- Email: [email protected]
More than one way to toy with ChAT and VAChT
Journal of Physiology - Paris 96 (2002) 61–72 www.elsevier.com/locate/jphysparis
More than one way to toy with ChAT and VAChT Xavier Castella, Marie-Franc¸oise Dieblera,*, Monique Tomasia, Claire Bigaria, Ste´phanie De Goisb, Sylvie Berrardb, Jacques Malletb, Maurice Israe¨la, Vladimı´r Dolez˘alc a
Laboratoire de Neurobiologie Cellulaire et Mole´culaire, CNRS, 91198 Gif-sur-Yvette, Cedex, France b LGN. CNRS, Hoˆpital Pitie´-Salpeˆtrie`re, Paris, France c Institute of Physiology, Prague, Czech Republic
Abstract Expression of choline acetyltransferase (ChAT) and of the vesicular acetylcholine transporter (VAChT) is required for the acquisition and the maintenance of the cholinergic phenotype. The ChAT and VAChT genes have been demonstrated to share a common gene locus and this suggests a coordinate regulation of their expression. In the present work, we examined the effects of several differentiating treatments on the modulation of ChAT and VAChT expression at the mRNA and protein levels in growing and differentiating NG108-15 cells. In cells grown in the presence of serum, all the agents tested—retinoic acid, dexamethasone and dibutyrylcyclicAMP (dbcAMP)—induced an increase of ChAT and VAChT mRNA levels but with different efficacy. Treatment with dbcAMP plus dexamethasone resulted in the largest increase of VAChT mRNA amount while retinoic acid mostly enhanced ChAT mRNA level. However, while ChAT activity was increased by all agents, no change in the VAChT protein level was detected. In cells differentiated by serum deprivation, only retinoic acid was effective in inducing an increase of VAChT and ChAT mRNA and ChAT activity, while we observed a downregulation by dbcAMP and dexamethasone. Treatment with the antimitotic agent cytosine arabinoside led to an increase of ChAT activity which was further largely enhanced by the addition of dbcAMP plus dexamethasone, but to only a slight change in VAChT activity. We further showed that complex glycosylation processes which might play a role in targeting and/or stability of the membrane protein VAChT are deficient in these cells. Indeed, in transient transfection assays with the reporter soluble enzyme luciferase placed under regulatory and promoter regions of the VAChT gene, we observed a modulation of luciferase expression by differentiating agents. These data illustrate the complexity of the processes which participate to the expression of the ChAT and VAChT genes, both at the transcriptional and posttranslational levels. # 2002 Elsevier Science Ltd. All rights reserved. Keywords: Choline acetyltransferase; Vesicular acetylcholine transporter; NG108-15; Cholinergic differentiation; Cyclic AMP; Dexamethasone
1. Introduction Coexpression in the same cell of the enzyme which synthesizes acetylcholine—the choline acetyltransferase (ChAT)—and of the transporter which ensures storage and concentration of the transmitter into synaptic vesicles—the vesicular acetylcholine transporter (VAChT)— is a prerequisite for a neuron to be cholinergic. In all species examined so far, the ChAT and VAChT genes are arranged in a common locus, referred to as ‘‘the cholinergic locus’’ [15], where the VAChT gene is inserted within the ChAT gene [1,4,15,26,33]. This unusual genomic organization forms a potentially favorable structural arrangement to support a coordinate regulation of the transcription of both genes, and in fine, for the two proteins to be co-expressed in cholinergic neu* Corresponding author. Tel.: +33-1-69-82-36-71; fax: +33-1-6982-94-66. E-mail address: [email protected]
rons. Indeed, while in mammalian, generation of specific transcripts of the ChAT and VAChT genes might result from the use of common and/or specific promoters [9], (for review see [14]), the recent study of De Gois et al. (2000) [11] indicates that the restricted expression of both genes to neuronal cells may be governed by a silencer element located upstream from the ChAT and VAChT coding regions. In addition, evidence for a coordinate up- or down- regulation of ChAT and VAChT mRNA levels by several differentiating agents came from several studies on different cellular models [5,6,7,32]. However, examples of regulatory processes specific for either ChAT or VAChT are now arising. The VAChT gene requires distinct control elements for a restricted expression in cholinergic neurons [11]. Uncoupling of the levels of specific transcripts, in space as shown in Drosophila [26] or in time as during vertebrate brain development ([23,43]) suggests the possibility of an independent regulation, either through a separate control of the activity of
0928-4257/02/$ - see front matter # 2002 Elsevier Science Ltd. All rights reserved. PII: S0928-4257(01)00081-X
62
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
Nomenclature ChAT Choline acetyltransferase CREB cAMP responsive element binding protein ERK extra-cellular regulated kinase GPDH glyceraldehyde-3-phosphate deshydrogenase JNK c-jun N-terminal kinase MAP mitogen activated protein MEK MAP/ERK Kinase PKA protein kinase A PKC protein kinase C VAChT vesicular acetylcholine transporter
specific promoters or through posttranscriptional mechanisms. In addition, recent studies on cell lines provide evidence for a dissociated regulation of mRNA and protein, both for ChAT [28] or VAChT [13]. In the present report, we have been using the NG 10815 cell line as a model to further explore the regulation and the expression of ChAT and VAChT during differentiation. As a way to mimic crucial stages of the neuronal development, cells were either allowed to proliferate in the presence of serum (and the growth factors it contained) or to stop dividing by serum starvation or by exposure to the antimitotic agent cytosine arabinoside in the presence of serum. The influence of different agents previously shown to increase ChAT activity in dividing cells was analyzed on neuronal phenotypic markers and on the expression of ChAT and VAChT. The results show that although the different stimuli used in this study were able to promote neuronal differentiation and modulate the transcription of the cholinergic locus, the amount of the VAChT protein was poorly regulated. However, transient transfection experiments with a construct in which the luciferase reporter gene was placed under the control of regulatory and promoter sequences of the VAChT gene, showed that modulation of this soluble enzyme by differentiating agents followed the pattern expected from VAChT mRNA studies. The data suggest that additional posttranslational processes, possibly complex glycosylations, participate in the control of the level of a fully mature membrane protein as VAChT.
2. Materials and methods 2.1. Materials All cell culture reagents came from Life Technologies. Stock solutions of all-trans-retinoic acid, dexametha-
sone, dibutyryl-cyclicAMP (dbcAMP) and cytosine arabinoside (Sigma) were made in distilled water or ethanol (retinoic acid) and diluted at least to 1% in the culture medium. [3H] acetyl-CoA (4 Ci/mmol) and L[3H] vesamicol (31Ci/mmol) were from New England Nuclear. Acetyl-CoA and bovine serum albumin were purchased from Boehringer. L-vesamicol was from RBI Biochemicals. All other chemicals were of the highest available purity. The monoclonal antibody against synaptophysin was purchased from Roche (France); the rabbit polyclonal antiserum against SNAP25 and the monoclonal antibodies anti rab5 and anti synaptobrevin (VAMP 2, clone 69.1) were from Synaptic Systems (Germany). The monoclonal antibody against bIII tubulin was from Promega (France). The monoclonal antibodies against SV2 and against N-CAM were obtained from the Developmental Studies Hybridoma Bank (University of Iowa, USA). Antisera against the C-terminal part of the rat VAChT [5] and against synaptotagmin [40] have been previously characterized. Secondary antibodies, horseradish peroxidase- and fluorescein isothiocyanate- (FITC) conjugated IgG were from Pasteur Production (France). SeeBlue prestained molecular weight markers were from Novex. 2.2. Cell culture Cell cultures were usually carried out in 12 wellplates. In proliferating conditions, NG 108-15 cells were plated at a density of 12 103 and maintained in the presence of 5% non inactivated fetal calf serum less than 6 months old [37]. Drugs were added 6–8 h after the seeding and the treatment was continued for 4 days without changing the medium. For serum starvation experiments, cells were seeded at a density of 120 103 and were first maintained for 24 h in a serum containing medium as described above. The medium was then replaced by a serum free defined medium containing 6 mg/ml bovine serum albumin and the test substances. Cells were harvested 6 days later. For experiments on cell proliferation inhibition in the presence of non-inactivated serum, cells were seeded at a density of 120103 and except in concentration-response experiments, they were treated with 1 mM cytosine arabinoside together with the test compounds. Forty hours later, the medium was replaced by a fresh medium containing only the test substances. Cells could be maintained for at least 5 days without changing the medium. In all the present experiments, we periodically replaced high-passage cultures (around 20) by fresh low-passage stocks (< 4). After either treatment, cells were harvested and washed in phosphate-buffered saline (PBS) and collected by centrifugation at 180g for 5 min. For ChAT measurement, vesamicol binding assay and protein determination, cells were disrupted in the presence of a
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
cocktail of protease inhibitors either by homogenization [45] or osmotic lysis and homogenization in 10 mM phosphate buffer [5]. Transient transfection experiments were performed as described by De Gois et al. (2000) [11], using the pl-123 reporter construct in which the luciferase gene was placed under the control of regulatory and promoter regions of the VAChT gene.
63
experiments and unless otherwise stated, 30 cycles of amplification were then routinely carried out. PCR products were electrophoresed on a 1.2% agarose gel, stained with ethidium bromide and visualized under UV light. Signal intensities were quantified on scanned images (Adobe Photoshop 4.0 and SigmaGel softwares). No signal was detected in RT samples. 2.5. ChAT assay
2.3. Northern blot analysis Northern blot analysis was performed as previously described [13]. Briefly, 15–30 mg of total RNA was sizeelectrophoresed and transferred to nitrocellulose membranes as described by Thomas (1980) [42]. cDNA probes (rat VAChT and rat ChAT) were 32P-labeled by the random primer labeling technique (NonaPrimer kit, Appligene). 2.4. RT-PCR Total RNA was extracted from 0.5 to 1106 cells using the RNeasy protocol (Qiagen). Homogenization of the fresh cell lysates was routinely done with Qiashredder columns (Qiagen). RNA recovery was quantified spectrophotometrically at 260 nm and further assessed by gel electrophoresis. Single strand cDNAs were synthesized with Superscript II reverse transcriptase (Life Technologies) using random hexamers as primers and 2 mg total RNA in a final volume of 20 ml. Samples were run in parallel in the absence of RT-polymerase (RT samples). One microliter (GPDH amplification) or 6 ml (ChAT or VAChT amplification) of the cDNA solutions were PCR amplified in a 25 ml reaction mixture which contained 200 mM dNTPs, 0.75 U of Taq DNA polymerase in buffer supplied by the manufacturer (Life Technologies) with 0.2 mM of each primer. Rat primers were as follows: ChAT S: 50 TACAGGCTTTACCAGAGACTGG TG 30 (1508-1531) AS: 50 AACTGGAGATGCAGAAG GTGATGG 30 (1965-1941) VAChT S: 50 CACCAAACTGTCGGAAGCGGTG 30 (43-64) AS: 50 GCAGCGAAGAGCGTGGCATAGTC 30 (544-522) GPDH S: 50 AGTGGAGATTGTTGCCATCA 30 (121-141) AS: 50 ACGGACACATTGGGGGTAGG 30 (768-747)
ChAT activity was quantified by the modified method of Fonnum (1969) [17], as described by Berrard et al. (1995) [5] using [3H] acetyl-CoA as a substrate. ChAT specific activity was expressed as pmol of [3H] acetylcholine that had been synthesized per mg protein and per 15 min incubation at 37 C. 2.6. L-[3H] Vesamicol binding The binding of L-[3H] vesamicol, a specific ligand of VAChT, was measured on lysed cells as previously described [45]. 2.7. Western blot analysis Lyophilized cell lysates (30–100 mg protein) were dissolved in lysis buffer containing 5% sodium dodecylsulfate (SDS) and 50 mM dithiothreitol as previously described [13]. Proteins were electrophoresed in 4–20% SDS-polyacrylamide minigels and transferred to nitrocellulose. Western blotting was performed with specific antibodies and peroxidase—conjugated secondary antibody. Immunoreactivity was visualized by enhanced chemiluminescence on film (Pierce). 2.8. Immunocytochemistry Cells cultured on glass coverslips coated with polyornithine were fixed and permeabilized with ice cold acetone or methanol as previously described [13]. Non specific binding was blocked by incubation with PBS containing 2% bovine serum albumin (BSA) for 15 min. Cells were then incubated for 3 h with the primary antibody diluted in PBS-1% BSA. Secondary antibody conjugated to fluorescein isothiocyanate (FITC) was used to visualize immunoreactivity. Blocking and immunolabeling steps were performed at room temperature and cultures were thoroughly rinsed with PBS after all steps. Samples mounted with Vectashield (Vector) were examined using epifluorescence microscope. 2.9. Protein determination
Cycle times were 30 s at 94 C, 30 s at 60 C (ChAT amplification) or 67 C (VAChT amplification) or 54 C (GPDH amplification), 30 s at 72 C. The number of cycles were optimized for each cDNA in preliminary
Protein content was determined by the method of Bradford (1976) [8] using bovine serum albumin as a standard.
