. equatonmsis (lane 3) showed a pattern of multiple products of different sizes, the more-abundant uroduct being a 280 bn fragment. The similaritv of the PCR producy patterns beiween these 2 species was remarkable. Other species of the subgenus Leishmania were tested and all of them yielded different amplification products with an extensive size range; these species included L. mexicana (lane 4), L. hertigi (lanes 6 & 7), L. deanei (lanes 8 & 9), L. herrem’ (lanes lo-12), L. adleri (lane 13), and SauroZeishman& (lanes 14117). The related kinetowlastid Endotrvaanum SW. (lane 5)I was also included. Under conditions of low stringency, the @500-DNA probe cross-hybridized with only L. bruziliensis (Fig. 4, B, lane 1). No cross-hybridization was found with any other species of Leishmania used in this study. This finding suggests the absence of the BSOO-DNA sequence from the genome of L. colombiensis and L. equatoriensis. I
The PSOO-PCR
assay with
clinical
S1169
SW.
.
samples
In order to evaluate the B~oo-PCR assay as a diagnostic method, clinical samples obtained from patients with active cutaneous or mucocutaneous leishmaniasis were used (Fig. 5). As reported above, no @500-PCR product was generated when total genomic DNA from L. mexicana BEL 21 (lane 2), L. amazonensis PH8 (lane 3) or L. donovani DD8 (lane 4), all belonging to the subgenus Leishmaniu, was used in the amplification reaction. In contrast, genomic DNA from species of the subgenus Viunnia, such as L. braziliensis M2903 (lane 1) and L. guyanensis M4147 (lane 5), produced the expected 375 bp amplification product. All biopsies tested generated the characteristic amplification product expected for the subgenus Viunnia, and confirmed the presence of L. (V&u&) species in the clinical samples (lanes 7- 11). As an internal control of the PCR reaction. we used the amwlitication of an internal region of the’f3-tubulin gene, &hich generates a PCR product of 900 bp, which was present in all samples. Discussion The combination of different molecular techniques, e.g. RFLP and PCR amplification, and the evaluation of different molecular markers provides a valuable tool for the identification of Leishmania parasites at different levels. In this work, we have identified a novel sequence, the fi500-DNA sequence, in the genomic DNA of Leishmania. This sequence is located upstream of the (3-tubulin gene region, as previously demonstrated in the restriction man of a clone of the fi-tub&z gene region obtained from the nuclear DNA of L. 7V.j Puvanensis M4147 (see MENDOZA-LEON et al.. 1995). The sequence is specific to the subgenus Vi&&& shown by hybridization experiments: the @OO-DNA sequence is not present in the genomic DNA of species belonging to the subgenus Leishmaniu. Due to its high sensitivity, the PCR technique has advantages as a tool in the molecular diagnosis of the aetiological agents of different parasitic diseases in clinical samples. Thus, after partial sequencing of the 8500 sequence, we designed the set of primers AZ/A,,, to evaluate the specificity of the sequence by a PCR
assay. The PCR amplification reaction, under high stringency conditions,bf the 8500 sequence from genomic DNA of different Leishmaniu swecies rewresentative of both subgenera, generated a unique PCR product of c. 375 bp in those species belonging to the subgenus Viannia, in agreement with the specificity of the BSOODNA sequence previously demonstrated by Southern analysis. Furthermore, we demonstrated the amplification of this sequence in all species in the subgenus Viunna. Surprisingly, L. colombiensis and L. equatoriensis gave negative results; these species had previously been classified as members of the subgenus Viunnia (see KREUTZER
et al.,
1991;
GRIMALDI
et aZ., 1992).
When the PCR reaction was carried out at low stringency by decreasing the annealing temperature to 50°C we found a multiple-banded amplification pattern with L. colombiensis and L. equatoriensis. The similarity of both patterns was striking; these patterns were different from those found with the other Vianniu species. Also, when genomic DNA of Endotrypanum sp. and other enigmatic species of Leishmaniasuch as i. hertigi, L. deanei. L. herren’. L. adleri and Sauroleishmania, &as used for PCR am&ication at low stringency, a distinct pattern of bands, similar to that obtained by RAPD, was found; this pattern showed some similarities and some differences among the organisms tested. Hybridization analysis using the (3500-DNA sequence and the p500-PCR product as probes conclusively demonstrated that no cross-homology exists between these probes and the PCR products generated at low stringency from the genomic DNA of Endotypanum or from those of different Leishmaniu species of the subgenus Viunnia. Also, hybridization analysis using the 375 bp fragment as probe and restricted genomic DNA from all species of the subgenera Viannia and Leishmania and Endotypanum sp. confirmed the absence of this fragment from L. coZombiensis. L. eauatoriensis and Endotbpanum sp. (data not shown). =The lack of crosshybridization with the (3500-DNA sequence demonstrated the absence of related sequences from species of the subgenus Leishmaniu, enigmatic species of Leishmania, L. colombiensis, L. equaton’ensis, and Endotypanum sp. A similar situation was found with the kDNA of L. Zuinsoni and other species of the subgenus Viunniu. For example, recognition of the species of this subgenus based on the specific amplification of kDNA using the oligonucleotide set Bl /B2 failed with L. lainsoni at 67.5”C, while different products were observed at a lower stringency annealing temperature (60.5”C) (ERESH et al., 1995). Sequence comparison of the minicircle DNA demonstrated that L. Zuinsoni is more similar to members of the subgenus Viunnia than to the subgenus Leishmania (see MCCANN et al., 1999). Previous results using isoenzyme analysis suggested the inappropriate placement of L. equato*iensis in the subgenus Vianniu (see CUPOLILLO et aZ., 1995, 2000). Also, molecular data from PCR amplification of the mini-exon gene non-transcribed spacer, minicircle conserved region sequences, analysis of ITS of the rRNA (ribosomal ribonucleic acid) gene, and sialidase activity suggested a close relationship between L. colombiensis and L. equatoriensis and Endotypanum schaudinni
(see CUPOLILLO
et al.,
1998a).
