Molecular structure of cyclomaltodextrinase derived from amylolytic lactic acid bacterium Enterococcus faecium K-1 and properties of recombinant enzymes expressed in Escherichia coli and Lactobacillus plantarum

G Model

ARTICLE IN PRESS

BIOMAC-8237; No. of Pages 8

International Journal of Biological Macromolecules xxx (2017) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac

Molecular structure of cyclomaltodextrinase derived from amylolytic lactic acid bacterium Enterococcus faecium K-1 and properties of recombinant enzymes expressed in Escherichia coli and Lactobacillus plantarum Kridsada Unban a , Apinun Kanpiengjai b , Saisamorn Lumyong c , Thu-Ha Nguyen d , Dietmar Haltrich d , Chartchai Khanongnuch a,e,∗ a

Division of Biotechnology, School of Agro-Industry, Faculty of Agro-Industry, Chiang Mai University, Chiang Mai 50100, Thailand Department of Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand c Microbiology Section, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand d Food Biotechnology Laboratory, Department of Food Science and Technology, BOKU – University of Natural Resources and Life Sciences, Vienna 1190, Austria e Material Science Research Center, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand b

a r t i c l e

i n f o

Article history: Received 8 August 2017 Received in revised form 14 September 2017 Accepted 17 September 2017 Available online xxx Keywords: Cyclomaltodextrinase Enterococcus faecium Enzyme properties Expression Cloning ALAB

a b s t r a c t Gene encoding cyclomaltodextrinase (Cdx) from amylolytic lactic acid bacterium Enterococcus faecium K-1 was cloned and nucleotide sequence was analyzed. The open-reading frame consisted of 1767 bp encoding 588 deduced amino acids. Consequently, four typically conserved regions of the glycoside hydrolase family 13 were revealed; however, nine exceeding amino acids (DSYQMTDVP) were found at the 282–290 position in comparison to previously reported cyclomaltodextrinases. This difference is believed to have an influence on the substrate specificity of this enzyme. The recombinant CDases expressed in Escherichia coli BL21 (CDX E) and Lactobacillus plantarum WCFS1 (CDX L) with high expression levels of 8041 and 5511 U/L were purified by Ni-NTA affinity chromatography. The active form CDX is a dimeric protein with two identical subunits of 62 kDa, approximately. Both CDX E and CDX L revealed nearly similar properties, but the thermostability of CDX L was slightly higher. Mn2+ and Co2+ at a concentration of 1 mM stimulated the enzyme activity, while the Ag+ , Cu2+ and SDS solution completely inhibited enzyme activity. CDX exhibited the highest activity with ␣-cyclodextrin and ␤-cyclodextrin, but lower toward pullulan and starch. Importantly, this is the first report describing genes, the molecular structure and properties of cyclomaltodextrinase derived from lactic acid bacteria E. faecium. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Cyclomaltodextrinase (CDase, EC 3.2.1.54) catalyzes the hydrolysis of cyclodextrins (CDs), which is a closed-ring structure consisting of 6-, 7- or 8-d-glucose residues linked through ␣-(1,4)linkages. It is an enzyme that belongs to the glycoside hydrolase family 13 (GH13), along with neopullulanase (NPase, EC 3.2.1.135) and maltogenic amylase (MAase, EC 3.2.1.133) [1]. Members of this family are capable of hydrolyzing at least two of three types of starchy substrates including cyclodextrins, pullulan and starch, which are distinguished from a typical ␣-amylase [2]. The CDase is also able to attack other related substrates, such as starch and pul-

∗ Corresponding author. E-mail addresses: [email protected], ck [email protected] (C. Khanongnuch).

lulan, but the most specific to CDs rather than others [3]. Among the differences in substrate specificity, the primary structure of these enzymes shares approximately 40–60% amino acid sequence identity [2]. According to the substrate specificity of CDase on amylose and amylopectin, CDase has been suggested to apply in food and pharmaceutical industries particularly the production of amylose-free or amylose-varied starch. The ratio of amylose to amylopectin in rice starch mainly influences the taste of cooked rice. Additionally, low-amylose rice, 5–15% of amylose, is suitable for frozen cooked rice [4]. In addition, Auh et al. [5] reported that the CDase treatment significantly retarded the retrogradation of cooked rice, since a substantial amount of amylose was degraded by the action of the enzyme. Many CDases have been isolated from various types of bacteria, including Bacillus coagulans [6], Clostridium thermohydrosulfuricum 39E [7], Bacillus sphaericus [8], Bacillus sp. I-5 [9], Alicyclobacillus acidocaldarius [10], Thermococcus

http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060 0141-8130/© 2017 Elsevier B.V. All rights reserved.