64
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
3. Results 3.1. Effects of differentiating agents in growing conditions The hybrid NG 108-15 line, which was generated by fusing the glioma C6-BU-1 and the neuroblastoma N18TG2 lines, has been previously demonstrated to display many neuronal traits [21,36]). As evidenced in Fig. 1, all cells were stained for the neuronal marker bIII tubulin. Although the two parental cells are unable to synthesize ACh, the hybrid NG 108-15 line has been long ago recognized as a cholinergic cell line on the basis of the presence of a ChAT activity and the release of the synthesized neurotransmitter after differentiation [21,30]. All our experiments were carried at low passages and ChAT activity remained fairly stable, around 1 pmol [H3] ACh synthesized per mg protein and 15 min. Surprisingly, we recently showed that a panel of differentiating treatments which were optimized according to their stimulatory effects on ChAT activity (Fig. 2A) were unable to bring about a parallel increase of the VAChT protein [12,13]. These treatments were applied for 4 days on cells proliferating up to confluence and consisted of : 1 mM retinoic acid (R), 1 mM dbcAMP (A), 0.1 mM dexamethasone (D) and the combination 0.2 mM dbcAMP plus 0.1 mM dexamethasone unless otherwise stated (AD). In the experiments illustrated in
Fig. 2B, the amount of VAChT protein was assessed by the binding of its specific ligand, vesamicol [2,44], and immunoblotting. No significant change in vesamicol binding could be observed with either treatment. VAChT is a glycosylated protein which is usually detected around 64–80 kDa [3,5,18,23,44], but the immunoreactivity was visualized here as a peptide of a small size around 33 kDa. Nonetheless, ChAT and VAChT mRNAs were upregulated by all treatments. In addition, different ratios of ChAT and VAChT mRNA levels were observed, depending on the agent used to differentiate the cells. As shown on Northern blots (Fig. 3), the combined addition of dbcAMP and dexamethasone was the most effective treatment to enhance VAChT mRNA amount, while the highest ChAT mRNA level was observed in the presence of retinoic acid.
4. Expression of ChAT and VAChT in NG cells differentiated in serum-free medium 4.1. Expression of common neuronal vesicular markers The next experiments were designed to create unfavorable conditions for cell proliferation and to induce a morphological differentiation towards a mature neuronal phenotype. To this purpose, we first removed the
Fig. 1. bIII- tubulin immunodetection in NG108-15 cells. Cells grown for 4 days in the presence of serum in control conditions (C) or in the presence of dbcAMP and dexamethasone (AD) were fixed in methanol as described in methods and stained with anti bIII-tubulin antibody. Immunoreactivity detected with a FITC conjugated secondary antibody was examined with epifluorescence microscopy.
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
65
Fig. 2. Effect of differentiation agents on ChAT and VAChT proteins. NG cells were grown for 4 days in the presence of serum and various differentiating agents: R, 1 mM retinoic acid; A, 1 mM dbcAMP; D, 1 mM dexamethasone; AD, 1 mM dbcAMP+1 mM dexamethasone. A. ChAT activity is expressed as fold increase of control values. Results are from 9 to 21 measurements. Control activity was 0.95 0.03 pmol [3H] ACh/mg protein/15 min. B. Vesamicol binding measured at 18 nM is expressed relative to control values. Data are from four independent experiments. C. Immunodetection of VAChT on western blot. Cell lysates (100 mg) and a mouse brain homogenate (first lane; 100 mg) were fractionated using 4–20% SDS PAGE. Western immunoblotting was performed with a rat VAChT antibody (1/5000) directed against the C-terminal part of the VAChT protein, and with ECL detection. The same blot without dehybridization was used for rab5 detection, as an internal control. Scale on the right indicates the position of molecular weight markers. The blot presented is representative of at least five experiments.
ing and in serum-free non proliferating conditions. In contrast to cells grown in the presence of serum where the low basal expression of common vesicular proteins (synaptophysin, SV2, synaptotagmin, VAMP) was increased by the addition of dbcAMP [13], serum deprivation alone was sufficient to induce a tremendous rise of these vesicular antigens; as illustrated in Fig. 5 for VAMP and SV2, addition of other agents did not yield further significant changes. 4.2. Expression of ChAT and VAChT
Fig. 3. Northern blot analysis of ChAT and VAChT mRNA levels under various differentiating treatments. Cells were treated for 2 days with 1 mM retinoic acid (R), 0.1 mM dexamethasone (D) or 0.2 mM dbcAMP+0.1 mM dexamethasone (AD). RNA preparations (30 mg) were first hybridized with a rat ChAT cDNA, stripped, and re-hybridized with a rat VAChT cDNA. The blot presented is representative of at least three to four experiments.
serum from the growth medium. NG108-15 cells grown in a serum-free medium displayed extensive morphological differentiation; they extended long, thin processes, decorated with many varicosities. Immunostaining of SNAP 25, a marker of synaptic plasma membranes and of VAMP (or synaptobrevin), a synaptic vesicle marker, illustrated these morphological changes, as shown in Fig. 4. VAMP immunostaining, which was mostly detected in the Golgi apparatus in control cells (+ serum), was largely enhanced by serum starvation and was concentrated at the tip of the processes and within the varicosities. Expression of vesicular antigens upon addition of differentiating agents was further analyzed on Western blots of sister cultures grown in proliferat-
ChAT activity of cells cultured for six days in a serum-free medium was slightly lower but not significantly different from that observed in cells grown for 4 days up to confluence in a serum containing medium. Further exposure to our panel of differentiating agents (see above) produced a mixed profile of changes (Fig. 6A). Retinoic acid became the only agent still able to upregulate ChAT activity whereas all other agents, alone or in combination, induced a downregulation of ChAT. As shown in Fig. 6B, the concentration-response curve for dexamethasone inhibitory effect was similar to that seen for the stimulatory effect in the presence of serum [13]; it was maximal at 30 nM and did not exceed 50% of control values. Consistent with the data on protein, ChAT mRNA abundance was increased in retinoic acid treated cells and it was accompanied by parallel changes in VAChT mRNA (Fig. 6C). However, none of these treatments produced significant changes in VAChT protein expression as assayed by vesamicol binding. It thus appears that, although serum deprivation does induce the expression of some vesicular proteins characteristic of a mature neuronal cell, it does not
66
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
Fig. 4. Effect of serum deprivation on differentiation. Cells grown in the absence of serum extended long processes. Upper line: immunodetection of the vesicular marker VAMP performed on cells fixed with methanol, shows increased expression and accumulation of the protein at the tips of the processes and in the varicosities. Lower line: immunodetection of the plasma membrane marker SNAP 25.
Fig. 5. Effect of serum deprivation on VAMP and SV2 expression. Cells were grown in the presence (+ serum) or in the absence of serum (0 serum). Cell lysates (30 mg) were analysed by Western blotting with a monoclonal SV2 antibody (1/50) and with a monoclonal VAMP antibody (1/500). Data presented are representative of at least 3 experiments.
have the capacity to support the expression of a cholinergic phenotype. 4.3. Effect of PKC depletion We next sought for the involvement of PKC in the opposite changes by dexamethasone or dbcAMP on ChAT activity under proliferating or non proliferating conditions as described above. To induce PKC depletion, we used a long-term exposure to the phorbol ester TPA [46]. Time course studies from 1 to 6 days exposure (data not shown) showed that TPA effects (0.5 mM) on ChAT activity were delayed. As shown in Fig. 7, application of TPA alone for 6 days produced a decrease of ChAT activity both in the presence and the absence of serum (30 and 31%, respectively). Furthermore, the TPA treatment prevented the stimulatory effects of both dbcAMP and dexamethasone in the presence of serum. The inhibitory effects of TPA, dbcAMP and dexamethasone on ChAT activity observed in the absence of serum (Figs. 6A and 7A) were not additive (Fig. 7B). In contrast, the stimulatory effect of retinoic acid was preserved in serum free medium and in the presence of
TPA both in serum containing and serum free medium (Figs. 6A, 7A and B). The differentiation profile in TPA-treated cells thus resembles that observed in cells cultured in serum-free medium, suggesting that PKC signaling might be involved in mediating the upregulation of ChAT activity by dexamethasone and dbcAMP in the presence of growth factors contained in serum.
5. Effects of chemical arrest of cell proliferation in the presence of serum 5.1. Effect of cytosine arabinoside on neuronal differentiation In the next set of experiments, cell proliferation was blocked by application of the antimitotic agent cytosine arabinoside (Ara-C) in the continuous presence of growth factors contained in serum. Because of the drug toxicity, we first had to establish an experimental protocol which would allow a prolonged observation. Different concentrations of Ara-C were applied for various length of time on cells seeded at high density and grown
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
67
Fig. 6. Effect of differentiating agents on ChAT activity and on ChAT and VAChT mRNAs in the absence of serum. NG cells were grown for 6 days in the absence of serum and treated with various differentiating agents: R, 1 mM retinoic acid; A, 0.2 mM dbcAMP; D, 0.1 mM dexamethasone; DR, 1 mM retinoic acid+0.1 mM dexamethasone; AD, 0.2 mM dbcAMP+0.1 mM dexamethasone. A. ChAT activity is expressed as fold increase of control values. Data are average S.E.M. values of four independent experiments. Control value was 0.93 0.11 pmol [3H] ACh/mg protein/15 min. B. Concentration-response curve of dexamethasone inhibitory effect on ChAT activity is expressed as a fraction of control values. Each point represents mean S.E.M. of three values. C. Northern blot analysis was performed on total RNA (15 mg) extracted from cells grown for 7 (7d) or 11 (11d) days in the absence of serum. The blot was hybridized with the radiolabeled ChAT probe, stripped and rehybridized with the radiolabeled VAChT probe.
Fig. 7. Effect of TPA on ChAT activity. NG cells were grown for 4 days in the presence of serum (A) or for 6 days in the absence of serum (B) and the indicated drugs in the presence of 0.5 mM TPA: C, no TPA; R, 1 mM retinoic acid; A, 0.2 mM dbcAMP; D, 0.1 mM dexamethasone. ChAT activity is expressed as a fraction of corresponding control values. Data are average S.E.M. values of four independent experiments. Control values in pmol [3H] ACh/mg protein/15 min, were 1.2 0.16 and 0.83 0.06 for A and B, respectively.
in the presence of serum. Fig. 8 shows ChAT activity (Fig. 8B) in one of these experiments where increasing concentrations of Ara-C were continuously present for 60 h prior to harvesting. This treatment induced about a two fold increase of ChAT activity but resulted in a sharp drop of protein content (Fig. 8A). The cells survived better when the time of the treatment with Ara-C was shortened. When applied at the concentration of 1 mM for 36–40 h and then removed, the cells survived well for at least the next 7 days, with no major morphological changes (not shown). This procedure was then routinely used for the next experiments and referred to as ‘‘Ara-C’’ treated cells. Parallel experiments were done in the continuous presence of differentiating agents. Additional application of dbcAMP in combina-
tion with dexamethasone, which we found the most efficient differentiating association on cells grown in the presence of serum ([13] and see above), induced the expected changes in cellular morphology. Cells formed small clusters at the border of which long processes were emitted far off the cell body. However, cells bodies and processes were loosely attached to the surface of the dish and tended to float in the medium. Immunocytochemical studies were thus unsuccessful. Neuronal differentiation was checked by Western blot experiments. As illustrated in Fig. 9, immunoreactivity of VAMP and SV2 was increased in Ara-C treated cells and application of dbcAMP plus dexamethasone further enhanced the abundance of these vesicular antigens. A similar observation was made for synaptophysin (not shown).