Me
are con-
fident of the specificity of the BSOO-DNA sequence to the genus Leishmania; nevertheless, such specificity is restricted to species of the subgenus Viunnii (see DEBRUIIN & BARKER, 1992; ERESH et aZ., 1995: MCCANN et aZ., 1999). Further *experiments ‘are necessary to establish the real status of L. colombiensis and L. equatoriensis in the genus Leishmaniu; our results suggest that the inclusion of these organisms in the subgenus Viannia must be revised. Different amplification PCR assays using different Leishmaniu DNA targets have been established for the diagnosis of the leisrhmaniases (HARRIS et aZ., 1998; PIRMEZ et aZ., 1999). One of the aims of this study was
s1170
to evaluate the efficacy of parasite detection in clinical samples obtained from patients with active cutaneous or mucocutaneous leishmaniasis, usina a 8500-PCR assay. The results presented here’demonstra’te that the parasites may be detected in clinical samples with high efficiency and sensitivity. Moreover, positive samples which had not previously been diagnosed were reproducibly detected with this assay. We are confident of the specificity of this assay because, in combination with hybridization experiments, we have demonstrated the homology of the PCR product to the BSOO-DNA sequence. The mucosal form of the disease is difficult to diagnose due to the small number of parasites present in the lesion. Our results are promising for diagnosis based on clinical samples from mucosal lesions; we are evaluating this assay in order to establish the optimal conditions for its use as a routine diagnostic method. In conclusion, we have identified a novel genomic DNA sequence, which is specific to the genus Leishmania. It is restricted to species of the subgenus Viannia, among which this sequence is apparently highly conserved; the only exceptions were the reference strains of L. colombiensis and L. equatoriensis. Thus, the l3500 sequence can be considered as a molecular marker for the subgenus L. fiXanniaJ Since the value of the PCR reaction has been demonstrated in the diagnosis of leishmaniasis, evaluation of the use of this sequence in a PCR assay for epidemiological studies is in progress. Acknowledgements
We are most grateful to Dr A. Herrera (Instituto de Biologia Exoerimental. Universidad Central de Venezuela) for critical comments on the manuscript, to Marcos Cathano (Departamento de Bioquimica y Biologia Molecular, FIOCRUZ, Rio de Janeiro) for technical assistance, and Jorge Rivas (IVIC, Venezuela) for photographic assistance. This work received financial support from Venezuelan government grants CDCH 03.10.4126.98, CDCH 03.33. 3961.97 and CONICIT Sl-96001411 to A. M.-L.; L. L and L. G received training grants from Universidad de Las Naciones Unidas to visit the laboratories of 0. F. and A. M.-L., respectively. References Cathano, M. I’., Cuoolillo, E., Camnbeil. D. & Fernandes. 0. (1998). Leishmant’a colombiensis an‘d Lekhmania equatoriensis: peculiar Viannia species. Memdrias do Institute Oswaldo Crux, 93, supplement 11, 182. Cupolillo, E., Grimaldi, G., jr & Momen, H. (1995). Discrimination of Leishmania isolates using a limited set of enzvmatic loci. Annals of Tropical Medic&e and Parasitology, 89, 17-21.
Cupolillo, E., Noyes, H., Pereira, L. 0. R., Fernandes, O., Pereira, I., Medina-Acosta, E. & Grimaldi, G., ir (1998a). Genetic relationship and evolution of New’World Leishmk nia: suggestion of evolutive link with Endotrypanum. Memhrias do Instituto Oswald0 Crux, 93, supplement 11, 186. Cupolillo, E., Pereira, L. 0. R., Fernandes, O., Pereira, J., Medina-Acosta, E. & Grimaldi, G., jr (1998b). Genetic data showing evolutionary links between Leishmania and Endotypanum. Memdrias do Instituto Oswaldo Cruz, 93, 6777683. Cupolillo, E., Medina-Acosta, E., Noyes, H., Momen, H. & Grimaldi, G., jr (2000). A revised classification for Leishmania and Endotrypanum. Parasitology Today, 16, 142-144. De Bruijn, M. H. L. & Barker, D. C. (1992). Diagnosis of New World leishmaniasis: specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNA. Acta Tropica, 52, 45-58. Eresh, S., Mendoza-Leon, A. &Barker, D. C. (1993). A small chromosome of Leishmania (Viannia) braziliensis contains
ALEXIS
MENDOZA-LE6N
ITAL.
multicopy sequences which are complex specific. Acta Tropica, 55,33-46. Eresh, S., de Bruijn, M. H. L., Mendoza-Leon, J. A. & Barker, D. C. (1995). Leishmaniu (Viunnia) lainsoni occupies a unique niche within the subgenus Vianniu. Transactions of the Royal Society of Tropical Medicine and Hygiene, 89, 231-236. Grimaldi, G., jr, Kreutzer, R. D., Hashiguchi, Y., Gomez, E. A., Mimory, T. & Tesh, R. B. (1992). Description of Leishmania equatoriensis sp. n. (Kinetoplastida, Trypanosomatidae), a new parasite infecting arboreal mammals in Ecuador. Memdrias do Znstituto Oswaldo Cruz, 87, 221-228. Harris, E., Kropp, G., Belli, A., Rodriguez, B. & Agabian, N. (1998). Single-step multiplex PCR assay for characterization of New World Leishmania complexes. Journal of Clinical Microbiology, 36, 1989-1995. Katakura, K., Kawasu, S.-I., Naya, T., Nagakura, K., Ito, M., Aikawa, M., Qu, J.-Q., Guan, L.-I., Zuo, X.-P., Chai, J.-J., Chang, K.-P. & Matsumoto, Y. (1998). Diagnosis of kalaazar by nested PCR based on amplification of the Leishmania mini-exon gene. Journal of Clinical Microbiology, 36, 2173-2177. Kreutzer, R. D., Corredor, A., Grimaldi, G., jr, Grogl, M., Rowton, E. D., Young, D. G., Morales, A., McMahonPratt, D., Guzman, H. & Tesh, R. B. (19911. Characterization of Leishmania~colombiensis~sp. n. (Kinetoplastida: Trypanosomatidae), a new parasite infecting humans, animals and phlebotomine sand flies in Colombia and Panama. American Journal of Tropical Medicine and Hygiene, 44, 662-675. Lainson, R. & Shaw, J. J. (1987). Evolution, classification and geographical distribution. In: The Leishmaniases in Biology and Medicine, Peters, W. & Killick-Kendrick, R. (editors), vol. 1. Academic Press, London, pp. l-120. McCann, S. H. E., Eresh, S. & Barker, D. C. (1999). Kinetoplast minicircle DNA from Leishmania (Viannia) lainsoni. Parasitology, 118, 371-374. Mendoza-Leon, A. & Barker, D. C. (1996). Variation of a multigene family in New World Leishmaniu: the fi-tubulin gene region. In: Molecular and Immune Mechanisms in the Pathogenesis of Cutaneous Leishmaniasis, Tapia, F. J., Caceres-Dittmar, G. & Sanchez, M. A. (editors). Austin, Texas: R. G. Landes Bioscience Publishers, pp. 107-127. Mendoza-Leon, A., Havercroft, J. & Barker, D. C. (1995). The RFLP analysis of the l?