- Email: [email protected]
mRNA expression alterations of inward rectifier potassium channels in rat brain with cholinergic impairment
Neuroscience Letters 322 (2002) 25–28 www.elsevier.com/locate/neulet
mRNA expression alterations of inward rectifier potassium channels in rat brain with cholinergic impairment Xiang-Hua Xu, Ya-Ping Pan, Xiao-Liang Wang* Department of Pharmacology, Institute of Materia Medica, Peking Union Medical College and Chinese Academy of Medical Sciences, 1 Xiannongtan Street, Beijing 100050, China Received 21 November 2001; received in revised form 27 December 2001; accepted 7 January 2002
Abstract Potassium channel dysfunction has been indicated in Alzheimer’s disease. In the present study, spatial memory, the activity of cortical acetylcholinesterase (AChE) and the expressions of inward rectifier potassium channels (Kir) were measured after ibotenic acid lesions of nucleus basalis magnocellularis (nbm) in rats. Expressions of Kir (Kir2.1, Kir3.1, Kir6.1 and Kir6.2) at mRNA level were assessed using reverse transcription-polymerase chain reaction. At 28 days after ibotenic acid injection, the spatial memory of rats was significantly impaired accompanied by a 32% reduction of cortical AChE activity. Furthermore, the expression of Kir6.2 was increased by 79.3% in cortex, and that of Kir6.1 was increased by 172.1% in hippocampus, while no obvious changes in the mRNA expression of Kir2.1 and Kir3.1 were detected. This study indicated that the expression of adenosine triphosphate-sensitive potassium channel was area and channel subtype specifically increased following nbm lesions. q 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Ibotenic acid; Nucleus basalis magnocellularis; Adenosine triphosphate-sensitive potassium channel; Inward rectifier; Acetylcholinesterase; Alzheimer’s disease
The discovery that cholinergic neurons in the basal forebrain degenerate in Alzheimer’s disease (AD) inspires major research to establish the role of cholinergic neurons in this disease [3,6]. Some of these cholinergic neurons are found in nucleus basalis magnocellularis (nbm). Excitotoxic lesions of this nucleus in rats result in an extensive loss of cholinergic neurons paralleled by impaired behavioral functions [5] and have been used to study the role of cholinergic neurons in AD. There have been a few reports about changes of potassium currents in AD patients [8], but the corresponding potassium channel subunits of these currents are still unknown. Acetylcholine (ACh) plays a critical role in the central nervous system via muscarinic and nicotinic receptors. Inward rectifier potassium channel (Kir) is a major superfamily of potassium channels coupled with receptors. ACh level in brain has been shown to be decreased in AD patients [14]. However, changes in electrophysiological properties and potassium channel subtypes remain unclear. In the present study, we determined the alterations of Kir2.1,
* Corresponding author. Tel.: 186-10-6316-5193; fax: 186-106301-7757. E-mail address: [email protected] (X.-L. Wang).
Kir3.1, Kir6.1 and Kir6.2 mRNA expression in the cortex and hippocampus of nbm lesioned rats. Adult male Wistar rats (Animal Center of Chinese Academy of Medical Sciences) weighing 260–300 g were anaesthetized with sodium pentobarbital (45 mg/kg, i.p.). Neurotoxic lesions of the basal forebrain were produced by injecting ibotenic acid. Animals were divided into two major subgroups, one group received ibotenic acid (Sigma-Aldrich, USA) microinjections (12 mg/ml and 0.5 ml per side during 5 min) into the nucleus basalis (A ¼ 0:9 mm posterior to bregma, L ¼ 2:6 mm lateral to midline and V ¼ 6:8 mm below dura) [15] and the other group received phosphatebuffered saline microinjections into the same position. Three weeks after the surgery, animals were tested on the acquisition of a task in a Morris water maze [13]. For each training trial, the latency to escape onto the hidden platform was recorded. If the rat was unable to find the platform within 60 s, the training trial was terminated and a maximum score of 60 s was assigned. Training trials were given on 6 successive days, and rats received four training trials each day. Rats were sacrificed by decapitation at 3, 7, 14, 28 days, respectively after the surgery. Cortical samples of 28 days after surgery were homogenized in 10 mM EDTA (50 mg/ml). Acetylcholinesterase (AChE) activity was measured by using the method of Ellman et al. [7]. Protein was measured