68
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
Fig. 8. Concentration-dependence of the effect of Ara-C on protein content and ChAT activity. Cells were grown in a serum containing medium and in continuous presence of the indicated concentrations of Ara-C for 60 h. Results are mean S.E.M. of three values. A, Protein per well. B, ChAT activity.
Fig. 9. Effects of Ara-C on the expression of the vesicular antigens VAMP and SV2. Ara: cells grown in the presence of serum were exposed for 36 h to 1 mM Ara-C and then further cultured for 6 days without Ara-C: Ara+AD: 0.2 mM dbcAMP+0.1 mM dexamethasone were continuously present in the culture medium. C: control cells grown for 4 days up to confluence without any treatment. Immunodetection of VAMP and SV2 on cell lysates (40 mg) was performed as described in Fig. 5. The blots are representative of three experiments.
5.2. Effect of cytosine arabinoside on ChAT and VAChT expression Fig. 10A shows that ChAT activity was about 8-fold higher in Ara-C treated cells than in control cells (namely, cells proliferating up to confluence for 4 days in the absence of any agent). Upregulation of ChAT activity appeared with some delay and no significant change in ChAT activity was seen immediately after the 40 h lasting treatment with Ara-C. The continuous presence of dexamethasone or of dbcAMP plus dexamethasone caused a further stimulation of ChAT activity. The highest level of ChAT was observed with the latter combination: with an approximate 15-fold enhancement over control, it appeared that the Ara-C treatment amplified the effects of the two other drugs.
Duration of Ara-C application was very critical and a treatment prolonged to 48–52 h (not shown) resulted in only a 3-fold increase of ChAT in the absence of any other agent. However, the presence of dbcAMP plus dexamethasone led to a comparable total increase of ChAT activity in the 6-day-old cultures. By contrast, the stimulatory effect of retinoic acid on ChAT activity was of similar magnitude in controls and Ara-C treated cells (not shown). Vesamicol binding assays (Fig. 10B) showed that the largest increase of ChAT activity (up to 15-fold in the presence of dbcAMP+dexamethasone) was accompanied by a distinct but still rather modest concomitant increase in VAChT protein level. Changes in mRNA abundance, followed by RT-PCR techniques, indicated that both ChAT and VAChT mRNAs were upregulated, but with a different time course (Fig. 10 C, D). While VAChT mRNA was already augmented after the 40 h of Ara-C application as compared to cells grown without the drug, only a slight increase of ChAT mRNA, if any, could be detected. Similar increases were observed for ChAT and VAChT mRNA levels on AraC treated cells receiving an additional treatment with differentiating agents. This upregulation was specific as none of the treatments affected the mRNA level of the ubiquitous enzyme GPDH.
6. Glycosylation of membrane proteins in NG 108-15 cells The question of a defective machinery for complex glycosylations in NG 108-15 cells was further examined by analyzing the immunoreactive profile of another
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
69
Fig. 10. Effects of Ara-C on ChAT and VAChT expression. A–B: ChAT and VAChT proteins. Cells were treated for 30 h with Ara-C (+Ara) and no further addition (C) or in the presence of the indicated drugs: D, 0.1 mM dexamethasone; AD, 0.2 mM dbcAMP+0.1 mM dexamethasone. ChAT activity (A) and vesamicol binding measured at 60 nM (B) are expressed relative to control values which were cells grown for four days up to confluence without any treatment (C, left bar). Results are mean S.E.M of two to three independent experiments. C–D: ChAT and VAChT mRNAs. The cDNA resulting from reverse transcription of 0.125 mg (ChAT), 0.075 mg (VAChT) or 0.062 mg (GPDH) of total RNA was subjected to PCR with the primers described in Methods. C: cells seeded at confluence were treated with 1 mM Ara-C for 30 h (Ara) or maintained in the absence of drug (C). Three independent seedings are presented. D: Differentiating agents were combined with a 30 h-treatment with Ara-C (+Ara) as described in Fig. 9: D: 0.1 mM dexamethasone; AD: 0.2 mM dbcAMP+0.1 mM dexamethasone; C: Ara-C treatment alone with no further addition. Data from two independent seedings, representative of four experiments. PCR products were visualized on agarose gels with ethidium bromide and UV light.
highly glycosylated protein, the resident Golgi protein TGN 38. While the polypeptide has a predicted size of 38 kDa, its apparent Mr on SDS/PAGE is usually around 85–90 kDa, due to extensive N- and O- posttranslational glycosylations [27]. Fig. 11 shows that, in contrast to the parental C6-BU-1 cells which produced a mature protein of the expected size, NG108-15 cells were unable to achieve the predicted glycosylations.
of NG108-15 cells were performed with plasmid constructs where the coding sequence of the soluble enzyme luciferase was placed under the control of promoter and regulatory regions of the VAChT gene. With the exception of retinoic acid, luciferase activity was stimulated by all the treatments which were shown to upregulate ChAT activity, demonstrating a coregulation of the reporter and the endogenous ChAT and VAChT genes (Fig. 12).
7. Transfection studies 8. Discussion To further assess whether post-translational modifications were key regulatory steps in the availability of the membrane protein VAChT, transient transfections
Cholinergic cell lines offer the possibility to explore the influence of regulatory molecules on the expression
70
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
of the cholinergic locus and its coupling to neuronal differentiation. The drawback of using cells of tumor origin can in fact turn out as an advantage, as it might reveal checkpoints and cooperative regulatory mechanisms that are normally involved in the expression of a mature neuronal transmitter phenotype. Numerous data in the literature support the hypothesis that neuronal differentiation is linked to the arrest of cell proliferation. Changing culture conditions allows one to study the expression of neuronal and transmitter markers in relation to the proliferation status of the cells. To this end, we used here the NG108-15 cell line, a well characterized hybridoma cell line [21,22,47] to combine proliferative or non proliferative culture conditions with differentiating agents selected in a previous study for their ability to increase ChAT activity [13]. As judged from the presence of bIII tubulin and of a basal ChAT activity, all cells were committed towards a neuronal cholinergic phenotype. However, they had low
Fig. 11. Immunodetection of the integral membrane protein of the trans-Golgi network TGN 38. Western blot analysis was performed on C6-BU-1(C) and NG 108-15 (N) cell lysates (50 mg) using a monoclonal TGN 38 antibody (1/500). Arrows indicate the estimated apparent molecular weight.
Fig. 12. Luciferase activity in transfected cells. NG 108-15 cells were transiently transfected with plasmid constructs containing the coding sequence of the soluble luciferase protein under the control of promoter and regulatory regions of the VAChT gene. Transfected cells were grown for 2 days in the presence of serum and treated with various differentiating agents: C, no treatment; R, 1 mM retinoic acid; D, 0.1 mM dexamethasone; AD, 0.2 mM dbcAMP+0.1 mM dexamethasone. Luciferase activity was normalized for transfection efficiency as described by De Gois et al. (2000) [12]. Data from seven independent experiments are expressed relative to control values.
levels of synaptic vesicle proteins. Consequently, upregulation of vesicular proteins was used here as a hallmark for neuronal differentiation, in addition to morphological criteria such as neurite outgrowth. Ongoing immuno-electronmicroscopy experiments will show if these proteins are assembled in true synaptic vesicles. High expression of vesicular proteins was observed when cell division was either stopped by serum deprivation or partly inhibited by exposure to a permeable analog of cAMP, two procedures which promoted an extensive morphological differentiation. The antimitotic agent cytosine arabinoside alone induced a moderate increase in vesicular proteins, with no major morphological changes, which was further stimulated by dbcAMP. As the mechanisms underlying the antiproliferative activity of these procedures differ, this suggests that inhibition of cell growth is not sufficient to promote the upregulation of vesicular proteins. Involvement of the MAP kinase cascades in combination with the cAMP signal transduction pathway in the signaling of differentiation has been largely documented in PC12 cells [10,29]. It is likely that these signaling pathways participate in the induction of the expression of the vesicular antigens observed here. Serum deprivation was shown in different cell systems ([24] and references within) to alter the raf/MEK/ERK protein kinase cascade normally regulated by growth factors and to activate the JNK pathway which plays a key role in activating several transcription factors (for review, [25]); one hypothesis is that this pathway is involved in mediating the upregulation of the vesicular proteins studied here. Experiments using specific inhibitors will help to elucidate the participation of either cascades in the presence or the absence of serum. The present experiments show that differentiation as judged by the above criteria and upregulation of ChAT activity were not supported by the same regulatory mechanisms. To the extent that mRNA amounts reflect gene transcription levels, stimulation of the expression of ChAT and VAChT genes occurred when cell growth was inhibited but only when the culture medium was supplemented with serum. The use of unheated and less than 6-month-old serum was crucial, indicating that the unidentified growth factors and/or neurotrophins involved in this upregulation are fragile. Cell division arrest by cytosine arabinoside was sufficient to induce an upregulation of ChAT activity, in agreement with reports on primary cultures of cholinergic cells [34]. Furthermore, dbcAMP and dexamethasone transducing pathways and cell growth arrest signalings acted synergistically to promote an upregulation of ChAT and VAChT expression, the combined treatments resulting in larger increase of ChAT activity than in growing cells (this study, [13]). By contrast, cessation of proliferation by serum starvation failed to support an upstimulation of ChAT activity. In some experiments, ChAT activity
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
of cells cultured in serum free medium was somewhat lower than those of sister cells grown in the presence of serum, but this was not significantly different. However, the stimulatory effects of dbcAMP and dexamethasone, observed alone or in combination in the presence of serum, were abrogated by the absence of growth factors. It is expected that serum deprivation as well as a prolonged TPA treatment, changed the pattern of intrinsic set of signaling cascades which contribute to cAMP dependent transcriptional synergy or repression (see [38]; for review, [19,20,31]). Likewise, Berse and Blusztajn [7] reported a cell type specific up or down modulation of ChAT and VAChT mRNAs by dexamethasone in PC12 and SN56 cells. While the study of Shimojo et al. (1998) [41] emphasized the role of PKA in controlling the regulation of both ChAT and VAChT genes in PC12 cells, little is yet known on the pairing of signaling cascades in the expression of the cholinergic locus in other systems. Indeed, cAMP transducing pathways through PKA and PKC activation are multiple, including a direct phosphorylation of CREB and the activation of B-raf/MEK/ERK cascades (for example, see [39] and for review, [35]). Activation of the MAP kinase cascade, which occurred in response to extracellular stimuli (i.e. growth factors) seemed to be required to upregulate transcription of the ChAT gene [16]. Interestingly, retinoic acid whose activity is mediated by nuclear receptor, upregulated ChAT and VAChT mRNAs and ChAT activity, regardless of the presence of serum (this study) or the cell type [7]. The intriguing observation reported in this study and previous works [12,13]) is that the VAChT protein level does not follow its messenger level. Differentiation of the cells in the presence of cytosine arabinoside with treatments which prompted up to a 15-fold increase of ChAT activity, induced only a modest increase of the binding of its specific ligand [2,44]. The absence of a functional VAChT protein in NG108-15 cells was suggested by the experiments of Zhong et al. [47], showing that differentiating treatments were unable to stimulate the formation of a granular acetylcholine pool. In addition, the VAChT protein was detected on Western blot as a peptide of small molecular weight (this study, [12,13]). As exemplified on the Golgi protein TGN38, we showed that NG108-15 cells were unable to achieve proper posttranslational glycosylation modification. As VAChT protein is highly glycosylated [45], it thus appears that these posttranslational modifications are crucial for this membrane protein to be functional. Indeed, transfection experiments allowed us to bypass the drawback of comparing the modulation of a soluble protein, ChAT, with that of a membrane protein. Expression of luciferase, whose coding sequence substituted the VAChT coding sequence and was placed under the control of identified promoter and regulatory
71
regions of ChAT and VAChT genes [11], was modulated by differentiating treatments. To conclude, cellular models allow one to unravel a complex regulatory pattern of the expression of the cholinergic locus, where transcriptional and posttranscriptional mechanisms contribute to fine tune the coordinate expression of ChAT and VAChT proteins in mature neurons.