-tubulin gene region in New World Leishmaniu. Parasitology, 111, l-9. Mendoza-Leon, A., Shaw, J. J. & Tapia, F. J. (1996). A guide for the cutaneous leishmaniasis connoisseur. In: Molecular and Immune Mechanisms in the Pathogenesis of Cutaneous Leishmaniasis, Tapia, F. J., Caceres-Dittmar, G. & Sanchez, M. A. (editors). Austin, Texas: R. G. Landes Bioscience Publishers, pp. l-23. Osman, 0. F., Kager, P. A., Zijlstra, E. E., El-Hassan, A. M. & Oskam, L. (1997). Use of PCR on lvmoh-node samnles as test of-cure’ of visceral leishmaniasis. Annals of Tro&al Medicine and Parasitology, 91, 845850. Pirmez, C., da Silva, T. V., Paes-Oliveira, N. M., da-Cruz, A. M., Goncalves da Costa, S. C., Catanho, M., Degrave, W. & Fernandes, 0. (1999). Use of PCR in diagnosis of human American tegumentary leishmaniasis in Rio de Janeiro, Brazil. Journal of Clinical Microbiology, 31,
1819-1823. Rodriguez, N., Guzman, B., Rodas, A., Takiff, H., Bloom, B. R. & Convit. 1. (1994). Diaanosis of cutaneous leishmaniasis and species ‘discriminatyon of parasites by PCR and hybridization. Journal of Clinical Microbiology, 32, 2246-2252. Santrich, C., Segura, I., Arias, A. L. & Saravia, N. (1990). Mucosal disease caused by Leishmania braziliensis guyanensis. American Journal of Tropical Medicine and Hygiene, 42, 51-55. Saravia, N. G., Holguin, A. F., McMahon-Pratt, D. & D’Alessandro, A. (1985). Mucocutaneous leishmaniasis in Colombia: Leishmania braziliensis subspecies diversity. American Journal of Tropical Medicine and Hygiene, 34, 7 144720.
OF THE ROYAL
SOCIETY
OF TROPICAL
MEDICINE
Basic molecular
tools
Molecular Viannia
for species identification
markers
Alexis Mendoza-Le6n’ , Luis Luis’ , Octavia de Bioauimica v Biolopia Molecular de Parcisitos. Venezuela; 2Deiartam&to de Medicina Tropical j Brasil. 4Centro Universitario de Medicina Tropical Cochabamba, Bolivia
AND HYGIENE
(2002) 96, SUPPLEMENT
in the Leishmania
1 S1/65-S1170
subgenus
Fernandes ‘, Elisa Cupolillo3 and Lineth Garcia’,4 ‘Laboratorio IBE. Fact&ad de Ciencias. Universidad Central de Venezuela. Caracas. 3Debartamento de Inmunoiogia, Instituto Oswald0 Cruz, Rio de Janeiro; (CUMETRO), Facultad de Medicina, Universidad Mayor de San Sin&,
Abstract We have previously identified a novel genomic sequence of 500 bp, the BSOO-DNA sequence, in the subgenus Leishmania (Ka,nia). This sequence was localized upstream of the f3-tub&in gene. Restriction fragment length polymorphism and hybridization analysis has shown that the @OO-DNA sequence is specific to this subgenus. A polymerase chain reaction (PCR) assay confirmed this specificity. The fi500DNA sequence was apparently absent from the genomic deoxyribonucleic acid of L. colombiensis and L. equator&k. These results indicate that a PCR assay based on the @OO-DNA sequence is likely to be of use to detect and identify Leishmania parasites of this subgenus in clinical samples with high sensitivity, specificity and reliability. The p500-DNA sequence can be considered a molecular marker for the subgenus Viannia. Keywords: diagnosis
leishmaniasis,
Leishmania (Viannia)
spp., @-tubulin gene,
Introduction Parasites of the genus Leishmania are grouped in 2 subnenera. Leishmania (Leishmania) and Leishmania (Kannia), according to the type of development (peripylarian or suprapylarian) in the digestive tract of the sand fly vector (LAINSON & SHAW, 1987; MENDOZALEON et al., 1996). Several species have been described in these subgenera and many of them are pathogenic to humans, promoting a wide spectrum of the diseases known as leishmaniases. Species of the subgenus Viannia are restricted to America and some of them are associated with the mucocutaneous clinical form of the disease (SARAVIA et al., 1985; SANTRICH et al., 1990; MENDOZA-LEON et al., 1996). Various molecular markers have been used to discriminate the species of this group of parasites, but certain species have unusual features not shared with other species of the same group-for example, L. peruviana, L. colombiensis and L. equatoriensis (see CATHANO et al., 1998; CUPOLILLO et al., 1998a, 1998b, 2000). Also, very divergent species within the subgenus have been described, one example being the species L. Zainsoni (see ERESH et al., 1995). Combinations of different molecular techniques, e.g. restriction fragment length polymorphism (RFLP) and the polymeraie chain reaction (PdR), ha;e proiided valuable tools to identifv Leishmaniu narasites at different levels. Thus, the development Lf different PCR assays using kinetoplast deoxyribonucleic acid (kDNA), the mini-exon non-transcribed spacer, genomic repetitive DNA, the tubulin gene, etc., have produced good evidence in support of the classification proposed ”
fi500-DNA
sequence,
molecular
marker,
nia, in order to develop a PCR assay that specifically detects all species of the subgenus Viannia.
,
by LAINSON & SHAG (1987) (DE BRUIJN & BANKER, 1992; RODRIGUEZ et al., 1994: MENDOZA-LEON & BAR&R, 1996; OSMAN et al., ‘1997; HARRIS et al., 1998; KATAKURA et al., 1998; PIRMEZ et al., 1999). In
the present work we used a novel repetitive genomic sequence, the p500-DNA sequence, which is specific to Leishmania species belonging to the subgenus I&n-
Address for correspondence: Alexis Mendoza-Le6n, Laboratorio de Bioquimica y Biologia Molecular de ParLsitos, Instituto de Biologia Experimental (IBE), Universidad Central de Venezuela. Apartado 47577, Caracas 1041A, Venezuela; phone +58 212 751 0111, fax +58 212 753 5897, e-mail [email protected]
Materials and Methods Parasite strains The designation and geographical origin of all Leishmania strains used in this study, including the World Health Organization (WHO) reference strains. are listed in th: Table. For. all s&dies, promastigotes’were grown at room temperature in Schneider’s Drosophila medium (Gibco) supplemented with 10% heat-inactivated fetal calf serum and 40 pg/mL (ERESH et al., 1993; MENDOZA-LEAN
chloramphenicol et al., 1995).