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model

ARTICLE IN PRESS

BIOMAC-8237; No. of Pages 8

K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

2

sp. B1001 [11], Flavobacterium sp. 92 [12], Paenibacillus sp. A11 [13] and Anoxybacillus flavithermus [1]. The CDase gene from Clostridium thermohydrosulfuricum 39E was firstly cloned and characterized [7] and then genes from other sources were also studied subsequently [3,8,9,13–15]. However, at present, there is no published information available on CDase activity derived from Enterococcus sp.. Recently, we have isolated an amylolytic lactic acid bacterium (ALAB), Enterococcus faecium K-1, capable of starch-degrading enzyme production during cultivation in MRS broth using starch as a sole carbon source. Regarding the main purpose of this bacterial isolation was to achieve for L-lactic acid production directly from starch, ␣-amylase, the main starch-degrading enzyme in the extracellular fraction was purified and characterized [16]. Beside the activity of ␣-amylase, other starch degrading enzymes, such as pullulanase and cyclodextrin-degrading activities, were also found from crude intracellular fraction prepared from the biomass of E. faecium K-1 cultivated at 37 ◦ C in MRS broth containing 1% (w/v) starch as a sole carbon source. Understanding the overall starch utilizing enzyme system of E. faecium K-1 would be very helpful for the improvement of the L-lactic producing capability of this bacterium, especially when starch or starch related substrates are used as substrate. To our knowledge, there has been no published report describing either enzyme activity or an analysis of the CDase gene from Enterococcus sp.. This study reports on the cloning, expression and purification of intracellular cyclomaltodextrinase (CDX) derived from E. faecium K-1. The differences in the primary structure of the CDX protein have been determined and described. In addition, we have also attempted to study the possibility for the overexpression of the Cdx gene in Lactobacillus plantarum WCFS1 using pSIP-based expression vector, which is of significant interest to those involving in the food, biotechnology, pharmaceutical and starch industries [17]. 2. Materials and methods 2.1. Bacterial strains and culture conditions An amylolytic lactic acid bacterium E. faecium K-1 isolated from starchy waste [16] was used as a source of genomic DNA. The bacterial stock culture was maintained in MRS broth containing 15% (v/v) glycerol at −80 ◦ C and transferred to fresh MRS broth before being used. All bacterial strains used in this study are presented in Table 1. Escherichia coli strains were cultivated in Luria-Bertani (LB) broth at 37 ◦ C with 200 rpm agitation, while Lactobacillus plantarum WCFS1 [18] was cultivated in MRS broth without agitation at 37 ◦ C. The appropriate antibiotics (100 ␮g/mL ampicillin or 50 ␮g/mL erythromycin) were used to maintain the plasmids for E. coli, whereas, 5 ␮g/mL of erythromycin was used for Lactobacillus plantarum.

Ontario, Canada). Two oligonucleotide primers for PCR amplification were designed based on the predicted gene encoding amylase (AmyE) of E. faecium Aus0004 (GenBank accession no. CP003351). The forward primer (AmyF, 5 GACGCACCATGGATACAGCTGCAATTTATC 3 ) and the reverse primer (AmyR, 5 AGTAGTCTCGAGTGAACACATGATCAAAAATCCG 3 ) contained NcoI and XhoI restriction sites (underlined), respectively. The gene expected to be amylase encoding gene was amplified by PCR using E. faecium K-1 genomic DNA as a template. Amplification was carried out using Phusion High-Fidelity DNA polymerase: initial denaturation at 98 ◦ C for 3 min, followed by 35 cycles of denaturation at 98 ◦ C for 30 s, annealing at 60 ◦ C for 30 s and extension at 72 ◦ C for 1.5 min with an additional extension at 72 ◦ C for 5 min in the final cycle. The 1.8 kb amplified PCR product was purified and ligated into pJET1.2/blunt plasmid (CloneJET PCR cloning kit, Thermo Scientific Inc.) according to the manufacturer’s instructions. The resulting plasmid pJET-CDX containing the inserted 1.8 kb fragment was confirmed by nucleotide sequencing.

2.4. Nucleotide sequence analysis The nucleotide sequencing was performed by a commercial sequencing service (LGC Genomics, Germany). The analysis of the nucleotide sequence and similarity comparisons were performed using the nucleotide BLAST and protein BLAST programs from the National Center for Biotechnology Information (NCBI) server (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The comparison of the Cdx gene from E. faecium K-1 with homologous proteins was carried out using the program ClustalW [19]. The structural features of the CDases derived from E. faecium K-1and Bacillus sp. I-5 were modeled by the Phyre2 web portal based on the 1EA9 of B. subtillis I-5. The resulting models were prepared with PyMOL software Version 1.7.4.5 (PyMOL Molecular Graphic System, Schrodinger, LLC).

2.5. Construction of recombinant plasmids The DNA fragment of the Cdx gene was excised from the pJET-CDX plasmid using NcoI and XhoI restriction enzymes and ligated into the NcoI-XhoI site of E. coli expression plasmid under T7 promoter (pET21d) and L. plantarum WCFS1 expression plasmid (pSIP409) [20], resulting in the plasmids pCDX E and pCDX L (Table 1), respectively. The constructed plasmid pCDX E was transformed into competent cells of E. coli BL21 (DE3) using the heat shock method [21], while the plasmid pCDX L was transformed into L. plantarum WCFS1 competent cells by electroporation (1.5 kV, 25 ␮F, 400 ) according to the protocol described by Aukrust and Blom [22].

2.2. Chemicals and enzymes All chemicals used in the experiment were of reagent grade and purchased from Sigma (St. Louis, MO, USA) unless otherwise stated and were of the highest quality available. MRS broth powder was purchased from Merck (Darmstadt, Germany). All restriction enzymes and T4 DNA ligase were purchased from Fermentus (Vilnius, Lithuania). Phusion High-Fidelity DNA polymerase was purchased from New England Biolabs (Beverly, MA, USA). Isopropyl-␤-d-thiogalactopyranoside (IPTG) was purchased from Roth (Karlsruhe, Germany). 2.3. Cloning of cyclomaltodextrinase gene from E. faecium K-1 The genomic DNA of E. faecium K-1 was extracted using a commercial Genomic DNA Isolation Kit (Norgen Biotek,

2.6. Heterologous expression of recombinant Cdx gene in E. coli Recombinant E. coli BL21 (DE3) harboring the expression plasmid pCDX E was grown in LB broth containing 100 ␮g/mL ampicillin at 37 ◦ C overnight. The overnight culture was transferred into 1 L of LB broth containing 100 ␮g/mL ampicillin and cultivated at 37 ◦ C with shaking at 180 rpm until the OD600 reached 0.8. The recombinant cell culture was then induced by adding 0.1 mM IPTG and further incubated at 25 ◦ C for 18 h. Subsequently, the induced cells were harvested and washed twice with 50 mM sodium-phosphate buffer at a pH value of 6.5. Then, harvested cells were disrupted using a French press at 100 MPa (AMINCO, MD, USA). Cell debris was removed by centrifugation at 25,000g at 4 ◦ C for 30 min to obtain the crude extract.