Acknowledgements This work was supported in part by a grant from the AFM and from GACR (305/01/0283). V.D. was the recipient of a fellowship from the CNRS. We are grateful to Dr. B. Rouzaire-Dubois and S. Bostel for their help with cell cultures; to Drs. S. O’Regan and F.-M. Meunier for their support in molecular biology experiments. References [1] A. Alfonso, K. Grundahl, J.S. Duerr, H.-P. Hahn, J.P. Rand, The Caenorhabditis elegans unc17 gene: a putative vesicular acetylcholine transporter, Nature 261 (1993) 617–619. [2] B.A. Bahr, S.M. Parsons, Demonstration of a receptor in Torpedo synaptic vesicles for the acetylcholine storage blocker Ltrans-2- (4-phenyl [3,4 3H] piperidino) cyclohexanol, Proc. Natl. Acad. Sci. USA 83 (1986) 2267–2270. [3] J. Barbosa Jr., A.R. Massensini, M.S. Santos, S.I. Meireles, R.S. Gomez, M.V. Gomez, M.A. Romano-Silva, V.F. Prado, M.A. Prado, Expression of the vesicular acetylcholine transporter, proteins involved in exocytosis, and functional calcium signaling in varicosities and soma of a murine septal cell line, J. Neurochem. 73 (1999) 1881–1893. [4] S. Be´janin, R. Cervini, J. Mallet, S. Berrard, A unique gene organization for two cholinergic markers, choline acetyltransferase and a putative vesicular transporter of acetylcholine, J. Biol. Chem. 269 (1994) 21944–21947. [5] S. Berrard, H. Varoqui, R. Cervini, M. Israe¨l, J. Mallet, M.F. Diebler, Coregulation of two embedded gene products: choline acetyltransferase and the vesicular acetylcholine transporter, J Neurochem 65 (1995) 939–942. [6] B. Berse, J.K. Blusztajn, Coordinated upregulation of choline acetyltransferase and vesicular acetylcholine transporter gene expression by the retinoic acid receptor alpha, cAMP, and leukemia inhibitory factor/ciliary neurotrophic factor signaling pathways in a murine septal cell line, J Biol. Chem. 270 (1995) 22101–22104. [7] B. Berse, J.K. Blusztajn, Modulation of cholinergic locus expression by glucocorticoids and retinoic acid is cell-type specific, FEBS Lett. 110 (1997) 175–179. [8] M.M. Bradford, A rapid and sensitive method of the quantitation of microgram quantities of protein utilizing the principal of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [9] R. Cervini, L. Houhou, P.-F. Pradat, S. Be´janin, J. Mallet, S. Berrard, Specific vesicular acetylcholine transporter promoter lie within the first intron of the rat choline acetyltransferase gene, J. Biol. Chem. 270 (1995) 24654–24657. [10] S. Cowley, H. Paterson, P. Kemp, C.J. Marshall, Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation on NIH 3T3 cells, Cell 77 (1994) 841–852.
72
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
[11] S. De Gois, L. Houhou, Y. Oda, M. Corbex, F. Pajak, E. The´venot, G. Vodjani, J. Mallet, S. Berrard, Is RE1:NRSE a common cis-regulatory sequence for ChAT and VAChT genes?, J. Biol. Chem. 275 (2000) 36683–36690. [12] M.-F. Diebler, M. Tomasi, F.-M. Meunier, M. Israe¨l, V. Dolez˘al, Influence of retinoic acid and cyclic AMP on the expression of choline acetyltranferase and of vesicular acetylcholine transporter in NG 108-15 cells, J. Physiol. (Paris) 92 (1998) 379–384. [13] V. Dolez˘al, X. Castell, M. Tomasi, M.F. Diebler, Stimuli that induce a cholinergic neuronal phenotype of NG108-15 cells upregulate ChAT and VAChT mRNAs but fail to increase VAChT protein, Brain Res. Bull. 54 (2001) 363–374. [14] L.E. Eiden, The cholinergic gene locus, J. Neurochem. 70 (1998) 2227–2240. [15] J.D. Erickson, H. Varoqui, M.K.H. Scha¨fer, W. Modi, M.F. Diebler, E. Weihe, J. Rand, L.E. Eiden, T.I. Bonner, T.B. Usdin, Functional identification of a vesicular acetylcholine transporter and its expression from a ‘‘cholinergic’’ gene locus, J. Biol. Chem. 269 (1994) 21929–21932. [16] E. Espinos, M.J. Weber, Activation of the MAP kinase cascade by histone deacetylase inhibitors is required for the stimulation of choline acetyltransferase gene promoter, Brain Res. Mol. Brain Res. 56 (1998) 118–124. [17] F. Fonnum, Isolation of choline esters from aqueous solutions by extraction with sodium tetraphenylboron in organic solvents, Biochem. J. 113 (1969) 291–298. [18] M.L. Gilmor, N.R. Nash, A. Roghani, R.H. Edwards, H. Yi, S.M. Hersch, A.I. Levey, Expression of the putative vesicular acetylcholine transporter in rat brain and localization in cholinergic synaptic vesicles, J. Neurosci. 16 (1996) 2179–2190. [19] R.H. Goodman, S. Smolik, CBP/p300 in cell growth, transformation, and development, Genes Dev. 14 (2000) 1553–1577. [20] M. Go¨ttlicher, S. Heck, P. Herrlich, Transcriptional cross-talk, the second mode of steroid hormone receptor action, J. Mol. Med. 76 (1998) 480–489. [21] B. Hamprecht, Structural, electrophysiological, biochemical and pharmacological properties of neuroblastoma glioma cell hybrids in cell culture, Int. Rev. Cytol. 49 (1977) 99–170. [22] L.B. Hersh, Induction of choline acetyltransferase in the neuroblastoma x glioma cell line NG 108-15, Neurochem. Res. 17 (1992) 1063–1067. [23] T. Holler, B. Berse, J.M. Cermak, M.-F. Diebler, J.K. Blusztajn, Differences in the developmental expression of the vesicular acetylcholine transporter and choline acetyltransferase in the rat brain, Neurosci. Lett. 212 (1996) 107–110. [24] Y. Huang, D. Hutter, Y. Liu, X. Wang, M.S. Sheikh, A.ML Chan, J. Nikki, N.J. Holbrook, Transforming Growth Factor suppresses serum deprivation-induced death of A549 cells through differential effects on c-Jun and JNK activities, J. Biol. Chem. 275 (2000) 18234–18242. [25] Y.T. Ip, R.J. Davis, Signal transduction by the c-Jun N-terminal kinase (JNK)-from inflammation to development, Curr. Opin. Cell Biol. 10 (1998) 205–219. [26] T. Kitamoto, W. Wang, P.M. Salvaterra, Structure and organization of the Drosophila cholinergic locus, J. Biol. Chem. 273 (1998) 2706–2713. [27] J.P. Luzio, B. Brake, G. Banting, K.E. Howell, P. Braghetta, K.K. Stanley, Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38), Biochem. J. 270 (1990) 97–102. [28] M.A. Malik, C.E. Greenwood, J.C. Blusztajn, B. Berse, Cholinergic differentiation triggered by blocking cell proliferation and treatment with all-trans-retinoic acid, Brain Res. 874 (2000) 178– 185. [29] M.D. Mark, D.R. Storm, Coupling of epidermal growth factor (EGF) with the antiproliferative activity of cAMP induces neuronal differentiation, J. Biol. Chem. 272 (1997) 17238–17244.
[30] R. McGee, P. Simpson, C. Christian, M. Mata, P. Nelson, M. Niremberg, Regulation of acetylcholine release from neuroblastoma glioma hybrid cell lines, Proc. Natl. Acad. USA 75 (1978) 1314–1318. [31] J.N. Miner, K.R. Yamamoto, Regulatory cross-talk at composite response elements, Trends Biochem. Sci. 16 (1991) 423–427. [32] H. Misawa, R. Takahashi, T. Deguchi, Coordinate expression of vesicular acetylcholine transporter and choline acetyltranferase in sympathetic superior cervical neurones, Neuroreport 6 (1995) 965–968. [33] J.M. Naciff, H. Misawa, J.R. Dedman, Molecular characterization of the mouse vesicular acetylcholine transporter gene, Neuroreport 8 (1997) 3467–3473. [34] A.J. Patel, A. Hunt, P. Seaton, The mechanism of cytosine arabinoside toxicity on quiescent astrocytes in vitro appears to be analogous to in vivo brain injury, Brain Res. 450 (1988) 378–381. [35] E.D. Roberson, J.D. English, J.P. Adams, J.C. Selcher, C. Kondratick, J.D. Sweatt, The mitogen-activated protein kinase cascade couples PKA and PKC to cAMP response element binding protein phosphorylation in area CA1 of hippocampus, J. Neurosciences 19 (1999) 4337–4348. [36] R.N. Rosenberg, C.K. Vance, M. Morrison, N. Prashad, J. Meyne, F. Baskin, Differentiation of neuroblastoma, glioma, and hybrid cells in culture as measured by the synthesis of specific protein species: evidence for neuroblast-glioblast reciprocal genetic regulation, J. Neurochem 30 (1978) 1343–1355. [37] B. Rouzaire-Dubois, J.M. Dubois, Tamoxifen blocks both proliferation and voltage-dependent K+ channels of neuroblastoma cells, Cell Signal 2 (1990) 387–393. [38] O.M. Seternes, B. Johansen, U. Moens, A dominant role for the Raf-MEK pathway in forskolin, 12-O-tetradecanoyl-phorbol acetate, and platelet-derived growth factor-induced CREB (cAMP-responsive element-binding protein) activation, uncoupled from serine133 phosphorylation in NIH 3T3 cells, Mol. Endocrinol. 13 (1999) 1071–1083. [39] A.J. Shaywitz, A.E. Greenberg, CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals, Ann Rev. Biochem. 68 (1999) 821–861. [40] G. Shiff, N. Morel, Association of syntaxin with SNAP-25 and VAMP (synaptobrevin) during axonal transport, J. Neurosci. Res. 48 (1997) 313–323. [41] M. Shimojo, D. Wu, L.B. Hersh, The cholinergic gene locus is coordinately regulated by protein kinase A II in PC12 cells, J. Neurochem. 71 (1998) 1118–1126. [42] P.S. Thomas, Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose, Proc. Natl. Acad. Sci. USA 77 (1980) 5201–5205. [43] X. Tian, X. Sun, J.B. Suszkiw, Developmental age-dependent upregulation of choline acetyltransferase and vesicular acetylcholine transporter mRNA expression in neonatal septum by nerve growth factor, Neuroscience Lett. 209 (1996) 134–136. [44] H. Varoqui, M.-F. Diebler, F.-M. Meunier, J.B. Rand, T.B. Usdin, T.I. Bonner, L.E. Eiden, J.D. Erickson, Cloning and expression of the vesamicol binding protein from the marine ray Torpedo, FEBS Lett. 342 (1994) 97–102. [45] H. Varoqui, F.-M. Meunier, F.A. Meunier, J. Molgo, S. Berrard, R. Cervini, J. Mallet, M. Israe¨l, M.-F. Diebler, Expression of the vesicular acetylcholine transporter in mammalian cells, Progress in Brain Research 109 (1996) 83–95. [46] S. Vyas, N. Faucon Biguet, J. Mallet, Transcriptional and post transcriptional regulation of tyrosine hydroxylase by proteine kinase C Embo J. 9 (1990) 3707–3712. [47] Z.G. Zhong, H. Misawa, S. Furuya, Y. Kimura, M. Noda, S. Yokoyama, H. Higashida, Overexpression of choline acetyltransferase reconstitutes discrete acetylcholine release in some but not all synapse formation-defective neuroblastoma cells, J. Physiol. (Paris) 89 (1995) 137–145.