Clinical samples Clinical samples were obtained from 5 patients from Carrasco village in Cochabamba, Bolivia, an area where an active focus of leishmaniasis has been identified. Three patients had lesions of cutaneous leishmaniasis and 2 had mucosal lesions; all samples were cryopreserved. The Montenegro skin test was positive in all patients; all received treatment with glucantime. Cell fractionation and genomic DNA preparation The total genomic DNA of promastigotes was isolated and purified as described’earlier ~ERESH et aZ., 1993; MENDOZA-LEON et al.. 1995). DNA was nurified with the aid of the QIA&pTM &sue kit (Qia’gen, Chatsworth, California, USA). The DNA samples were ethanol-precipitated and resuspended in sterile water for further analysis. Restriction mapping and Southern blot analysis DNA was digested with the restriction endonuclease PstI (Life Te&nology) under the conditions suggested by the suppliers. The DNA was fractionated bv electrophoresis %G 1% agarose gel, Southern blotted on to a Gene Screen PlusTM membrane (Dunontl and hvbridized with 32P-labelled probes (raLdor& pri6er 1abGiing using the Multiprime TM DNA labelling kit from Amersham) (MENDOZA-LE~)N et al., 1995); the Leishmania @OO-DNA sequence and pLgp4 were used as probes. Construction of the pLgpSO0 and sequence analysis The plasmid pLgfi4, which contains the complete coding region of the fl-tubulin gene from Leishmania
S1166
ALEXIS
Table
1. Details
of strains
Genus and subgenus Species” Leishmania (Leishmaniu) L. m&caAa L. amazonensis L. donovani L. infanturn Leishmania (Kannia) L. brazikensis L. guyanensis L. panamensis L. lainsoni L. na;fJ; L. shawi L. equatoviensis L. colombiensis
of Leishmania
and other
trypanosomatids
Strain designationb MHOM/BZ/82/BELZ MNYClBZl62lM379 IFWBW67PH8 MHOMIINI80IDD8 MHOM/FRi78/LEM75
1
MHOMW75iM2903 MHOM/BR/75/M4147 MHOM/‘PA/71/LS94 MHOM/BR@l/M6426 MDASiBRi70iM5533 MCEBIBRi84lM8408 MCHO/EC/82/Lsp 1 IHAR/CO/S5/CL500 Sauroleishmania and other 1I.eishmania spp. S. tarentolae RTAWSEfXXlLVlO8 RTAWDZI39ILV4 14 L. adleri RLlzIIzEiXXlLv3o L. hoogstraali RLIZkSDlXXlLV3 1 L. gymnodactyli RGECISUIXWLV247 L. hertigi MCOE/PA/‘65/C8; LV42 MCOEIPAI72IC 119; LV43 L. deanei MCOEIBRIXXIM2808; LV402 MCOE/BWOOIM5088 L. herreri IYLEICRI74IO 12; Yleph; LV342 Endotypanum sp .
MENDOZA-LEi)N
ETAL.
studied
Abbreviation
Origin
BEL2 1 M379 PH8C5’ DD8 LEM75
Belize
M2903 M4147 LS94 M6426 M5533 M8408 Lspl CL500
Brazil Brazil
Belize Brazil India
France
Panama
Brazil Brazil Brazil Ecuador Colombia
LV108 LV414 LV30 LV3 1 LV247 LV42 LV43 LV402 M5088 LV342
’
See note
’
d
,
“The nomenclature of Leishmania nrouosed bv LAINSON & SHAW (1987) is followed. “The majority of these strains have-been designated as reference strains by WHO. ‘This is a cloned derivative of L. (L.) amazonensis stock PH8. dDr E. Cupolillo provided these strains.
c
3 kb
1
2
3
45
6
4.36
2.32
o-5b
Probe:
pLgS4
PL!$4
pLg/1500
Fig. 1. Identification of the l3500-DNA sequence of Leishmania. Total genomic DNA (c. 5 lag) representative of different the subgenera Leishmania and Viannia was digested with the endonuclease PstI at 37°C and subjected to electrophoresis agarose gel. The gel was Southern blotted and hybridized to probes 32P-pLg134 (panels A & B) or “I’-pLgfi500 (panel C) 2X salineesodium citrate buffer, 2% sodium dodecyl sulphate, 2X Denhardt’s solution, 100 pg/mL calf thymus DNA. (kb) markers derived from Hind111 fragments of h-DNA. Panel A: lane 1, L. (L.&hmania) mexicana BEL 21; lane amazonensis PH8; lane 3, L. (Viannia) braziliensis M2903; lane 4, L. (V.) guyanensis M4147; lane 5, L. (K) panamensis 6, L. (L.) donovani DDS; lane 7, L. (L.) infanturn LEM75. Panels B & C: lanes 1-3, L. (V.) guyanensis; lane 4, L. M5533; lanes 5 & 6, L. (V.) nut% isolates other than M5533.
species of in a 1.0% at 67°C in Kilobase 2, L. (L.) LS94; lane (V.) naiffi
MOLECULAR MARKERS FOR LEISHMANIA
(VIANNIA)
SW.