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model

ARTICLE IN PRESS

BIOMAC-8237; No. of Pages 8

K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

3

Table 1 Strains and plasmids used for cloning and expression of the Cdx gene from E. faecium K-1. Strains and plasmids Strains E. faecium K-1 E. coli NEB5␣ E. coli BL21 (DE3) L. plantarum WCFS1 Plasmids pJET1.2/blunt pET21d pSIP409 pCDX E pCDX L

Relevant characteristics and purpose

Reference

wild type, original source of Cdx cloning host host strain for heterologous expression host strain for heterologous expression

[16] New England Biolabs Invitrogen [18]

for subcloning and PCR fragment synthesis T7 promoter expression vector, Ampr spp-based expression vector, pSIP401 derivative, Emr , gusA controlled by PsppQ pET21d derivative, containing Cdx carrying C-terminal His6 -tag pSIP409 derivative, gusA replaced by Cdx carrying C-terminal His6 -tag

Thermo Scientific Inc. Novagen [20] this study this study

2.7. Heterologous expression of recombinant Cdx gene in L. plantarum An overnight culture of L. plantarum WCFS1 harboring the expression plasmid pCDX L was transferred to 1 L of MRS broth containing 5 ␮g/mL of erythromycin to an OD600 of 0.1 and incubated at 30 ◦ C without agitation. The cells were induced at an OD600 of 0.3 by adding 25 ng/mL of the inducing peptide pheromone IP-673 (supplied by the Molecular Biology Unit, University of Newcastleupon-Tyne, UK). Cells were harvested at an OD600 of 1.8–2.0, washed twice with 50 mM of sodium-phosphate buffer at a pH of 6.5 and disrupted by using a French press at 100 MPa (AMINCO, MD, USA). Cell debris was removed by centrifugation at 25,000g at 4 ◦ C for 30 min and the supernatant obtained was use as crude extract for further experimentation.

2.10. Molecular weight determination The molecular weight of the purified enzyme was estimated by SDS-PAGE on a 10% polyacrylamide gel. Protein bands were visualized by Bio-Safe Coomassie (BioRad, Hercules, USA). The precision Plus ProteinTM standard (BioRad) was used as protein molecular markers. Native molecular weight was estimated by gel filtration using Superdex 200 column (1.0 × 30 cm, GE healthcare, UK). The column was equilibrated with 10 mM of phosphate buffer at a pH value of 6.5 supplemented with 100 mM sodium chloride at a flow rate of 0.5 mL/min. The gel filtration calibration kit high molecular weight (GE healthcare, UK) containing a mixture of Ovalbumin (44 kDa), Conalbumin (75 kDa), Aldolase (158 kDa), Ferritin (440 kDa), and Thyroglobulin (669 kDa) was used as the molecular mass standard.

2.8. Purification of recombinant CDX 2.11. Enzyme properties and kinetic parameter determination The purification of the recombinant CDX derived from E. coli BL21 (DE3) and L. plantarum WCFS1 were performed using Ni-NTA column (Qiagen, Germany). The crude extract was loaded into a 5-mL nickel-nitrilotriacetic acid column that was pre-equilibrated with buffer A (50 mM sodium-phosphate, pH 6.5, 0.3 M NaCl and 20 mM imidazole). The protein was eluted at a rate of 1.5 mL/min with a linear gradient from 0 to 100% buffer B (50 mM sodiumphosphate, pH 6.5, 0.3 M NaCl and 250 mM imidazole). Active fractions were pooled, desalted and concentrated by membrane ultrafiltration with a 10-kDa molecular weight cutoff (Amicon, MA, USA). The purified enzyme was stored in 50 mM of sodium phosphate buffer at a pH value of 6.5 at 4 ◦ C until being used. The purified enzyme expressed from E. coli and L. plantarum were named CDX E and CDX L, respectively.

2.9. Enzyme activity assay and protein determination CDX activity was determined using ␣-cyclodextrin as a substrate. The reaction mixture comprised of 50 ␮L of suitably diluted enzyme and 50 ␮L of 1% (w/v) ␣-cyclodextrin in 100 mM sodiumphosphate buffer pH 6.5 was incubated at 37 ◦ C for 10 min using an Eppendorf (Hamburg, Germany) thermomixer compact with an agitation rate at 900 rpm. After the incubation period, the reaction was stopped by the addition of 100 ␮L of dinitrosalicylic (DNS) acid. It was then boiled for 10 min and 800 ␮L of distilled water was added. The release of reducing sugar was assessed through the determination of the absorbance at 540 nm. One unit of CDX activity was defined as the amount of enzyme that released 1 ␮mole of reducing sugar per minute under the assay conditions. The protein concentration was determined by the Bradford method using a commercial kit (Protein assay system kit 600-0005, BioRad) using bovine serum albumin (BSA) as a standard protein.

The optimum pH of the CDX E and CDX L activities were determined at 37 ◦ C using a reaction mixture of 1% (w/v) ␣-cyclodextrin and the appropriately diluted enzyme solution prepared in 100 mM of Britton-Robinson buffer at pH values in a range of 3.0-11.0. In order to determine the pH stability of CDX activity, the reaction mixtures were incubated at pH values in a range of 3.0-11.0 at 4 ◦ C for 24 h and the residual CDX activity was determined under the standard assay conditions. The effect of temperature on the enzyme activity was determined by performing the enzyme assay at different temperatures in a range of 20–60 ◦ C in 100 mM of sodiumphosphate buffer, pH 6.5. Thermal stability was investigated by incubating the diluted enzyme for 1 h at various temperatures in a range of 20–60 ◦ C in 100 mM sodium-phosphate buffer, pH 6.5 followed by cooling the solution on ice. The residual CDX activity was determined under standard assay conditions. The effect of metal ions and reagents on CDX E and CDX L was determined by preincubation of the purified enzyme in the presence of KCl, NaCl, LiCl, AgNO3 , NiCl2 , CoCl2 , MgCl2 , CuSO4 , BaCl2 , MnCl2 , CaCl2 , Pb(NO3 )2 , FeCl3 , AlCl3 , EDTA and SDS at final concentrations of 1 mM at 25 ◦ C for 1 h, then, the enzyme activity was determined and the relative activity of enzyme was calculated using the reaction without metal ion as control. The Michaelis-Menten constant (Km ) and the maximum reaction velocity (vmax ) of CDX E and CDX L were determined for various substrates including ␣-cyclodextrin, ␤-cyclodextrin and pullulan. The enzyme activity was determined under standard assay conditions using substrates at concentrations in a range of 0.5–250 g/L. The non-linear regression analysis of the data was performed using the software program SigmaPlot version 12.0 (Systat Software Inc., San Jose, CA, USA) to calculate the Km and vmax values. The kcat value was defined as vmax /[E] where [E] represented the enzyme concentration (␮mol/mL) that was used.