More than one way to toy with ChAT and VAChT Xavier Castella, Marie-Franc¸oise Dieblera,*, Monique Tomasia, Claire Bigaria, Ste´phanie De Goisb, Sylvie Berrardb, Jacques Malletb, Maurice Israe¨la, Vladimı´r Dolez˘alc a
Laboratoire de Neurobiologie Cellulaire et Mole´culaire, CNRS, 91198 Gif-sur-Yvette, Cedex, France b LGN. CNRS, Hoˆpital Pitie´-Salpeˆtrie`re, Paris, France c Institute of Physiology, Prague, Czech Republic
Abstract Expression of choline acetyltransferase (ChAT) and of the vesicular acetylcholine transporter (VAChT) is required for the acquisition and the maintenance of the cholinergic phenotype. The ChAT and VAChT genes have been demonstrated to share a common gene locus and this suggests a coordinate regulation of their expression. In the present work, we examined the effects of several differentiating treatments on the modulation of ChAT and VAChT expression at the mRNA and protein levels in growing and differentiating NG108-15 cells. In cells grown in the presence of serum, all the agents tested—retinoic acid, dexamethasone and dibutyrylcyclicAMP (dbcAMP)—induced an increase of ChAT and VAChT mRNA levels but with different efficacy. Treatment with dbcAMP plus dexamethasone resulted in the largest increase of VAChT mRNA amount while retinoic acid mostly enhanced ChAT mRNA level. However, while ChAT activity was increased by all agents, no change in the VAChT protein level was detected. In cells differentiated by serum deprivation, only retinoic acid was effective in inducing an increase of VAChT and ChAT mRNA and ChAT activity, while we observed a downregulation by dbcAMP and dexamethasone. Treatment with the antimitotic agent cytosine arabinoside led to an increase of ChAT activity which was further largely enhanced by the addition of dbcAMP plus dexamethasone, but to only a slight change in VAChT activity. We further showed that complex glycosylation processes which might play a role in targeting and/or stability of the membrane protein VAChT are deficient in these cells. Indeed, in transient transfection assays with the reporter soluble enzyme luciferase placed under regulatory and promoter regions of the VAChT gene, we observed a modulation of luciferase expression by differentiating agents. These data illustrate the complexity of the processes which participate to the expression of the ChAT and VAChT genes, both at the transcriptional and posttranslational levels. # 2002 Elsevier Science Ltd. All rights reserved. Keywords: Choline acetyltransferase; Vesicular acetylcholine transporter; NG108-15; Cholinergic differentiation; Cyclic AMP; Dexamethasone
1. Introduction Coexpression in the same cell of the enzyme which synthesizes acetylcholine—the choline acetyltransferase (ChAT)—and of the transporter which ensures storage and concentration of the transmitter into synaptic vesicles—the vesicular acetylcholine transporter (VAChT)— is a prerequisite for a neuron to be cholinergic. In all species examined so far, the ChAT and VAChT genes are arranged in a common locus, referred to as ‘‘the cholinergic locus’’ [15], where the VAChT gene is inserted within the ChAT gene [1,4,15,26,33]. This unusual genomic organization forms a potentially favorable structural arrangement to support a coordinate regulation of the transcription of both genes, and in fine, for the two proteins to be co-expressed in cholinergic neu* Corresponding author. Tel.: +33-1-69-82-36-71; fax: +33-1-6982-94-66. E-mail address: [email protected]
rons. Indeed, while in mammalian, generation of specific transcripts of the ChAT and VAChT genes might result from the use of common and/or specific promoters [9], (for review see [14]), the recent study of De Gois et al. (2000) [11] indicates that the restricted expression of both genes to neuronal cells may be governed by a silencer element located upstream from the ChAT and VAChT coding regions. In addition, evidence for a coordinate up- or down- regulation of ChAT and VAChT mRNA levels by several differentiating agents came from several studies on different cellular models [5,6,7,32]. However, examples of regulatory processes specific for either ChAT or VAChT are now arising. The VAChT gene requires distinct control elements for a restricted expression in cholinergic neurons [11]. Uncoupling of the levels of specific transcripts, in space as shown in Drosophila [26] or in time as during vertebrate brain development ([23,43]) suggests the possibility of an independent regulation, either through a separate control of the activity of
0928-4257/02/$ - see front matter # 2002 Elsevier Science Ltd. All rights reserved. PII: S0928-4257(01)00081-X
62
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
Nomenclature ChAT Choline acetyltransferase CREB cAMP responsive element binding protein ERK extra-cellular regulated kinase GPDH glyceraldehyde-3-phosphate deshydrogenase JNK c-jun N-terminal kinase MAP mitogen activated protein MEK MAP/ERK Kinase PKA protein kinase A PKC protein kinase C VAChT vesicular acetylcholine transporter
specific promoters or through posttranscriptional mechanisms. In addition, recent studies on cell lines provide evidence for a dissociated regulation of mRNA and protein, both for ChAT [28] or VAChT [13]. In the present report, we have been using the NG 10815 cell line as a model to further explore the regulation and the expression of ChAT and VAChT during differentiation. As a way to mimic crucial stages of the neuronal development, cells were either allowed to proliferate in the presence of serum (and the growth factors it contained) or to stop dividing by serum starvation or by exposure to the antimitotic agent cytosine arabinoside in the presence of serum. The influence of different agents previously shown to increase ChAT activity in dividing cells was analyzed on neuronal phenotypic markers and on the expression of ChAT and VAChT. The results show that although the different stimuli used in this study were able to promote neuronal differentiation and modulate the transcription of the cholinergic locus, the amount of the VAChT protein was poorly regulated. However, transient transfection experiments with a construct in which the luciferase reporter gene was placed under the control of regulatory and promoter sequences of the VAChT gene, showed that modulation of this soluble enzyme by differentiating agents followed the pattern expected from VAChT mRNA studies. The data suggest that additional posttranslational processes, possibly complex glycosylations, participate in the control of the level of a fully mature membrane protein as VAChT.
2. Materials and methods 2.1. Materials All cell culture reagents came from Life Technologies. Stock solutions of all-trans-retinoic acid, dexametha-
sone, dibutyryl-cyclicAMP (dbcAMP) and cytosine arabinoside (Sigma) were made in distilled water or ethanol (retinoic acid) and diluted at least to 1% in the culture medium. [3H] acetyl-CoA (4 Ci/mmol) and L[3H] vesamicol (31Ci/mmol) were from New England Nuclear. Acetyl-CoA and bovine serum albumin were purchased from Boehringer. L-vesamicol was from RBI Biochemicals. All other chemicals were of the highest available purity. The monoclonal antibody against synaptophysin was purchased from Roche (France); the rabbit polyclonal antiserum against SNAP25 and the monoclonal antibodies anti rab5 and anti synaptobrevin (VAMP 2, clone 69.1) were from Synaptic Systems (Germany). The monoclonal antibody against bIII tubulin was from Promega (France). The monoclonal antibodies against SV2 and against N-CAM were obtained from the Developmental Studies Hybridoma Bank (University of Iowa, USA). Antisera against the C-terminal part of the rat VAChT [5] and against synaptotagmin [40] have been previously characterized. Secondary antibodies, horseradish peroxidase- and fluorescein isothiocyanate- (FITC) conjugated IgG were from Pasteur Production (France). SeeBlue prestained molecular weight markers were from Novex. 2.2. Cell culture Cell cultures were usually carried out in 12 wellplates. In proliferating conditions, NG 108-15 cells were plated at a density of 12 103 and maintained in the presence of 5% non inactivated fetal calf serum less than 6 months old [37]. Drugs were added 6–8 h after the seeding and the treatment was continued for 4 days without changing the medium. For serum starvation experiments, cells were seeded at a density of 120 103 and were first maintained for 24 h in a serum containing medium as described above. The medium was then replaced by a serum free defined medium containing 6 mg/ml bovine serum albumin and the test substances. Cells were harvested 6 days later. For experiments on cell proliferation inhibition in the presence of non-inactivated serum, cells were seeded at a density of 120103 and except in concentration-response experiments, they were treated with 1 mM cytosine arabinoside together with the test compounds. Forty hours later, the medium was replaced by a fresh medium containing only the test substances. Cells could be maintained for at least 5 days without changing the medium. In all the present experiments, we periodically replaced high-passage cultures (around 20) by fresh low-passage stocks (< 4). After either treatment, cells were harvested and washed in phosphate-buffered saline (PBS) and collected by centrifugation at 180g for 5 min. For ChAT measurement, vesamicol binding assay and protein determination, cells were disrupted in the presence of a
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
cocktail of protease inhibitors either by homogenization [45] or osmotic lysis and homogenization in 10 mM phosphate buffer [5]. Transient transfection experiments were performed as described by De Gois et al. (2000) [11], using the pl-123 reporter construct in which the luciferase gene was placed under the control of regulatory and promoter regions of the VAChT gene.
63
experiments and unless otherwise stated, 30 cycles of amplification were then routinely carried out. PCR products were electrophoresed on a 1.2% agarose gel, stained with ethidium bromide and visualized under UV light. Signal intensities were quantified on scanned images (Adobe Photoshop 4.0 and SigmaGel softwares). No signal was detected in RT samples. 2.5. ChAT assay
2.3. Northern blot analysis Northern blot analysis was performed as previously described [13]. Briefly, 15–30 mg of total RNA was sizeelectrophoresed and transferred to nitrocellulose membranes as described by Thomas (1980) [42]. cDNA probes (rat VAChT and rat ChAT) were 32P-labeled by the random primer labeling technique (NonaPrimer kit, Appligene). 2.4. RT-PCR Total RNA was extracted from 0.5 to 1106 cells using the RNeasy protocol (Qiagen). Homogenization of the fresh cell lysates was routinely done with Qiashredder columns (Qiagen). RNA recovery was quantified spectrophotometrically at 260 nm and further assessed by gel electrophoresis. Single strand cDNAs were synthesized with Superscript II reverse transcriptase (Life Technologies) using random hexamers as primers and 2 mg total RNA in a final volume of 20 ml. Samples were run in parallel in the absence of RT-polymerase (RT samples). One microliter (GPDH amplification) or 6 ml (ChAT or VAChT amplification) of the cDNA solutions were PCR amplified in a 25 ml reaction mixture which contained 200 mM dNTPs, 0.75 U of Taq DNA polymerase in buffer supplied by the manufacturer (Life Technologies) with 0.2 mM of each primer. Rat primers were as follows: ChAT S: 50 TACAGGCTTTACCAGAGACTGG TG 30 (1508-1531) AS: 50 AACTGGAGATGCAGAAG GTGATGG 30 (1965-1941) VAChT S: 50 CACCAAACTGTCGGAAGCGGTG 30 (43-64) AS: 50 GCAGCGAAGAGCGTGGCATAGTC 30 (544-522) GPDH S: 50 AGTGGAGATTGTTGCCATCA 30 (121-141) AS: 50 ACGGACACATTGGGGGTAGG 30 (768-747)
ChAT activity was quantified by the modified method of Fonnum (1969) [17], as described by Berrard et al. (1995) [5] using [3H] acetyl-CoA as a substrate. ChAT specific activity was expressed as pmol of [3H] acetylcholine that had been synthesized per mg protein and per 15 min incubation at 37 C. 2.6. L-[3H] Vesamicol binding The binding of L-[3H] vesamicol, a specific ligand of VAChT, was measured on lysed cells as previously described [45]. 2.7. Western blot analysis Lyophilized cell lysates (30–100 mg protein) were dissolved in lysis buffer containing 5% sodium dodecylsulfate (SDS) and 50 mM dithiothreitol as previously described [13]. Proteins were electrophoresed in 4–20% SDS-polyacrylamide minigels and transferred to nitrocellulose. Western blotting was performed with specific antibodies and peroxidase—conjugated secondary antibody. Immunoreactivity was visualized by enhanced chemiluminescence on film (Pierce). 2.8. Immunocytochemistry Cells cultured on glass coverslips coated with polyornithine were fixed and permeabilized with ice cold acetone or methanol as previously described [13]. Non specific binding was blocked by incubation with PBS containing 2% bovine serum albumin (BSA) for 15 min. Cells were then incubated for 3 h with the primary antibody diluted in PBS-1% BSA. Secondary antibody conjugated to fluorescein isothiocyanate (FITC) was used to visualize immunoreactivity. Blocking and immunolabeling steps were performed at room temperature and cultures were thoroughly rinsed with PBS after all steps. Samples mounted with Vectashield (Vector) were examined using epifluorescence microscope. 2.9. Protein determination
Cycle times were 30 s at 94 C, 30 s at 60 C (ChAT amplification) or 67 C (VAChT amplification) or 54 C (GPDH amplification), 30 s at 72 C. The number of cycles were optimized for each cDNA in preliminary
Protein content was determined by the method of Bradford (1976) [8] using bovine serum albumin as a standard.