(Viannia) guyanensis strain M4147 on a 2.6 kb Hind111 fragment, was used to subclone the 500 bp PstI-fragment in the vector pUC18 (MENDOZA-LEON et al., 1995). After electrophoresis, the 500 bp PstI fragment was ietrieved from he agarbse gel and-purified by the PREP-A-GENETM DNA ourification kit (BioRad). cdli DH5&, DNA ligation, transformatidn in Escherichia clone identification and selection were performed according to standard procedures using the fi500 fragment as probe. Partial sequencing of the fi500 fragment was conducted using the forward and reverse primers of the cjoning site of the pUC18 vector acco;ding to standard procedures with the SequenaseTM version 2.0 DNA sequencing kit (USB). The partial sequence was analysed using Mac VectorTM software. Hybridization
Filters containing DNA were prehybridized and hybridized as described previously (MENDOZA-LEON et aZ., 1995). Hybridization was carried out overnight at 67°C in 2X saline-sodium citrate buffer (SSC), 2.0% sodium dodecyl sulphate (SDS), 2X Denhardt’s solution, and 100 kg/mL calf thymus DNA. After hybridization, the filters were washed for one hour under medium stringency conditions (2X SSC, 0.1% SDS) at 65°C with a minimum of 4 changes of buffer. The filters were exposed for autoradiography at -80°C. assay PCR amplification was performed in a final volume of 20 ILL containing the cocktail of PCR-SupermixTM (Gibco BRL), 50pmol of primers AZ (5’- GACACGCGCTTGCGCACTCGT 3’) and Alo (5’ CCCCCTGCCTCGCCTGC 3’) and 5 na of total genomic DNA. The reaction mixtures were covered wi& mineral oil (Sigma) and the PCR reaction was performed in an MT Research PTC-100TM thermocvcler, with 5 min preincubation at 95°C followed by 35 cycles of 1 min at !YY’C, 1 min at 50°C (low stringency] or 60°C (high strineencvl. and 2 min at 72°C. with a final extension at 72°C ‘&r 10 min. The procluct was analysed by electrophoresis on 1.0 % agarose gel in TBE buffer (89 mM Tris, 89 mM boric acid, 2 mM ethylene diami-
PCR
Fig. 2. Specificity of the @OO-DNA sequence of Letihmaniu. Total genomic DNA (5 ng) of different species of Leishmania representative of both subgenera, Leishmania and Viannia, was subjected to PCR amplification of the @SO0 sequence using the oligonucleotide set AZ/Al0 as primers and 60°C as annealing temperature during 35 cycles. The PCR products were separated by electrophoresis in a 1.5% agarose gel and visualized by ethidium bromide staining (panel A). The gel was then Southern blotted and hybridized to the probe ‘*Pfi500 under medium stringency conditions (panel B). Lane 1, L. (Leishmania) mexicana M379; lane 2, L. (L.) amazonensis PH8; lane 3, L. (L.) mexicana BEL 21; lane 4, L. (Viannia) braziliensis M2903; lane 5, L. (V.) panamensis LS94; lane 6, L. (V.) guyanensis M4147; lane 7, pLgfi4-DNA (positive control); lane 8, no DNA (negative control). Expected product size, for species belonging to the subgenus Viannia, was 375 bp.
Fig. 3. The BSOO-DNA sequence in the subgenus Leishmaniu (Vianniu). Total genomic DNA (5 ng) of different species of Leishmania and Endonypanum was subjected to PCR amplifias described cation of the @SO0 sequence and electrophoresis for Fig. 2. Lane 1, L. (Vianniu) braziliensis M2903; lane 2; L. (V.) guyanensis M4147; lane 3, L. (V.) panamensis LS94; lane 4, L. (V.) lainsoni M6426; lane 5, L. (V.) equatoriensis Lspl; lane 6, L. (I’.) shawi M8408; lane 7, L. (V.) na$ M5533; lane 8, L. (V.) colombiensis CL500; lane 9, Endotypanum sp.; lane 10, L. (V.) guyanensis M4147; lane 1 lT L. (Leishmania) mexicana BEL 21. Lane 12, no DNA (negatwe control). Lane M contained the 1.0 kb DNA ‘ladder’ molecular size marker.
netetraacetic acid, pH 8.3). Samples were recorded as positive when a 375 bp PCR product could be detected. Results Identification subgenus
of a novel genomic
sequence
specific
to the
Leishmania (Viannia) strains Genomic DNA from different Leishmania representative of the subgenera Leishmania and Viannia was digested with the endonuclease PstI and a Southern blot transfer carried out using the fi-tubulin pLgfi4 clone as probe (Fig. 1A). Species of the subgenus Leishmania produced patterns which differed between species of ‘New World’ Leishmania, represented by L. mexicana BEL21 (lane 1) and L. amazonensis PH8C5 (lane 2), and ‘Old World’ Leishmania, such as L. donovani DD8 (lane 6) and L. infanturn LEM75 (lane 7), suggesting intra-subgeneric variation. Different patterns could also be distinguished among species of the subgenus Viannia, represented by L. braziliensis M2903 (lane 3), L. guyanensis M4147 (lane 4) and L. panamensis LS94 (lane 5). A common PstI fragment of c. 500 bp (0500) was present in all species of the subgenus Viannia. This sequence was subcloned from pLgfi4, as described in the Materials and Methods section, and the resulting pLgfl500 clone was used to determine similarly the presence and specificity of the sequence in natural isolates of Leishmania. As an example, we detected the presence of the 500 bp PstI band in the species of Leishmania previously characterized by isoenzyme analysis as L. guyanensis and L. naiffi (Fig. 1B) . The 500 bp DNA subgenus Viannia
sequence
as a molecular
marker
of the
The presence and specificity of the 8500 sequence in the genomic DNA of Leishmania was evaluated by PCR amplification and hybridization of the PCR products to the fi500 probe. The pLgfi500 clone was partially sequenced and a set of oligonucleotides was designed for use in a PCR assay. Genomic DNA of Leishmania strains representative of both subgenera was amplified at an annealing temperature of 60°C with the set of primers Alo/A2 (Fig. 2). Under these conditions, no signal was found in L. mexicana strain M379 (lane 1); however, some PCR products were detected in L. amazonensis PH8 (lane 2) and L. mexicana BEL21 (lane 3), both strains belonging to the subgenus Leish-
S1168
ALEXIS
7
8
9
1011
Fig. 5. Detection of Leishmaniu (Vianniu) species in clinical samples by the /3500-PCR assay. Crude DNA from biopsies obtained from patients with active cutaneous or mucocutaneous leishmaniasis lesions was prepared as described in the Material and Methods section and amplification of the BSOODNA sequence was carried out as described for Fig. 3. As an internal control of the PCR reaction, primers for amplification of an internal region of the coding sequence of the f3-tubulin gene which generate a PCR product of 900 bp were included. Lane 1, L. (Viannia) braziliensis M2903; lane 2, L. (L.) mexicana EEL 21; lane 3, L. (L.) amazonensis PH8; lane 4, L. (L.) donovani DD8; lane 5, L. (V.) guyanensis M4147; lane 6, no DNA (negative control); lanes 7 & 10, patients with mucosal lesions; lanes 8, 9 & 11, patients with cutaneous lesions. The molecular size marker (lane M and between lanes 6 and 7) was a 100 bp DNA ‘ladder’.