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model BIOMAC-8237; No. of Pages 8

ARTICLE IN PRESS K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

4

2.12. Substrate specificity and hydrolysis products Substrate specificity of CDX E and CDX L was examined by measuring the enzyme activity under standard assay conditions using various substrates including ␣-cyclodextrin, ␤-cyclodextrin, pullulan, soluble starch, amylose, amylopectin and glycogen. Analysis of the hydrolysis products of CDX E and CDX L on various substrates was performed by incubating 1 U of purified enzyme with 1.0% (w/v) of ␣-cyclodextrin, ␤-cyclodextrin, pullulan, panose, maltose, maltotriose, maltotetraose, maltopentaose and maltohexaose in Na-phosphate buffer, at a pH value of 6.5 at 37 ◦ C for 6 h. The reaction processes were then stopped by boiling the solutions for 10 min. The reaction mixtures were spotted onto a silica gel plate (Merck TLC silica gel 60, Damstadt, Germany) and developed twice in a mobile phase system containing n-butanol:ethanol:water (5:3:2, v/v/v). The plate was then sprayed with 0.5% (w/v) of thymol in 5% (v/v) of a sulfuric acid solution in ethanol and heated at 105 ◦ C for 5 min in order to visualize the sugars.

3. Results and discussion 3.1. Cloning of Cdx gene from E. faecium K-1 and nucleotide sequence analysis The Cdx gene (GenBank accession number MF141078) acquired from E. faecium K-1 consisted of 1767 nucleotides encoding 588 amino acid residues with TGA termination codon and possessed a calculated molecular mass of 69.4 kDa. No predicted signal peptide was found in the open-reading frame encoding the enzyme, indicating an intracellular location in the original host. The nucleotide sequence of Cdx gene showed the highest identity (98%) with the NPase gene from E. faecium T110 (CP006030), and showed 90% identity with the NPase gene of E. faeicum NRRL B-2354 (CP0040630) and E. faecium DO (NC 017960), and 90% with ␣amylase gene of E. faecium Aus0004 (CP003351). The amino acid sequence analysis of CDX also found four conserved regions (Fig. 1) which were the typical conserved regions of the CD-hydrolyzing enzymes GH13 family, including CDase, MAase and NPase [23]. The catalytic residues Asp340, Glu369 and Asp446 are also presented. Additionally, the conserved region (WLQGDEFHAVMNYAF) which was proposed to be the CD-binding site is presented in the CDX located between the classical conserved regions III and IV [2]. These results confirm that CDX acquired from E. faecium K-1 belongs to the GH13 family of CD-hydrolyzing enzymes. In comparison of the putative amino acid sequence of CDX from E. faecium K-1 to those of other enzymes in the GH13 family, CDX showed 53% identity with MAase of Bacillus subtilis [24], 49% with NPase of Geobacillus stearothermophilus [25], 49% with MAase of Bacillus sp. US149 [26], 48% with MAase of Thermus sp. [27], and 44% with CDase of Thermoanaerobacter ethanolicus 39E [7]. However, considering the putative amino acid sequence alignment presented in Fig. 1, CDX acquired from E. faecium K-1 shows nine exceeding amino acids (DSYQMTDVP) at the position of 282–290, which is remarkably different from other CDases that have been previously reported. The 3D structure of E. faecium K-1 was constructed and is presented in Fig. 2A in comparison to that of Bacillus sp. I-5 [9], the representative of the previously reported CDase (Fig. 2B). The 3D structure of both showed a degree of similarity and confirmed the overall general structure of CDase including C-domain, N-domain, (␤/␣)8 Barrel and domain B-domain as described by Fritzsche et al. [12]; however, the part of exceeding DSYQMTDVP peptide located in the B-domain (presented in red color in Fig. 2B) significantly showed a conformational difference within the B-domain which is reported to be responsible for the substrate specificity of the enzyme [28]. This difference in

Fig. 1. Amino acid sequence alignment of cyclomaltodextrinase; CDX, E. faecium K-1 (accession number MF141078), CD1; Thermoanaerobacter ethanolicus 39E (P29964), CD2; Bacillus sphaericus E-244 (Q08341), CD3; Bacillus sp. I-5 (Q59226); CD4, Anoxybacillus flavithermus (AAX29991.1), CD5, Paenibacillus sp. A11 (AAO47386.1). The four conserved regions commonly found among enzymes in the glycoside hydrolase family 13 of the ␣-amylase family (I–IV) and the CD-binding site conserved regions boxed. The catalytic residues Asp340, Glu369 and Asp436 are presented in a black and white background and the nine exceeding amino acid are shown shaded in grey.

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model

ARTICLE IN PRESS

BIOMAC-8237; No. of Pages 8

K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

5

Fig. 2. The 3D structure of CDase derived from E. faecium K-1 (A) and Bacillus sp. I-5 (B).