64
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
3. Results 3.1. Effects of differentiating agents in growing conditions The hybrid NG 108-15 line, which was generated by fusing the glioma C6-BU-1 and the neuroblastoma N18TG2 lines, has been previously demonstrated to display many neuronal traits [21,36]). As evidenced in Fig. 1, all cells were stained for the neuronal marker bIII tubulin. Although the two parental cells are unable to synthesize ACh, the hybrid NG 108-15 line has been long ago recognized as a cholinergic cell line on the basis of the presence of a ChAT activity and the release of the synthesized neurotransmitter after differentiation [21,30]. All our experiments were carried at low passages and ChAT activity remained fairly stable, around 1 pmol [H3] ACh synthesized per mg protein and 15 min. Surprisingly, we recently showed that a panel of differentiating treatments which were optimized according to their stimulatory effects on ChAT activity (Fig. 2A) were unable to bring about a parallel increase of the VAChT protein [12,13]. These treatments were applied for 4 days on cells proliferating up to confluence and consisted of : 1 mM retinoic acid (R), 1 mM dbcAMP (A), 0.1 mM dexamethasone (D) and the combination 0.2 mM dbcAMP plus 0.1 mM dexamethasone unless otherwise stated (AD). In the experiments illustrated in
Fig. 2B, the amount of VAChT protein was assessed by the binding of its specific ligand, vesamicol [2,44], and immunoblotting. No significant change in vesamicol binding could be observed with either treatment. VAChT is a glycosylated protein which is usually detected around 64–80 kDa [3,5,18,23,44], but the immunoreactivity was visualized here as a peptide of a small size around 33 kDa. Nonetheless, ChAT and VAChT mRNAs were upregulated by all treatments. In addition, different ratios of ChAT and VAChT mRNA levels were observed, depending on the agent used to differentiate the cells. As shown on Northern blots (Fig. 3), the combined addition of dbcAMP and dexamethasone was the most effective treatment to enhance VAChT mRNA amount, while the highest ChAT mRNA level was observed in the presence of retinoic acid.
4. Expression of ChAT and VAChT in NG cells differentiated in serum-free medium 4.1. Expression of common neuronal vesicular markers The next experiments were designed to create unfavorable conditions for cell proliferation and to induce a morphological differentiation towards a mature neuronal phenotype. To this purpose, we first removed the
Fig. 1. bIII- tubulin immunodetection in NG108-15 cells. Cells grown for 4 days in the presence of serum in control conditions (C) or in the presence of dbcAMP and dexamethasone (AD) were fixed in methanol as described in methods and stained with anti bIII-tubulin antibody. Immunoreactivity detected with a FITC conjugated secondary antibody was examined with epifluorescence microscopy.
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
65
Fig. 2. Effect of differentiation agents on ChAT and VAChT proteins. NG cells were grown for 4 days in the presence of serum and various differentiating agents: R, 1 mM retinoic acid; A, 1 mM dbcAMP; D, 1 mM dexamethasone; AD, 1 mM dbcAMP+1 mM dexamethasone. A. ChAT activity is expressed as fold increase of control values. Results are from 9 to 21 measurements. Control activity was 0.95 0.03 pmol [3H] ACh/mg protein/15 min. B. Vesamicol binding measured at 18 nM is expressed relative to control values. Data are from four independent experiments. C. Immunodetection of VAChT on western blot. Cell lysates (100 mg) and a mouse brain homogenate (first lane; 100 mg) were fractionated using 4–20% SDS PAGE. Western immunoblotting was performed with a rat VAChT antibody (1/5000) directed against the C-terminal part of the VAChT protein, and with ECL detection. The same blot without dehybridization was used for rab5 detection, as an internal control. Scale on the right indicates the position of molecular weight markers. The blot presented is representative of at least five experiments.
ing and in serum-free non proliferating conditions. In contrast to cells grown in the presence of serum where the low basal expression of common vesicular proteins (synaptophysin, SV2, synaptotagmin, VAMP) was increased by the addition of dbcAMP [13], serum deprivation alone was sufficient to induce a tremendous rise of these vesicular antigens; as illustrated in Fig. 5 for VAMP and SV2, addition of other agents did not yield further significant changes. 4.2. Expression of ChAT and VAChT
Fig. 3. Northern blot analysis of ChAT and VAChT mRNA levels under various differentiating treatments. Cells were treated for 2 days with 1 mM retinoic acid (R), 0.1 mM dexamethasone (D) or 0.2 mM dbcAMP+0.1 mM dexamethasone (AD). RNA preparations (30 mg) were first hybridized with a rat ChAT cDNA, stripped, and re-hybridized with a rat VAChT cDNA. The blot presented is representative of at least three to four experiments.
serum from the growth medium. NG108-15 cells grown in a serum-free medium displayed extensive morphological differentiation; they extended long, thin processes, decorated with many varicosities. Immunostaining of SNAP 25, a marker of synaptic plasma membranes and of VAMP (or synaptobrevin), a synaptic vesicle marker, illustrated these morphological changes, as shown in Fig. 4. VAMP immunostaining, which was mostly detected in the Golgi apparatus in control cells (+ serum), was largely enhanced by serum starvation and was concentrated at the tip of the processes and within the varicosities. Expression of vesicular antigens upon addition of differentiating agents was further analyzed on Western blots of sister cultures grown in proliferat-
ChAT activity of cells cultured for six days in a serum-free medium was slightly lower but not significantly different from that observed in cells grown for 4 days up to confluence in a serum containing medium. Further exposure to our panel of differentiating agents (see above) produced a mixed profile of changes (Fig. 6A). Retinoic acid became the only agent still able to upregulate ChAT activity whereas all other agents, alone or in combination, induced a downregulation of ChAT. As shown in Fig. 6B, the concentration-response curve for dexamethasone inhibitory effect was similar to that seen for the stimulatory effect in the presence of serum [13]; it was maximal at 30 nM and did not exceed 50% of control values. Consistent with the data on protein, ChAT mRNA abundance was increased in retinoic acid treated cells and it was accompanied by parallel changes in VAChT mRNA (Fig. 6C). However, none of these treatments produced significant changes in VAChT protein expression as assayed by vesamicol binding. It thus appears that, although serum deprivation does induce the expression of some vesicular proteins characteristic of a mature neuronal cell, it does not
66
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
Fig. 4. Effect of serum deprivation on differentiation. Cells grown in the absence of serum extended long processes. Upper line: immunodetection of the vesicular marker VAMP performed on cells fixed with methanol, shows increased expression and accumulation of the protein at the tips of the processes and in the varicosities. Lower line: immunodetection of the plasma membrane marker SNAP 25.
Fig. 5. Effect of serum deprivation on VAMP and SV2 expression. Cells were grown in the presence (+ serum) or in the absence of serum (0 serum). Cell lysates (30 mg) were analysed by Western blotting with a monoclonal SV2 antibody (1/50) and with a monoclonal VAMP antibody (1/500). Data presented are representative of at least 3 experiments.
have the capacity to support the expression of a cholinergic phenotype. 4.3. Effect of PKC depletion We next sought for the involvement of PKC in the opposite changes by dexamethasone or dbcAMP on ChAT activity under proliferating or non proliferating conditions as described above. To induce PKC depletion, we used a long-term exposure to the phorbol ester TPA [46]. Time course studies from 1 to 6 days exposure (data not shown) showed that TPA effects (0.5 mM) on ChAT activity were delayed. As shown in Fig. 7, application of TPA alone for 6 days produced a decrease of ChAT activity both in the presence and the absence of serum (30 and 31%, respectively). Furthermore, the TPA treatment prevented the stimulatory effects of both dbcAMP and dexamethasone in the presence of serum. The inhibitory effects of TPA, dbcAMP and dexamethasone on ChAT activity observed in the absence of serum (Figs. 6A and 7A) were not additive (Fig. 7B). In contrast, the stimulatory effect of retinoic acid was preserved in serum free medium and in the presence of
TPA both in serum containing and serum free medium (Figs. 6A, 7A and B). The differentiation profile in TPA-treated cells thus resembles that observed in cells cultured in serum-free medium, suggesting that PKC signaling might be involved in mediating the upregulation of ChAT activity by dexamethasone and dbcAMP in the presence of growth factors contained in serum.
5. Effects of chemical arrest of cell proliferation in the presence of serum 5.1. Effect of cytosine arabinoside on neuronal differentiation In the next set of experiments, cell proliferation was blocked by application of the antimitotic agent cytosine arabinoside (Ara-C) in the continuous presence of growth factors contained in serum. Because of the drug toxicity, we first had to establish an experimental protocol which would allow a prolonged observation. Different concentrations of Ara-C were applied for various length of time on cells seeded at high density and grown
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
67
Fig. 6. Effect of differentiating agents on ChAT activity and on ChAT and VAChT mRNAs in the absence of serum. NG cells were grown for 6 days in the absence of serum and treated with various differentiating agents: R, 1 mM retinoic acid; A, 0.2 mM dbcAMP; D, 0.1 mM dexamethasone; DR, 1 mM retinoic acid+0.1 mM dexamethasone; AD, 0.2 mM dbcAMP+0.1 mM dexamethasone. A. ChAT activity is expressed as fold increase of control values. Data are average S.E.M. values of four independent experiments. Control value was 0.93 0.11 pmol [3H] ACh/mg protein/15 min. B. Concentration-response curve of dexamethasone inhibitory effect on ChAT activity is expressed as a fraction of control values. Each point represents mean S.E.M. of three values. C. Northern blot analysis was performed on total RNA (15 mg) extracted from cells grown for 7 (7d) or 11 (11d) days in the absence of serum. The blot was hybridized with the radiolabeled ChAT probe, stripped and rehybridized with the radiolabeled VAChT probe.
Fig. 7. Effect of TPA on ChAT activity. NG cells were grown for 4 days in the presence of serum (A) or for 6 days in the absence of serum (B) and the indicated drugs in the presence of 0.5 mM TPA: C, no TPA; R, 1 mM retinoic acid; A, 0.2 mM dbcAMP; D, 0.1 mM dexamethasone. ChAT activity is expressed as a fraction of corresponding control values. Data are average S.E.M. values of four independent experiments. Control values in pmol [3H] ACh/mg protein/15 min, were 1.2 0.16 and 0.83 0.06 for A and B, respectively.
in the presence of serum. Fig. 8 shows ChAT activity (Fig. 8B) in one of these experiments where increasing concentrations of Ara-C were continuously present for 60 h prior to harvesting. This treatment induced about a two fold increase of ChAT activity but resulted in a sharp drop of protein content (Fig. 8A). The cells survived better when the time of the treatment with Ara-C was shortened. When applied at the concentration of 1 mM for 36–40 h and then removed, the cells survived well for at least the next 7 days, with no major morphological changes (not shown). This procedure was then routinely used for the next experiments and referred to as ‘‘Ara-C’’ treated cells. Parallel experiments were done in the continuous presence of differentiating agents. Additional application of dbcAMP in combina-
tion with dexamethasone, which we found the most efficient differentiating association on cells grown in the presence of serum ([13] and see above), induced the expected changes in cellular morphology. Cells formed small clusters at the border of which long processes were emitted far off the cell body. However, cells bodies and processes were loosely attached to the surface of the dish and tended to float in the medium. Immunocytochemical studies were thus unsuccessful. Neuronal differentiation was checked by Western blot experiments. As illustrated in Fig. 9, immunoreactivity of VAMP and SV2 was increased in Ara-C treated cells and application of dbcAMP plus dexamethasone further enhanced the abundance of these vesicular antigens. A similar observation was made for synaptophysin (not shown).