>
Fig. 4. Cross-homology of the Leishlnaniu PCR products to the b500-DNA sequence. Panel A. Total genomic DNA (5 ng) of different Leishmania species belonging to the subgenus V&&z was examined by PCR amplification of the B500 sequence as described for Fig. 3, but under low stringency conditions (50°C as annealing temperature). The PCR products were separated by electrophoresis through a 2.0% agarose gel and visualized by ethidium bromide staining. Panel A: lane 1, L. (Viannia) braziliensis M2903; lane 2; L. (V.) guyanensis M4 147; lane 3, L. (V.) panamensis LS94; lane 4, L. (V.) shawi M8408; lane 5, L. (V.) na$fi M5533; lane 6, L. (V.) lainsoni M6426; lane 7, L. (V.) colombiensis CL500; lane 8, L. (V.) equatoriensis Lspl; lane 9, no DNA (negative control). Panel B: a similar analysis was carried out using different species of Leishmaniu; after ethidium bromide staining (upper section), the gel was Southern blotted and hybridized to 32P-B500 under medium stringency conditions and washed as described under Materials and Methods (lower section); some species not belonging to the subgenus Viannia were included. Lane 1, L. (V.) bruziliensis M2903; lane 2, L. (V.) colombiensis CL500; lane 3, L. (V.) equatoriensis Lspl; lane 4, L. (Leishmania) mexicana BEL21; lane 5, Endotypanum sp.; lanes 6 & 7, L. her& lanes 8 & 9, L. deanei; lanes 10-12, L. herreti; lane 13, L. adleri; lane 14-17, Sauroleishmania. Lane 18, no DNA (negative control). The molecular size marker was a 100 bp DNA ‘ladder’.
mania. In contrast, was visualized
ETA.
MENDOZA-LEON
a unique
by ethidium
fragment
of about 375 bp
bromide staining in 3 different species of the subgenus Viannia-L. braziliensis (lane 4), L. panarnensis (lane 5) and L. guyanensis (lane
6). Also, the positive control, pLgp4, (lane 7) showed the same fragment. Southern transfer of the PCR products was carried out and the filter was hybridized to the 8500 probe. A positive signal was found in species of the subgenus I&nniu only, confirming the specificity of the sequence for this subgenus. In order to demonstrate the presence of the @OODNA sequence in the subgenus Viunniu, the same PCR assay under the conditions described above was evaluated with genomic DNA (5 ng) from 8 different species in this subgenus. As shown in Fig. 3, the PCR assay was positive with the WHO reference strains of L. bruziliensis M2903 (lane l), L. guyanensis M4147 (lanes 2 & lo), L. punurnensis LS94 (lane 3), L. Zuinsoni M6426 (lane 4), L. shuwi M8408 (lane 6) and L. naiffi’ M5533 (lane 7); all of them yielded products of the expected size range (375 bp). No PCR product was found when L. equatoriensis Lspl (lane 5) and L. colombiensis CL500 (lane 8) were used. Similar results were found when Lsp2, another strain of L. equatorknsis and E582.34, another strain of L. colombiensis, obtained from the Fiocruz reference bank (Rio de Janeiro, Brazil), were used (data not shown). These results suggest the absence of the p500-DNA sequence from these 2 species. Also, no product was obtained from genomic DNA of L. mexicana BEL 21 (lane 11) or the related kinetoplastid Endotypunum sp. (lane 9). These results suggest that the @OO-PCR assay can unambiguously identify Leishmunia parasites belonging to the subgenus Viannia. Thus, the J3500-DNA sequence can be considered a molecular marker of this subgenus. The subgeneric
status of L. colombiensis
and
L.
equatoriensis L. equutoriensis and L. colombiensis have been classified as members of the subgenus Viunniu (see I-UTZER et al., 1991; GRIMUDI et al., 1992). Since both species gave anomalous results in the (3500-PCR assay, we decided to perform the PCR amplification at low stringency (50°C) to evaluate by hybridization the cross-homology of the PCR products to the J3500 sequence. As shown in Fig. 4A, the PCR assay produced products in the expected size range (375 bp) for
MOLECULAR
MARKERS
FOR LEISHMANIA
(VIANNIA)
genomic DNA of L. bruziliensis M2903 (lane I), L. guyanensis M4147 (lane 2), L. panarnensis LS94 (lane 3), L. shawi M8408 (lane 4), L. naiffi M5533 (lane 5), and L. lainsoni M6426 (lane 6). L. colombiensis CL500 (lane 7) and L. equatoriensis Lspl (lane 8) gave similar oatterns which differed from those of the L. 0Gnnia) species, and none of the bands had the expected size of 375 bp. A similar experiment was performed in order to estimate the homology of these bands to the fi500DNA seauence, using L. braziliensis strain M2903 as a positive dontrol (Fig.“4B, lane 1). A distinct pattern of bands was obtained with strains of the subgenus Leishmania, different from that of the subgenus I&n&, after ethidium bromide staining. L. colombiensis (lane 2) and L. equatonmsis (lane 3) showed a pattern of multiple products of different sizes, the more-abundant uroduct being a 280 bn fragment. The similaritv of the PCR producy patterns beiween these 2 species was remarkable. Other species of the subgenus Leishmania were tested and all of them yielded different amplification products with an extensive size range; these species included L. mexicana (lane 4), L. hertigi (lanes 6 & 7), L. deanei (lanes 8 & 9), L. herrem’ (lanes lo-12), L. adleri (lane 13), and SauroZeishman& (lanes 14117). The related kinetowlastid Endotrvaanum SW. (lane 5)I was also included. Under conditions of low stringency, the @500-DNA probe cross-hybridized with only L. bruziliensis (Fig. 4, B, lane 1). No cross-hybridization was found with any other species of Leishmania used in this study. This finding suggests the absence of the BSOO-DNA sequence from the genome of L. colombiensis and L. equatoriensis. I
The PSOO-PCR
assay with
clinical
S1169
SW.
.