Table 2 CDX activity in the cell-free extracts of E. faecium K-1 and recombinants. Organism

Enzyme activity (U/L of culture)

Specific activity (U/mg of protein)

E. faecium K-1 (wild type) E. coli BL21 (DE3) + pCDX E L. plantarum WCFS1 + pCDX L

28.7 ± 0.6 8040.8 ± 139.0 5510.7 ± 282.0

1.76 ± 0.2 23.7 ± 1.3 17.0 ± 0.9

the B-domain is highly suspected of influencing the property of the enzyme aspect in terms of substrate specificity. 3.2. Gene expression and purification of recombinant CDX in E. coli and L. plantarum The recombinant enzymes were successfully produced in both E. coli BL21 (DE3) and L. plantarum WCFS1 with the higher level being compared to the CDX activity in the wild type (Table 2). The intracellular CDX activity produced by the recombinant E. coli was approximately 8041 U/L of the fermentation broth with a level of specific activity of 23.7 U/mg of protein. Meanwhile, CDX activity produced by recombinant L. plantarum was 5511 U/L of the fermentation broth with a specific activity of 17.0 U/mg of protein. However, the extracellular CDX activities were not found in the culture supernatants either of E. coli BL21 (DE3) or L. plantarum WCFS1. The recombinant enzymes from both hosts were successfully purified with a single-step purification protocol using the Ni-NTA column. The recombinant CDX E expressed in E. coli was purified with 26.1% recovery with the specific activity of 9.38 U/mg of protein. Whereas, CDX L expressed in L. plantarum was also purified with a higher level of recovery at 43.4% with 10.64 U/mg of protein. Both recombinant purified enzymes showed an identical size of approximately 62 kDa on the SDS-PAGE (Fig. 3). However, gel filtration on the Superdex 200 column of the native CDX showed the molecular mass of the recombinant CDX at 130 kDa, approximately, this indicates the native form of CDX from E. faecium K-1 is a dimeric protein comprised of two identical subunits. This conclusion corresponded with most of the previously reported studies on cyclodextrin degrading enzymes including CDases derived from B. sphaericus E-244, B. stearothermophilus K-12481, Alkalophilic Bacil-

Table 3 Effects of various metal ions and reagents at a concentration of 1 mM on the enzyme activities of recombinant CDX expressed from E. coli BL21 (DE3) (CDX E) and L. plantarum WCFS1 (CDX L). Ion/Reagent

Control KCl NaCl LiCl AgNO3 NiCl2 CoCl2 MgCl2 CuSO4 BaCl2 MnCl2 CaCl2 Pb(NO3 )2 FeCl3 AlCl3 EDTA SDS

Relative activity (%) CDX E

CDX L

100.0 101.8 ± 0.6 114.1 ± 0.7 97.3 ± 0.2 0 67.1 ± 2.2 126.5 ± 1.7 90.3 ± 6.1 0 100.9 ± 0.7 137.1 ± 0.2 103.1 ± 4.4 110.2 ± 0.8 119.0 ± 3.5 102.7 ± 0.4 77.9 ± 0.3 0

100.0 99.9 ± 5.7 102.3 ± 1.9 91.5 ± 1.1 0 71.4 ± 3.1 129.4 ± 6.2 92.4 ± 2.7 0 103.7 ± 5.7 134.7 ± 3.5 90.8 ± 2.2 101.2 ± 0.5 114.1 ± 0.1 100.6 ± 0.7 63.1 ± 2.3 0

lus sp. and B. subtilis SUH4-2, all of which were found to be dimeric proteins [2]. 3.3. Biochemical characteristics and kinetic analysis of enzymes The effects of pH on enzyme activity were determined for recombinant CDX obtained from both bacterial hosts. Both CDX E and CDX L revealed almost similar properties. The optimal pH value for enzyme activity was found to be pH 6.0 (Fig. 4A) and enzyme activity was most stable over a wide range of pH ranging from pH 5.0–9.5 at 4 ◦ C for 24 h, retaining 80–100% of its initial activity (Fig. 4B). Both CDX E and CDX L showed an optimal temperature at 50 ◦ C, but only CDX L retained above 80% of the maximum activity after being incubated at a temperature of 50 ◦ C for 1 h, while the thermostability of CDX E was slightly lower under the same conditions (Fig. 4C and 4D). However, CDX E is completely inactivated at 60 ◦ C, while CDX L retained approximately 37% relative activity under the same conditions and temperatures. Several CDases had optimum temperatures in a range of 35–65 ◦ C [6,7,9,29–31]. The

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model BIOMAC-8237; No. of Pages 8 6

ARTICLE IN PRESS K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

Fig. 3. SDS-PAGE of purified recombinant CDX expressed from E. coli BL21 (DE3) (A) and L. plantarum WCFS1 (B); Lane 1, molecular weight marker; Lane 2, crude supernatant; Lane 3, purified enzyme.

Fig. 4. pH optimum (A), pH stability (B), temperature optimum (C) and thermostability of recombinant CDX expressed from E. coli BL21 (DE3) (CDX E) and L. plantarum WCFS1 (CDX L).

effect of various metal ions, EDTA and SDS on both CDX E and CDX L are shown in Table 3. CDX activity was activated by Mn2+ and Co2+ , while some of the metal ions such as Ca2+ , Al3+ , Mg2+ , Pb2+ , K+ , Na+ , Li+ , Ba+ displayed minor effects on the enzyme activity. EDTA and Ni2+ reduced the activity by 63 and 71%, respectively, whereas Ag+ , Cu2+ and SDS completely inhibited the activity of both CDX E and CDX L. The complete deactivation when exposed to the 1 mM SDS solution supported the dimeric structural property of CDX obtained from E. faecium K-1.