68
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
Fig. 8. Concentration-dependence of the effect of Ara-C on protein content and ChAT activity. Cells were grown in a serum containing medium and in continuous presence of the indicated concentrations of Ara-C for 60 h. Results are mean S.E.M. of three values. A, Protein per well. B, ChAT activity.
Fig. 9. Effects of Ara-C on the expression of the vesicular antigens VAMP and SV2. Ara: cells grown in the presence of serum were exposed for 36 h to 1 mM Ara-C and then further cultured for 6 days without Ara-C: Ara+AD: 0.2 mM dbcAMP+0.1 mM dexamethasone were continuously present in the culture medium. C: control cells grown for 4 days up to confluence without any treatment. Immunodetection of VAMP and SV2 on cell lysates (40 mg) was performed as described in Fig. 5. The blots are representative of three experiments.
5.2. Effect of cytosine arabinoside on ChAT and VAChT expression Fig. 10A shows that ChAT activity was about 8-fold higher in Ara-C treated cells than in control cells (namely, cells proliferating up to confluence for 4 days in the absence of any agent). Upregulation of ChAT activity appeared with some delay and no significant change in ChAT activity was seen immediately after the 40 h lasting treatment with Ara-C. The continuous presence of dexamethasone or of dbcAMP plus dexamethasone caused a further stimulation of ChAT activity. The highest level of ChAT was observed with the latter combination: with an approximate 15-fold enhancement over control, it appeared that the Ara-C treatment amplified the effects of the two other drugs.
Duration of Ara-C application was very critical and a treatment prolonged to 48–52 h (not shown) resulted in only a 3-fold increase of ChAT in the absence of any other agent. However, the presence of dbcAMP plus dexamethasone led to a comparable total increase of ChAT activity in the 6-day-old cultures. By contrast, the stimulatory effect of retinoic acid on ChAT activity was of similar magnitude in controls and Ara-C treated cells (not shown). Vesamicol binding assays (Fig. 10B) showed that the largest increase of ChAT activity (up to 15-fold in the presence of dbcAMP+dexamethasone) was accompanied by a distinct but still rather modest concomitant increase in VAChT protein level. Changes in mRNA abundance, followed by RT-PCR techniques, indicated that both ChAT and VAChT mRNAs were upregulated, but with a different time course (Fig. 10 C, D). While VAChT mRNA was already augmented after the 40 h of Ara-C application as compared to cells grown without the drug, only a slight increase of ChAT mRNA, if any, could be detected. Similar increases were observed for ChAT and VAChT mRNA levels on AraC treated cells receiving an additional treatment with differentiating agents. This upregulation was specific as none of the treatments affected the mRNA level of the ubiquitous enzyme GPDH.
6. Glycosylation of membrane proteins in NG 108-15 cells The question of a defective machinery for complex glycosylations in NG 108-15 cells was further examined by analyzing the immunoreactive profile of another
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
69
Fig. 10. Effects of Ara-C on ChAT and VAChT expression. A–B: ChAT and VAChT proteins. Cells were treated for 30 h with Ara-C (+Ara) and no further addition (C) or in the presence of the indicated drugs: D, 0.1 mM dexamethasone; AD, 0.2 mM dbcAMP+0.1 mM dexamethasone. ChAT activity (A) and vesamicol binding measured at 60 nM (B) are expressed relative to control values which were cells grown for four days up to confluence without any treatment (C, left bar). Results are mean S.E.M of two to three independent experiments. C–D: ChAT and VAChT mRNAs. The cDNA resulting from reverse transcription of 0.125 mg (ChAT), 0.075 mg (VAChT) or 0.062 mg (GPDH) of total RNA was subjected to PCR with the primers described in Methods. C: cells seeded at confluence were treated with 1 mM Ara-C for 30 h (Ara) or maintained in the absence of drug (C). Three independent seedings are presented. D: Differentiating agents were combined with a 30 h-treatment with Ara-C (+Ara) as described in Fig. 9: D: 0.1 mM dexamethasone; AD: 0.2 mM dbcAMP+0.1 mM dexamethasone; C: Ara-C treatment alone with no further addition. Data from two independent seedings, representative of four experiments. PCR products were visualized on agarose gels with ethidium bromide and UV light.
highly glycosylated protein, the resident Golgi protein TGN 38. While the polypeptide has a predicted size of 38 kDa, its apparent Mr on SDS/PAGE is usually around 85–90 kDa, due to extensive N- and O- posttranslational glycosylations [27]. Fig. 11 shows that, in contrast to the parental C6-BU-1 cells which produced a mature protein of the expected size, NG108-15 cells were unable to achieve the predicted glycosylations.
of NG108-15 cells were performed with plasmid constructs where the coding sequence of the soluble enzyme luciferase was placed under the control of promoter and regulatory regions of the VAChT gene. With the exception of retinoic acid, luciferase activity was stimulated by all the treatments which were shown to upregulate ChAT activity, demonstrating a coregulation of the reporter and the endogenous ChAT and VAChT genes (Fig. 12).
7. Transfection studies 8. Discussion To further assess whether post-translational modifications were key regulatory steps in the availability of the membrane protein VAChT, transient transfections
Cholinergic cell lines offer the possibility to explore the influence of regulatory molecules on the expression
70
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
of the cholinergic locus and its coupling to neuronal differentiation. The drawback of using cells of tumor origin can in fact turn out as an advantage, as it might reveal checkpoints and cooperative regulatory mechanisms that are normally involved in the expression of a mature neuronal transmitter phenotype. Numerous data in the literature support the hypothesis that neuronal differentiation is linked to the arrest of cell proliferation. Changing culture conditions allows one to study the expression of neuronal and transmitter markers in relation to the proliferation status of the cells. To this end, we used here the NG108-15 cell line, a well characterized hybridoma cell line [21,22,47] to combine proliferative or non proliferative culture conditions with differentiating agents selected in a previous study for their ability to increase ChAT activity [13]. As judged from the presence of bIII tubulin and of a basal ChAT activity, all cells were committed towards a neuronal cholinergic phenotype. However, they had low
Fig. 11. Immunodetection of the integral membrane protein of the trans-Golgi network TGN 38. Western blot analysis was performed on C6-BU-1(C) and NG 108-15 (N) cell lysates (50 mg) using a monoclonal TGN 38 antibody (1/500). Arrows indicate the estimated apparent molecular weight.
Fig. 12. Luciferase activity in transfected cells. NG 108-15 cells were transiently transfected with plasmid constructs containing the coding sequence of the soluble luciferase protein under the control of promoter and regulatory regions of the VAChT gene. Transfected cells were grown for 2 days in the presence of serum and treated with various differentiating agents: C, no treatment; R, 1 mM retinoic acid; D, 0.1 mM dexamethasone; AD, 0.2 mM dbcAMP+0.1 mM dexamethasone. Luciferase activity was normalized for transfection efficiency as described by De Gois et al. (2000) [12]. Data from seven independent experiments are expressed relative to control values.
levels of synaptic vesicle proteins. Consequently, upregulation of vesicular proteins was used here as a hallmark for neuronal differentiation, in addition to morphological criteria such as neurite outgrowth. Ongoing immuno-electronmicroscopy experiments will show if these proteins are assembled in true synaptic vesicles. High expression of vesicular proteins was observed when cell division was either stopped by serum deprivation or partly inhibited by exposure to a permeable analog of cAMP, two procedures which promoted an extensive morphological differentiation. The antimitotic agent cytosine arabinoside alone induced a moderate increase in vesicular proteins, with no major morphological changes, which was further stimulated by dbcAMP. As the mechanisms underlying the antiproliferative activity of these procedures differ, this suggests that inhibition of cell growth is not sufficient to promote the upregulation of vesicular proteins. Involvement of the MAP kinase cascades in combination with the cAMP signal transduction pathway in the signaling of differentiation has been largely documented in PC12 cells [10,29]. It is likely that these signaling pathways participate in the induction of the expression of the vesicular antigens observed here. Serum deprivation was shown in different cell systems ([24] and references within) to alter the raf/MEK/ERK protein kinase cascade normally regulated by growth factors and to activate the JNK pathway which plays a key role in activating several transcription factors (for review, [25]); one hypothesis is that this pathway is involved in mediating the upregulation of the vesicular proteins studied here. Experiments using specific inhibitors will help to elucidate the participation of either cascades in the presence or the absence of serum. The present experiments show that differentiation as judged by the above criteria and upregulation of ChAT activity were not supported by the same regulatory mechanisms. To the extent that mRNA amounts reflect gene transcription levels, stimulation of the expression of ChAT and VAChT genes occurred when cell growth was inhibited but only when the culture medium was supplemented with serum. The use of unheated and less than 6-month-old serum was crucial, indicating that the unidentified growth factors and/or neurotrophins involved in this upregulation are fragile. Cell division arrest by cytosine arabinoside was sufficient to induce an upregulation of ChAT activity, in agreement with reports on primary cultures of cholinergic cells [34]. Furthermore, dbcAMP and dexamethasone transducing pathways and cell growth arrest signalings acted synergistically to promote an upregulation of ChAT and VAChT expression, the combined treatments resulting in larger increase of ChAT activity than in growing cells (this study, [13]). By contrast, cessation of proliferation by serum starvation failed to support an upstimulation of ChAT activity. In some experiments, ChAT activity
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
of cells cultured in serum free medium was somewhat lower than those of sister cells grown in the presence of serum, but this was not significantly different. However, the stimulatory effects of dbcAMP and dexamethasone, observed alone or in combination in the presence of serum, were abrogated by the absence of growth factors. It is expected that serum deprivation as well as a prolonged TPA treatment, changed the pattern of intrinsic set of signaling cascades which contribute to cAMP dependent transcriptional synergy or repression (see [38]; for review, [19,20,31]). Likewise, Berse and Blusztajn [7] reported a cell type specific up or down modulation of ChAT and VAChT mRNAs by dexamethasone in PC12 and SN56 cells. While the study of Shimojo et al. (1998) [41] emphasized the role of PKA in controlling the regulation of both ChAT and VAChT genes in PC12 cells, little is yet known on the pairing of signaling cascades in the expression of the cholinergic locus in other systems. Indeed, cAMP transducing pathways through PKA and PKC activation are multiple, including a direct phosphorylation of CREB and the activation of B-raf/MEK/ERK cascades (for example, see [39] and for review, [35]). Activation of the MAP kinase cascade, which occurred in response to extracellular stimuli (i.e. growth factors) seemed to be required to upregulate transcription of the ChAT gene [16]. Interestingly, retinoic acid whose activity is mediated by nuclear receptor, upregulated ChAT and VAChT mRNAs and ChAT activity, regardless of the presence of serum (this study) or the cell type [7]. The intriguing observation reported in this study and previous works [12,13]) is that the VAChT protein level does not follow its messenger level. Differentiation of the cells in the presence of cytosine arabinoside with treatments which prompted up to a 15-fold increase of ChAT activity, induced only a modest increase of the binding of its specific ligand [2,44]. The absence of a functional VAChT protein in NG108-15 cells was suggested by the experiments of Zhong et al. [47], showing that differentiating treatments were unable to stimulate the formation of a granular acetylcholine pool. In addition, the VAChT protein was detected on Western blot as a peptide of small molecular weight (this study, [12,13]). As exemplified on the Golgi protein TGN38, we showed that NG108-15 cells were unable to achieve proper posttranslational glycosylation modification. As VAChT protein is highly glycosylated [45], it thus appears that these posttranslational modifications are crucial for this membrane protein to be functional. Indeed, transfection experiments allowed us to bypass the drawback of comparing the modulation of a soluble protein, ChAT, with that of a membrane protein. Expression of luciferase, whose coding sequence substituted the VAChT coding sequence and was placed under the control of identified promoter and regulatory
71
regions of ChAT and VAChT genes [11], was modulated by differentiating treatments. To conclude, cellular models allow one to unravel a complex regulatory pattern of the expression of the cholinergic locus, where transcriptional and posttranscriptional mechanisms contribute to fine tune the coordinate expression of ChAT and VAChT proteins in mature neurons.