samples
In order to evaluate the B~oo-PCR assay as a diagnostic method, clinical samples obtained from patients with active cutaneous or mucocutaneous leishmaniasis were used (Fig. 5). As reported above, no @500-PCR product was generated when total genomic DNA from L. mexicana BEL 21 (lane 2), L. amazonensis PH8 (lane 3) or L. donovani DD8 (lane 4), all belonging to the subgenus Leishmaniu, was used in the amplification reaction. In contrast, genomic DNA from species of the subgenus Viunnia, such as L. braziliensis M2903 (lane 1) and L. guyanensis M4147 (lane 5), produced the expected 375 bp amplification product. All biopsies tested generated the characteristic amplification product expected for the subgenus Viunnia, and confirmed the presence of L. (V&u&) species in the clinical samples (lanes 7- 11). As an internal control of the PCR reaction. we used the amwlitication of an internal region of the’f3-tubulin gene, &hich generates a PCR product of 900 bp, which was present in all samples. Discussion The combination of different molecular techniques, e.g. RFLP and PCR amplification, and the evaluation of different molecular markers provides a valuable tool for the identification of Leishmania parasites at different levels. In this work, we have identified a novel sequence, the fi500-DNA sequence, in the genomic DNA of Leishmania. This sequence is located upstream of the (3-tubulin gene region, as previously demonstrated in the restriction man of a clone of the fi-tub&z gene region obtained from the nuclear DNA of L. 7V.j Puvanensis M4147 (see MENDOZA-LEON et al.. 1995). The sequence is specific to the subgenus Vi&&& shown by hybridization experiments: the @OO-DNA sequence is not present in the genomic DNA of species belonging to the subgenus Leishmaniu. Due to its high sensitivity, the PCR technique has advantages as a tool in the molecular diagnosis of the aetiological agents of different parasitic diseases in clinical samples. Thus, after partial sequencing of the 8500 sequence, we designed the set of primers AZ/A,,, to evaluate the specificity of the sequence by a PCR
assay. The PCR amplification reaction, under high stringency conditions,bf the 8500 sequence from genomic DNA of different Leishmaniu swecies rewresentative of both subgenera, generated a unique PCR product of c. 375 bp in those species belonging to the subgenus Viannia, in agreement with the specificity of the BSOODNA sequence previously demonstrated by Southern analysis. Furthermore, we demonstrated the amplification of this sequence in all species in the subgenus Viunna. Surprisingly, L. colombiensis and L. equatoriensis gave negative results; these species had previously been classified as members of the subgenus Viunnia (see KREUTZER
et al.,
1991;
GRIMALDI
et aZ., 1992).
When the PCR reaction was carried out at low stringency by decreasing the annealing temperature to 50°C we found a multiple-banded amplification pattern with L. colombiensis and L. equatoriensis. The similarity of both patterns was striking; these patterns were different from those found with the other Vianniu species. Also, when genomic DNA of Endotrypanum sp. and other enigmatic species of Leishmaniasuch as i. hertigi, L. deanei. L. herren’. L. adleri and Sauroleishmania, &as used for PCR am&ication at low stringency, a distinct pattern of bands, similar to that obtained by RAPD, was found; this pattern showed some similarities and some differences among the organisms tested. Hybridization analysis using the (3500-DNA sequence and the p500-PCR product as probes conclusively demonstrated that no cross-homology exists between these probes and the PCR products generated at low stringency from the genomic DNA of Endotypanum or from those of different Leishmaniu species of the subgenus Viunnia. Also, hybridization analysis using the 375 bp fragment as probe and restricted genomic DNA from all species of the subgenera Viannia and Leishmania and Endotypanum sp. confirmed the absence of this fragment from L. coZombiensis. L. eauatoriensis and Endotbpanum sp. (data not shown). =The lack of crosshybridization with the (3500-DNA sequence demonstrated the absence of related sequences from species of the subgenus Leishmaniu, enigmatic species of Leishmania, L. colombiensis, L. equaton’ensis, and Endotypanum sp. A similar situation was found with the kDNA of L. Zuinsoni and other species of the subgenus Viunniu. For example, recognition of the species of this subgenus based on the specific amplification of kDNA using the oligonucleotide set Bl /B2 failed with L. lainsoni at 67.5”C, while different products were observed at a lower stringency annealing temperature (60.5”C) (ERESH et al., 1995). Sequence comparison of the minicircle DNA demonstrated that L. Zuinsoni is more similar to members of the subgenus Viunnia than to the subgenus Leishmania (see MCCANN et al., 1999). Previous results using isoenzyme analysis suggested the inappropriate placement of L. equato*iensis in the subgenus Vianniu (see CUPOLILLO et aZ., 1995, 2000). Also, molecular data from PCR amplification of the mini-exon gene non-transcribed spacer, minicircle conserved region sequences, analysis of ITS of the rRNA (ribosomal ribonucleic acid) gene, and sialidase activity suggested a close relationship between L. colombiensis and L. equatoriensis and Endotypanum schaudinni
(see CUPOLILLO
et al.,
1998a).
Me
are con-
fident of the specificity of the BSOO-DNA sequence to the genus Leishmania; nevertheless, such specificity is restricted to species of the subgenus Viunnii (see DEBRUIIN & BARKER, 1992; ERESH et aZ., 1995: MCCANN et aZ., 1999). Further *experiments ‘are necessary to establish the real status of L. colombiensis and L. equatoriensis in the genus Leishmaniu; our results suggest that the inclusion of these organisms in the subgenus Viannia must be revised. Different amplification PCR assays using different Leishmaniu DNA targets have been established for the diagnosis of the leisrhmaniases (HARRIS et aZ., 1998; PIRMEZ et aZ., 1999). One of the aims of this study was
s1170
to evaluate the efficacy of parasite detection in clinical samples obtained from patients with active cutaneous or mucocutaneous leishmaniasis, usina a 8500-PCR assay. The results presented here’demonstra’te that the parasites may be detected in clinical samples with high efficiency and sensitivity. Moreover, positive samples which had not previously been diagnosed were reproducibly detected with this assay. We are confident of the specificity of this assay because, in combination with hybridization experiments, we have demonstrated the homology of the PCR product to the BSOO-DNA sequence. The mucosal form of the disease is difficult to diagnose due to the small number of parasites present in the lesion. Our results are promising for diagnosis based on clinical samples from mucosal lesions; we are evaluating this assay in order to establish the optimal conditions for its use as a routine diagnostic method. In conclusion, we have identified a novel genomic DNA sequence, which is specific to the genus Leishmania. It is restricted to species of the subgenus Viannia, among which this sequence is apparently highly conserved; the only exceptions were the reference strains of L. colombiensis and L. equatoriensis. Thus, the l3500 sequence can be considered as a molecular marker for the subgenus L. fiXanniaJ Since the value of the PCR reaction has been demonstrated in the diagnosis of leishmaniasis, evaluation of the use of this sequence in a PCR assay for epidemiological studies is in progress. Acknowledgements
We are most grateful to Dr A. Herrera (Instituto de Biologia Exoerimental. Universidad Central de Venezuela) for critical comments on the manuscript, to Marcos Cathano (Departamento de Bioquimica y Biologia Molecular, FIOCRUZ, Rio de Janeiro) for technical assistance, and Jorge Rivas (IVIC, Venezuela) for photographic assistance. This work received financial support from Venezuelan government grants CDCH 03.10.4126.98, CDCH 03.33. 3961.97 and CONICIT Sl-96001411 to A. M.-L.; L. L and L. G received training grants from Universidad de Las Naciones Unidas to visit the laboratories of 0. F. and A. M.-L., respectively. References Cathano, M. I’., Cuoolillo, E., Camnbeil. D. & Fernandes. 0. (1998). Leishmant’a colombiensis an‘d Lekhmania equatoriensis: peculiar Viannia species. Memdrias do Institute Oswaldo Crux, 93, supplement 11, 182. Cupolillo, E., Grimaldi, G., jr & Momen, H. (1995). Discrimination of Leishmania isolates using a limited set of enzvmatic loci. Annals of Tropical Medic&e and Parasitology, 89, 17-21.