The Km and vmax values of the recombinant enzymes were analyzed using ␣-cyclodextrin, ␤-cyclodextrin and pullulan as substrates by varying their concentration value (Table 4). Enzyme kinetic parameters were calculated using the Lineweaver-Burk plot of the Michaelis-Menten equations. The kinetic analysis showed that both recombinant enzymes have a higher affinity for ␤cyclodextrin than ␣-cyclodextrin and pullulan, as indicated by the lower Km value obtained with ␤-cyclodextrin. However, the most important parameter influences on the catalysis efficiency is kcat

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model

ARTICLE IN PRESS

BIOMAC-8237; No. of Pages 8

K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

7

Table 4 Comparison of kinetic parameters of the purified recombinant CDX expressed in E. coli BL21 (DE3) (CDX E) and L. plantarum WCFS1 (CDX L). kcat (s−1 )

vmax (U/mg min)

kcat /Km (mg/mL s)−1

Substrate

Km (mg/mL) CDX E

CDX L

CDX E

CDX L

CDX E

CDX L

CDX E

CDX L

␣-Cyclodextrin ␤-Cyclodextrin Pullulan

5.2 ± 0.1 4.6 ± 0.2 58.2 ± 2.3

5.1 ± 0.3 4.6 ± 0.1 47.2 ± 2.7

512.7 ± 24.0 336.9 ± 31.0 268.8 ± 11.0

505.4 ± 19.0 346.4 ± 47.0 218.6 ± 29.0

535.8 ± 18.0 352.1 ± 15.0 280.9 ± 24.0

528.1 ± 31.0 362.0 ± 21.0 228.4 ± 17.0

104.6 ± 16.0 75.9 ± 0.3 4.7 ± 0.2

104.4 ± 8.0 77.7 ± 1.5 4.8 ± 0.5

Fig. 5. Thin layer chromatography (TLC) of the hydrolysis products from pullulan, ␣-cyclodextrin and ␤-cyclodextrin (A) and panose, maltose, maltotriose, maltotetraose, maltopentose and maltohexaose (B) by recombinant CDX from L. plantarum WCFS1 with a substrate concentration of 1 g/L at 37 ◦ C for 6 h: (A) Lane 1, 6, standards oligosacharide (glucose [G1], maltose [G2], maltotriose [G3], maltotetraose [G4], maltopentaose[G5], and maltohexaose [G6]); Lane 2, standard panose; Lane 3, pullulan; Lane 4, ␣-cyclodextrin; Lane5, ␤-cyclodextrin. (B) Lane 1, 9, standard oligosaccharide; Lane 2, standard panose; Lane 3, panose; Lane 4, maltose; Lane 5, maltotriose; Lane 6, maltotetraose; Lane7, maltopentaose; Lane 8, maltohexaose. Table 5 Substrate specificity of the purified recombinant CDX expressed in E. coli BL21 (DE3) (CDX E) and L. plantarum WCFS1 (CDX L). Substrate

␣-Cyclodextrin ␤-Cyclodextrin Pullulan Soluble starch Amylose Amylopectin Glycogen

Relative activity (%) CDX E

CDX L

100.0 86.7 ± 2.3 7.6 ± 0.5 3.4 ± 0.2 0.5 ± 0.1 0 0

100.0 87.6 ± 1.1 6.5 ± 0.2 2.9 ± 0.8 0.7 ± 0.1 0 0

and the value of kcat /Km is normally used to predict the catalysis efficacy of the enzyme [32]. Regarding the value of kcat /Km presented in Table 4, the higher value of kcat /Km found with ␣-cyclodextrin indicates that the recombinant enzymes are able to hydrolyze ␣cyclodextrin more efficient than ␤-cyclodextrin and pullulan. 3.4. Substrate specificity and hydrolysis products The purified recombinant CDX expressed from both E. coli and L. plantarum showed their highest degree of activity on ␣cyclodextrin and ␤-cyclodextrin in comparison to pullulan. No activity was detected on glycogen and amylopectin (Table 5). It was suggested that the enzymes could not attack the ␣-1,6 glycosidic linkage. These results also indicate that the recombinant CDX was more highly specific with ␣-cyclodextrin and ␤-cyclodextrin when compared with pullulan (by about 12–14 times) unlike other NPases which a high specific activity was normally found on pullulan [30,33]. The highest degree of substrate specificity of the recombinant enzymes on CDs was similar to the relative hydrolysis

Table 6 Comparison of substrate specificity of cyclomaltodextrinase from E. faecium K-1 carrying nine exceeding amino acids (DSYQMTDVP) to other previously reported CDases derived from various microorganisms. Organism

Substrate specificity

Reference

E. faecium K-1 Thermoanaerobacter ethanolicus 39E Bacillus sphaericus E-244 Bacillus sp. I-5 Anoxybacillus flavithermus Paenibacillus sp. A11

␣-CD > ␤-CD » PL > SS ␣-CD > ␤-CD » SS ∼ = PL ␤-CD > ␣-CD » SS > PL ␤-CD > ␣-CD » SS > PL ␣-CD > ␤-CD » SS > PL ␤-CD > ␣-CD » SS > PL

This study [7] [34] [9] [1] [13]

CD, cyclodextrin; PL, pullulan; SS, Soluble starch.

activities of CDases from Paenibacillus sp. A11 [13], B. sphaericus ATCC7055 [29] and Clostridium thermohydrosulfuicum 39E [7]. These findings can confirm the inclusion of CDX acquired from E. faecium K-1 in the CDase group. However, the E. faecium K-1 CDX in this experiment showed a higher degree of substrate specificity on pullulan in comparison to starch which is different from the substrate specificity of other previously reported CDases (Table 6). The differences in higher degrees of specificity with regard to pullulan than to the starch substrate corresponded to the change of the secondary structure in the B-domain caused by the nine exceeding amino acids of CDX that were mentioned previously. Our results support and confirm the 3D structure and molecular characterization of CDase derived from Flavobacterium sp. no. 92, particularly with regard to the functional property of the B-domain as described by Fritzsche et al. [12]. Product formation after the hydrolysis of a recombinant enzyme against various starch related substrates, including ␣-cyclodextrin, ␤-cyclodextrin, pullulan and oligosaccharides, was analyzed by TLC and the result is presented in Fig. 5. The major hydrolysis prod-

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060

G Model BIOMAC-8237; No. of Pages 8

ARTICLE IN PRESS K. Unban et al. / International Journal of Biological Macromolecules xxx (2017) xxx–xxx

8

uct of pullulan hydrolyzed by recombinant CDX was panose with the minority of the glucose and maltose corresponding to a typical hydrolysis product of CDases [2]. Moreover, CDX hydrolyzed ␣-cyclodextrin and ␤-cyclodextrin to mainly maltose and glucose as the minority product (Fig. 5A), whereas G3 and G5 were also completely hydrolyzed to maltose and glucose (Fig. 5B). Moreover, G4 and G6 were also completely hydrolyzed but only to maltose. The results of the hydrolysis product analysis were supportive of the conclusion that CDX acquired from E. faecium K-1 should belong to the CDase type enzyme.