Acknowledgements This work was supported in part by a grant from the AFM and from GACR (305/01/0283). V.D. was the recipient of a fellowship from the CNRS. We are grateful to Dr. B. Rouzaire-Dubois and S. Bostel for their help with cell cultures; to Drs. S. O’Regan and F.-M. Meunier for their support in molecular biology experiments. References [1] A. Alfonso, K. Grundahl, J.S. Duerr, H.-P. Hahn, J.P. Rand, The Caenorhabditis elegans unc17 gene: a putative vesicular acetylcholine transporter, Nature 261 (1993) 617–619. [2] B.A. Bahr, S.M. Parsons, Demonstration of a receptor in Torpedo synaptic vesicles for the acetylcholine storage blocker Ltrans-2- (4-phenyl [3,4 3H] piperidino) cyclohexanol, Proc. Natl. Acad. Sci. USA 83 (1986) 2267–2270. [3] J. Barbosa Jr., A.R. Massensini, M.S. Santos, S.I. Meireles, R.S. Gomez, M.V. Gomez, M.A. Romano-Silva, V.F. Prado, M.A. Prado, Expression of the vesicular acetylcholine transporter, proteins involved in exocytosis, and functional calcium signaling in varicosities and soma of a murine septal cell line, J. Neurochem. 73 (1999) 1881–1893. [4] S. Be´janin, R. Cervini, J. Mallet, S. Berrard, A unique gene organization for two cholinergic markers, choline acetyltransferase and a putative vesicular transporter of acetylcholine, J. Biol. Chem. 269 (1994) 21944–21947. [5] S. Berrard, H. Varoqui, R. Cervini, M. Israe¨l, J. Mallet, M.F. Diebler, Coregulation of two embedded gene products: choline acetyltransferase and the vesicular acetylcholine transporter, J Neurochem 65 (1995) 939–942. [6] B. Berse, J.K. Blusztajn, Coordinated upregulation of choline acetyltransferase and vesicular acetylcholine transporter gene expression by the retinoic acid receptor alpha, cAMP, and leukemia inhibitory factor/ciliary neurotrophic factor signaling pathways in a murine septal cell line, J Biol. Chem. 270 (1995) 22101–22104. [7] B. Berse, J.K. Blusztajn, Modulation of cholinergic locus expression by glucocorticoids and retinoic acid is cell-type specific, FEBS Lett. 110 (1997) 175–179. [8] M.M. Bradford, A rapid and sensitive method of the quantitation of microgram quantities of protein utilizing the principal of protein-dye binding, Anal. Biochem. 72 (1976) 248–254. [9] R. Cervini, L. Houhou, P.-F. Pradat, S. Be´janin, J. Mallet, S. Berrard, Specific vesicular acetylcholine transporter promoter lie within the first intron of the rat choline acetyltransferase gene, J. Biol. Chem. 270 (1995) 24654–24657. [10] S. Cowley, H. Paterson, P. Kemp, C.J. Marshall, Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation on NIH 3T3 cells, Cell 77 (1994) 841–852.
72
X. Castell et al. / Journal of Physiology - Paris 96 (2002) 61–72
[11] S. De Gois, L. Houhou, Y. Oda, M. Corbex, F. Pajak, E. The´venot, G. Vodjani, J. Mallet, S. Berrard, Is RE1:NRSE a common cis-regulatory sequence for ChAT and VAChT genes?, J. Biol. Chem. 275 (2000) 36683–36690. [12] M.-F. Diebler, M. Tomasi, F.-M. Meunier, M. Israe¨l, V. Dolez˘al, Influence of retinoic acid and cyclic AMP on the expression of choline acetyltranferase and of vesicular acetylcholine transporter in NG 108-15 cells, J. Physiol. (Paris) 92 (1998) 379–384. [13] V. Dolez˘al, X. Castell, M. Tomasi, M.F. Diebler, Stimuli that induce a cholinergic neuronal phenotype of NG108-15 cells upregulate ChAT and VAChT mRNAs but fail to increase VAChT protein, Brain Res. Bull. 54 (2001) 363–374. [14] L.E. Eiden, The cholinergic gene locus, J. Neurochem. 70 (1998) 2227–2240. [15] J.D. Erickson, H. Varoqui, M.K.H. Scha¨fer, W. Modi, M.F. Diebler, E. Weihe, J. Rand, L.E. Eiden, T.I. Bonner, T.B. Usdin, Functional identification of a vesicular acetylcholine transporter and its expression from a ‘‘cholinergic’’ gene locus, J. Biol. Chem. 269 (1994) 21929–21932. [16] E. Espinos, M.J. Weber, Activation of the MAP kinase cascade by histone deacetylase inhibitors is required for the stimulation of choline acetyltransferase gene promoter, Brain Res. Mol. Brain Res. 56 (1998) 118–124. [17] F. Fonnum, Isolation of choline esters from aqueous solutions by extraction with sodium tetraphenylboron in organic solvents, Biochem. J. 113 (1969) 291–298. [18] M.L. Gilmor, N.R. Nash, A. Roghani, R.H. Edwards, H. Yi, S.M. Hersch, A.I. Levey, Expression of the putative vesicular acetylcholine transporter in rat brain and localization in cholinergic synaptic vesicles, J. Neurosci. 16 (1996) 2179–2190. [19] R.H. Goodman, S. Smolik, CBP/p300 in cell growth, transformation, and development, Genes Dev. 14 (2000) 1553–1577. [20] M. Go¨ttlicher, S. Heck, P. Herrlich, Transcriptional cross-talk, the second mode of steroid hormone receptor action, J. Mol. Med. 76 (1998) 480–489. [21] B. Hamprecht, Structural, electrophysiological, biochemical and pharmacological properties of neuroblastoma glioma cell hybrids in cell culture, Int. Rev. Cytol. 49 (1977) 99–170. [22] L.B. Hersh, Induction of choline acetyltransferase in the neuroblastoma x glioma cell line NG 108-15, Neurochem. Res. 17 (1992) 1063–1067. [23] T. Holler, B. Berse, J.M. Cermak, M.-F. Diebler, J.K. Blusztajn, Differences in the developmental expression of the vesicular acetylcholine transporter and choline acetyltransferase in the rat brain, Neurosci. Lett. 212 (1996) 107–110. [24] Y. Huang, D. Hutter, Y. Liu, X. Wang, M.S. Sheikh, A.ML Chan, J. Nikki, N.J. Holbrook, Transforming Growth Factor suppresses serum deprivation-induced death of A549 cells through differential effects on c-Jun and JNK activities, J. Biol. Chem. 275 (2000) 18234–18242. [25] Y.T. Ip, R.J. Davis, Signal transduction by the c-Jun N-terminal kinase (JNK)-from inflammation to development, Curr. Opin. Cell Biol. 10 (1998) 205–219. [26] T. Kitamoto, W. Wang, P.M. Salvaterra, Structure and organization of the Drosophila cholinergic locus, J. Biol. Chem. 273 (1998) 2706–2713. [27] J.P. Luzio, B. Brake, G. Banting, K.E. Howell, P. Braghetta, K.K. Stanley, Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38), Biochem. J. 270 (1990) 97–102. [28] M.A. Malik, C.E. Greenwood, J.C. Blusztajn, B. Berse, Cholinergic differentiation triggered by blocking cell proliferation and treatment with all-trans-retinoic acid, Brain Res. 874 (2000) 178– 185. [29] M.D. Mark, D.R. Storm, Coupling of epidermal growth factor (EGF) with the antiproliferative activity of cAMP induces neuronal differentiation, J. Biol. Chem. 272 (1997) 17238–17244.
[30] R. McGee, P. Simpson, C. Christian, M. Mata, P. Nelson, M. Niremberg, Regulation of acetylcholine release from neuroblastoma glioma hybrid cell lines, Proc. Natl. Acad. USA 75 (1978) 1314–1318. [31] J.N. Miner, K.R. Yamamoto, Regulatory cross-talk at composite response elements, Trends Biochem. Sci. 16 (1991) 423–427. [32] H. Misawa, R. Takahashi, T. Deguchi, Coordinate expression of vesicular acetylcholine transporter and choline acetyltranferase in sympathetic superior cervical neurones, Neuroreport 6 (1995) 965–968. [33] J.M. Naciff, H. Misawa, J.R. Dedman, Molecular characterization of the mouse vesicular acetylcholine transporter gene, Neuroreport 8 (1997) 3467–3473. [34] A.J. Patel, A. Hunt, P. Seaton, The mechanism of cytosine arabinoside toxicity on quiescent astrocytes in vitro appears to be analogous to in vivo brain injury, Brain Res. 450 (1988) 378–381. [35] E.D. Roberson, J.D. English, J.P. Adams, J.C. Selcher, C. Kondratick, J.D. Sweatt, The mitogen-activated protein kinase cascade couples PKA and PKC to cAMP response element binding protein phosphorylation in area CA1 of hippocampus, J. Neurosciences 19 (1999) 4337–4348. [36] R.N. Rosenberg, C.K. Vance, M. Morrison, N. Prashad, J. Meyne, F. Baskin, Differentiation of neuroblastoma, glioma, and hybrid cells in culture as measured by the synthesis of specific protein species: evidence for neuroblast-glioblast reciprocal genetic regulation, J. Neurochem 30 (1978) 1343–1355. [37] B. Rouzaire-Dubois, J.M. Dubois, Tamoxifen blocks both proliferation and voltage-dependent K+ channels of neuroblastoma cells, Cell Signal 2 (1990) 387–393. [38] O.M. Seternes, B. Johansen, U. Moens, A dominant role for the Raf-MEK pathway in forskolin, 12-O-tetradecanoyl-phorbol acetate, and platelet-derived growth factor-induced CREB (cAMP-responsive element-binding protein) activation, uncoupled from serine133 phosphorylation in NIH 3T3 cells, Mol. Endocrinol. 13 (1999) 1071–1083. [39] A.J. Shaywitz, A.E. Greenberg, CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals, Ann Rev. Biochem. 68 (1999) 821–861. [40] G. Shiff, N. Morel, Association of syntaxin with SNAP-25 and VAMP (synaptobrevin) during axonal transport, J. Neurosci. Res. 48 (1997) 313–323. [41] M. Shimojo, D. Wu, L.B. Hersh, The cholinergic gene locus is coordinately regulated by protein kinase A II in PC12 cells, J. Neurochem. 71 (1998) 1118–1126. [42] P.S. Thomas, Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose, Proc. Natl. Acad. Sci. USA 77 (1980) 5201–5205. [43] X. Tian, X. Sun, J.B. Suszkiw, Developmental age-dependent upregulation of choline acetyltransferase and vesicular acetylcholine transporter mRNA expression in neonatal septum by nerve growth factor, Neuroscience Lett. 209 (1996) 134–136. [44] H. Varoqui, M.-F. Diebler, F.-M. Meunier, J.B. Rand, T.B. Usdin, T.I. Bonner, L.E. Eiden, J.D. Erickson, Cloning and expression of the vesamicol binding protein from the marine ray Torpedo, FEBS Lett. 342 (1994) 97–102. [45] H. Varoqui, F.-M. Meunier, F.A. Meunier, J. Molgo, S. Berrard, R. Cervini, J. Mallet, M. Israe¨l, M.-F. Diebler, Expression of the vesicular acetylcholine transporter in mammalian cells, Progress in Brain Research 109 (1996) 83–95. [46] S. Vyas, N. Faucon Biguet, J. Mallet, Transcriptional and post transcriptional regulation of tyrosine hydroxylase by proteine kinase C Embo J. 9 (1990) 3707–3712. [47] Z.G. Zhong, H. Misawa, S. Furuya, Y. Kimura, M. Noda, S. Yokoyama, H. Higashida, Overexpression of choline acetyltransferase reconstitutes discrete acetylcholine release in some but not all synapse formation-defective neuroblastoma cells, J. Physiol. (Paris) 89 (1995) 137–145.