Cupolillo, E., Noyes, H., Pereira, L. 0. R., Fernandes, O., Pereira, I., Medina-Acosta, E. & Grimaldi, G., ir (1998a). Genetic relationship and evolution of New’World Leishmk nia: suggestion of evolutive link with Endotrypanum. Memhrias do Instituto Oswald0 Crux, 93, supplement 11, 186. Cupolillo, E., Pereira, L. 0. R., Fernandes, O., Pereira, J., Medina-Acosta, E. & Grimaldi, G., jr (1998b). Genetic data showing evolutionary links between Leishmania and Endotypanum. Memdrias do Instituto Oswaldo Cruz, 93, 6777683. Cupolillo, E., Medina-Acosta, E., Noyes, H., Momen, H. & Grimaldi, G., jr (2000). A revised classification for Leishmania and Endotrypanum. Parasitology Today, 16, 142-144. De Bruijn, M. H. L. & Barker, D. C. (1992). Diagnosis of New World leishmaniasis: specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNA. Acta Tropica, 52, 45-58. Eresh, S., Mendoza-Leon, A. &Barker, D. C. (1993). A small chromosome of Leishmania (Viannia) braziliensis contains
ALEXIS
MENDOZA-LE6N
ITAL.
multicopy sequences which are complex specific. Acta Tropica, 55,33-46. Eresh, S., de Bruijn, M. H. L., Mendoza-Leon, J. A. & Barker, D. C. (1995). Leishmaniu (Viunnia) lainsoni occupies a unique niche within the subgenus Vianniu. Transactions of the Royal Society of Tropical Medicine and Hygiene, 89, 231-236. Grimaldi, G., jr, Kreutzer, R. D., Hashiguchi, Y., Gomez, E. A., Mimory, T. & Tesh, R. B. (1992). Description of Leishmania equatoriensis sp. n. (Kinetoplastida, Trypanosomatidae), a new parasite infecting arboreal mammals in Ecuador. Memdrias do Znstituto Oswaldo Cruz, 87, 221-228. Harris, E., Kropp, G., Belli, A., Rodriguez, B. & Agabian, N. (1998). Single-step multiplex PCR assay for characterization of New World Leishmania complexes. Journal of Clinical Microbiology, 36, 1989-1995. Katakura, K., Kawasu, S.-I., Naya, T., Nagakura, K., Ito, M., Aikawa, M., Qu, J.-Q., Guan, L.-I., Zuo, X.-P., Chai, J.-J., Chang, K.-P. & Matsumoto, Y. (1998). Diagnosis of kalaazar by nested PCR based on amplification of the Leishmania mini-exon gene. Journal of Clinical Microbiology, 36, 2173-2177. Kreutzer, R. D., Corredor, A., Grimaldi, G., jr, Grogl, M., Rowton, E. D., Young, D. G., Morales, A., McMahonPratt, D., Guzman, H. & Tesh, R. B. (19911. Characterization of Leishmania~colombiensis~sp. n. (Kinetoplastida: Trypanosomatidae), a new parasite infecting humans, animals and phlebotomine sand flies in Colombia and Panama. American Journal of Tropical Medicine and Hygiene, 44, 662-675. Lainson, R. & Shaw, J. J. (1987). Evolution, classification and geographical distribution. In: The Leishmaniases in Biology and Medicine, Peters, W. & Killick-Kendrick, R. (editors), vol. 1. Academic Press, London, pp. l-120. McCann, S. H. E., Eresh, S. & Barker, D. C. (1999). Kinetoplast minicircle DNA from Leishmania (Viannia) lainsoni. Parasitology, 118, 371-374. Mendoza-Leon, A. & Barker, D. C. (1996). Variation of a multigene family in New World Leishmaniu: the fi-tubulin gene region. In: Molecular and Immune Mechanisms in the Pathogenesis of Cutaneous Leishmaniasis, Tapia, F. J., Caceres-Dittmar, G. & Sanchez, M. A. (editors). Austin, Texas: R. G. Landes Bioscience Publishers, pp. 107-127. Mendoza-Leon, A., Havercroft, J. & Barker, D. C. (1995). The RFLP analysis of the l?-tubulin gene region in New World Leishmaniu. Parasitology, 111, l-9. Mendoza-Leon, A., Shaw, J. J. & Tapia, F. J. (1996). A guide for the cutaneous leishmaniasis connoisseur. In: Molecular and Immune Mechanisms in the Pathogenesis of Cutaneous Leishmaniasis, Tapia, F. J., Caceres-Dittmar, G. & Sanchez, M. A. (editors). Austin, Texas: R. G. Landes Bioscience Publishers, pp. l-23. Osman, 0. F., Kager, P. A., Zijlstra, E. E., El-Hassan, A. M. & Oskam, L. (1997). Use of PCR on lvmoh-node samnles as test of-cure’ of visceral leishmaniasis. Annals of Tro&al Medicine and Parasitology, 91, 845850. Pirmez, C., da Silva, T. V., Paes-Oliveira, N. M., da-Cruz, A. M., Goncalves da Costa, S. C., Catanho, M., Degrave, W. & Fernandes, 0. (1999). Use of PCR in diagnosis of human American tegumentary leishmaniasis in Rio de Janeiro, Brazil. Journal of Clinical Microbiology, 31,
1819-1823. Rodriguez, N., Guzman, B., Rodas, A., Takiff, H., Bloom, B. R. & Convit. 1. (1994). Diaanosis of cutaneous leishmaniasis and species ‘discriminatyon of parasites by PCR and hybridization. Journal of Clinical Microbiology, 32, 2246-2252. Santrich, C., Segura, I., Arias, A. L. & Saravia, N. (1990). Mucosal disease caused by Leishmania braziliensis guyanensis. American Journal of Tropical Medicine and Hygiene, 42, 51-55. Saravia, N. G., Holguin, A. F., McMahon-Pratt, D. & D’Alessandro, A. (1985). Mucocutaneous leishmaniasis in Colombia: Leishmania braziliensis subspecies diversity. American Journal of Tropical Medicine and Hygiene, 34, 7 144720.