[10]

[11]

[12]

4. Conclusions

[13]

Gene encoding CDase enzyme (Cdx) from amylolytic lactic acid bacterium, E. faecium K-1 was cloned, expressed and biochemically characterized. The E. faecium K-1 CDX was confirmed to be a member of the glycoside hydrolase family GH 13, but it was different from other previously reported CDase by nine exceeding amino acids located in the B-domain leads to the differences in the secondary structure and functional properties with regard to substrate specificity. The Cdx gene was also successfully expressed in E. coli in high levels and also was efficiently produced in L. plantarum using pSIP-based expression vector. The recombinant enzyme exhibited higher degrees of strict substrate specificity towards cyclodextrins than the pullulan and the main hydrolysis product was maltose. This is the first report describing the nucleotide sequence, secondary structure and relevant properties of CDase obtained from lactic acid bacterium of E. faecium.

[14]

Acknowledgments We gratefully appreciated the joint support from the ASEANEuropean Academic University Network (ASEA-UNINET), the Austrian Federal Ministry of Science, Research and Economy and the Austrian Agency for International Cooperation in Education and Research (OeAD-GmbH). This work was also supported by Chiang Mai University’s 50th Anniversary Scholarship and Thailand Research Fund (RTA5880006). We also acknowledge Mr. Russell K. Hollis from English Department, Faculty of Humanities, Chiang Mai University, for English editing.

[15]

[16]

[17]

[18]

[19]

[20]

[21] [22] [23]

[24]

[25]

References [1] P. Turner, A. Labes, O.H. Fridjonsson, G.O. Hreggvidson, P. Schönheit, J.K. Kristjansson, O. Holst, E.N. Karlsson, Two novel cyclodextrin-degrading enzymes isolated from thermophilic bacteria have similar domain structures but differ in oligomeric state and activity profile, J. Biosci. Bioeng. 100 (2005) 380–390. [2] K.H. Park, T.J. Kim, T.K. Cheong, J.W. Kim, B.H. Oh, B. Svensson, Structure, specificity and function of cyclomaltodextrinase, a multispecific enzyme of the ␣-amylase family, Biochim. Biophys. Acta 2000 (1478) 165–185. [3] Y. Nakagawa, W. Saburi, M. Takada, Y. Hatada, K. Horikoshi, Gene cloning and enzymatic characteristics of a novel ␥-cyclodextrin-specific cyclodextrinase from alkalophilic Bacillus clarkii 7364, Biochim. Biophys. Acta 2008 (1784) 2004–2011. [4] K.H. Park, Carbohydrate-Active Enzymes: Structure, Function and Applications, Elsevier Science, 2008. [5] J.H. Auh, H.Y. Chae, Y.R. Kim, K.H. Shim, S.H. Yoo, K.H. Park, Modification of rice starch by selective degradation of amylose using alkalophilic Bacillus cyclomaltodextrinase, J. Agric. Food Chem. 54 (2006) 2314–2319. [6] S. Kitahata, M. Taniguchi, S.D. Beltran, T. Sugimoto, S. Okada, Purification and some properties of cyclodextrinase from Bacillus coagulans, Agric. Biol. Chem. 47 (1983) 1441–1447. [7] S.M. Podkovyrov, J. Zeikus, Structure of the gene encoding cyclomaltodextrinase from Clostridium thermohydrosulfuricum 39E and characterization of the enzyme purified from Escherichia coli, J. Bacteriol. 174 (1992) 5400–5405. [8] T. Oguma, A. Matsuyama, M. Kikuchi, E. Nakano, Cloning and sequence analysis of the cyclomaltodextrinase gene from Bacillus sphaericus and expression in Escherichia coli cells, Appl. Microbiol. Biotechnol. 39 (1993) 197–203. [9] T.J. Kim, J.H. Shin, J.H. Oh, M.J. Kim, S.B. Lee, S. Ryu, K. Kwon, J.W. Kim, E.H. Choi, J.F. Robyt, Analysis of the gene encoding cyclomaltodextrinase from

[26]

[27]

[28] [29]

[30]

[31]

[32] [33]

[34]

alkalophilic Bacillus sp. I-5 and characterization of enzymatic properties, Arch. Biochem. Biophys. 353 (1998) 221–227. A. Hülsmann, R. Lurz, F. Scheffel, E. Schneider, Maltose and maltodextrin transport in the thermoacidophilic gram-positive bacterium Alicyclobacillus acidocaldarius is mediated by a high-affinity transport system that includes a maltose binding protein tolerant to low pH, J. Bacteriol. 182 (2000) 6292–6301. Y. Hashimoto, T. Yamamoto, S. Fujiwara, M. Takagi, T. Imanaka, Extracellular synthesis specific recognition, and intracellular degradation of cyclomaltodextrins by the hyperthermophilic archaeon Thermococcus sp. strain B1001, J. Bacteriol. 183 (2001) 5050–5057. H.B. Fritzsche, T. Schwede, G.E. Schulz, Covalent and three-dimensional structure of the cyclodextrinase from Flavobacterium sp. no. 92, Eur. J. Biochem. 270 (2003) 2332–2341. J. Kaulpiboon, P. Pongsawasdi, Expression of cyclodextrinase gene from Paenibacillus sp. A11 in Escherichia coli and characterization of the purified cyclodextrinase, BMB Rep. 37 (2004) 408–415. G. Fiedler, M. Pajatsch, A. Böck, Genetics of a novel starch utilisation pathway present in Klebsiella oxytoca, J. Mol. Biol. 256 (1996) 279–291. Y. Sun, X. Lv, Z. Li, J. Wang, B. Jia, J. Liu, Recombinant cyclodextrinase from Thermococcus kodakarensis KOD1: expression, purification, and enzymatic characterization, Archaea (2015) 2015. K. Unban, A. Kanpiengjai, G. Takata, K. Uechi, W.C. Lee, C. Khanongnuch, Amylolytic enzymes acquired from L-lactic acid producing Enterococcus faecium K-1 and improvement of direct Lactic acid production from cassava starch, Appl. Biochem. Biotechnol. (2017), http://dx.doi.org/10.1007/s1201012017-12436-12011. E. Halbmayr, G. Mathiesen, T.H. Nguyen, T. Maischberger, C.K. Peterbauer, V.G. Eijsink, D. Haltrich, High-level expression of recombinant ␤-galactosidases in Lactobacillus plantarum and Lactobacillus sakei using a Sakacin P-based expression system, J. Agric. Food Chem. 56 (2008) 4710–4719. M. Kleerebezem, J. Boekhorst, R. Van Kranenburg, D. Molenaar, O.P. Kuipers, R. Leer, R. Tarchini, S.A. Peters, H.M. Sandbrink, M.W.E.J. Fiers, Complete genome sequence of Lactobacillus plantarum WCFS1, Proc. Natl. Acad. Sci. 100 (2003) 1990. M.A. Larkin, G. Blackshields, N. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, Clustal W and Clustal X version 2.0, Bioinformatics 23 (2007) 2947–2948. T.T. Nguyen, G. Mathiesen, L. Fredriksen, R. Kittl, T.H. Nguyen, V.G. Eijsink, D. Haltrich, C.K. Peterbauer, A food-grade system for inducible gene expression in Lactobacillus plantarum using an alanine racemase-encoding selection marker, J. Agric. Food Chem. 59 (2011) 5617–5624. J. Sambrook, D.W. Russell, Molecular Clonging: A Laboratory Mannual, Cold Spring Harbor Press, New York, 2001. T. Aukrust, H. Blom, Transformation of Lactobacillus strains used in meat and vegetable fermentations, Food Res. Int. 25 (1992) 253–261. J.E. Lee, I.H. Kim, J.H. Jung, D.H. Seo, S.G. Kang, J.F. Holden, J. Cha, C.S. Park, Molecular cloning and enzymatic characterization of cyclomaltodextrinase from hyperthermophilic archaeon Thermococcus sp. CL1, J. Microbiol. Biotechnol. 23 (2013) 1060–1069. H.Y. Cho, Y.W. Kim, T.J. Kim, H.S. Lee, D.Y. Kim, J.W. Kim, Y.W. Lee, S.B. Lee, K.H. Park, Molecular characterization of a dimeric intracellular maltogenic amylase of Bacillus subtilis SUH4-2, Biochim. Biophys. Acta 1478 (2000) 333–340. T. Kuriki, J.H. Park, T. Imanaka, Characteristics of thermostable pullulanase from Bacillus stearothermophilus and the nucleotide sequence of the gene, J. Ferment. Bioeng. 69 (1990) 204–210. S.B. Mabrouk, E.B. Messaoud, D. Ayadi, S. Jemli, A. Roy, M. Mezghani, S. Bejar, Cloning and sequencing of an original gene encoding a maltogenic amylase from Bacillus sp. US149 strain and characterization of the recombinant activity, Mol. Biotechnol. 38 (2008) 211–219. T.J. Kim, M.J. Kim, B.C. Kim, J.C. Kim, T.K. Cheong, J.W. Kim, K.H. Park, Modes of action of acarbose hydrolysis and transglycosylation catalyzed by a thermostable maltogenic amylase, the gene for which was cloned from a Thermus strain, Appl. Environ. Microbiol. 65 (1999) 1644–1651. S. Janecek, B. Svensson, B. Henrissat, Domain evolution in the ␣-amylase family, J. Mol. Evol. 45 (1997) 322–331. N. Galvin, C. Kelly, W. Fogarty, Purification and properties of the cyclodextrinase of Bacillus sphaericus ATCC 7055, Appl. Microbiol. Biotechnol. 42 (1994) 46–50. J. Matzke, A. Herrmann, E. Schneider, E.P. Bakker, Gene cloning nucleotide sequence and biochemical properties of a cytoplasmic cyclomaltodextrinase (neopullulanase) from Alicyclobacillus acidocaldarius, reclassification of a group of enzymes, FEMS Microbiol. Lett. 183 (2000) 55–61. J. Kaulpiboon, P. Pongsawasdi, Purification and characterization of cyclodextrinase from Paenibacillus sp. A11, Enzyme Microb. Technol. 36 (2005) 168–175. R. Eisenthal, M.J. Danson, D.W. Hough, Catalytic efficiency and k cat/K M: a useful comparator? Trends Biotechnol. 25 (2007) 247–249. M.J. Yebra, A. Blasco, P. Sanz, Expression and secretion of Bacillus polymyxa neopullulanase in Saccharomyces cerevisiae, FEMS Microbiol. Lett. 170 (1999) 41–49. T. Oguma, A. Matsuyama, M. Kikuchi, E. Nakano, Cloning and sequence analysis of the cyclomaltodextrinase gene from Bacillus sphaericus and expression in Escherichia coli cells, Appl. Microbiol. Biotechnol. 39 (1993) 197–203.

Please cite this article in press as: K. Unban, et al., Int. J. Biol. Macromol. (2017), http://dx.doi.org/10.1016/j.ijbiomac.2017.09.060