0304-3940/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 2) 00 07 1- X
X.-H. Xu et al. / Neuroscience Letters 322 (2002) 25–28
26
with the Lowry method and bovine serum albumin was used as the standard [11]. Total RNA was extracted from tissue homogenate by Trizol agents (Promega, USA) according to the manufacturer’s instructions. For quantification of mRNA expression of Kir (Kir2.1, Kir3.1, Kir6.1 and Kir6.2), semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was established for each gene studied. DNase-treated total RNA (2 mg) was converted to cDNA using random nonamer and Moloney Murine Leukemia Virus Reverse Transcriptase reverse transcription (RT; Gibco) in a 20 ml reaction mixture. PCR reaction was performed in 25 ml reaction volume, consisting of 1 ml of RT mix, 10 pmol gene-specific primers (see Table 1 for primer sequences), 1 £ ExTaq buffer, 50 mM of deoxynucleotide triphosphate and 1 unit of ExTaq polymerase (Takara). PCRs were run for 25–32 cycles of 94 8C for 30 s, 60 8C for 1 min and 72 8C for 2 min. To normalize for differences in the amount of total RNA added to the reaction, amplification of 18S ribosomal RNA was performed as an endogenous control. The optimal cycle number for each gene was determined in the preliminary experiments so that the PCR products resulting from serial dilutions of 1-1/16 of RT mix fell in a linear range after amplification. These were: 25 cycles for Kir2.1, Kir3.1 and 18S rRNA; 32 cycles for Kir6.1 and Kir6.2. The PCR products were separated by 1.5% agarose gels electrophoresed with ethidium bromide. Quantification of differences in mRNA levels was performed using the Kodak Digital Science Electrophoresis Documentation and Analysis System 120 (Eastman Kodak Co., NY, USA). We used ibotenic acid to induce lesions of nbm and impaired the spatial memory of rats successfully. Rats with ibotenic acid lesions showed a marked increase in escape latencies compared with sham rats each day (Fig. 1). The total escape latency of the nbm lesions group for 6 days was significantly increased from 109.8 ^ 8.7 to 195.6 ^ 21.0 s (P , 0:05; n ¼ 10). In order to directly determine whether cholinergic neurons had been damaged, we measured AChE activity in homogenates of the cortex at 28 days after ibotenic acid microinjection and found that cortical AChE activity was significantly lower in the nbm lesions group than that in sham rats (6.6 ^ 0.56 and 9.7 ^ 1.02 mmol/mg protein per hour, respectively) (P , 0:05; n ¼ 6), which was consistent with previous reports [16].
Fig. 1. The effect of ibotenic acid on spatial memory in the Morris water maze. Mean latencies to escape from water onto the hidden platform were measured. Each rat from control (n ¼ 10) and ibotenic acid (IBO) groups (n ¼ 10) was subjected to four trials per day for 6 consecutive days. Means ^ SEM are presented. *P , 0:05, **P , 0:01 compared with control group.
Kir may contribute to the resting membrane K 1 conductance of the cells. Members of the Kir2.0 subfamily express channels that appear to correspond to the ‘classical’ inward rectifier. Most work has focused on the first family member, Kir2.1 (IRK1), which showed properties characteristic of native strong inward rectifiers. The Kir3.0 subfamily encodes proteins that, when heterologously expressed, give rise to potassium channels modulated by G-protein activation. Functional G-protein coupled inward rectifier channels are believed to be formed by Kir3.1 and other subunits [10]. In this study, we found that the mRNA expression of Kir2.1 and Kir3.1 was not significantly changed in cortex and hippocampus between sham- and ibotenic acid-treated rats (Fig. 2). Adenosine triphosphate (ATP)-sensitive potassium (KATP) channels have the general function of linking the membrane K 1 permeability of cells to their metabolic state and electrical activity [2]. Molecular studies have revealed that KATP channels are octameric complexes of Kir6.0 subunits (Kir6.1 and Kir6.2) and sulfonylurea subunits [1]. Various permutations have been reported in neuronal cells [12]. In this study, we found the mRNA expression of Kir6.2 in cortex was decreased by 47.9% at 3 days after nbm lesions and then increased slowly. After 28 days, the expression of Kir6.2 was increased by 79.3% compared
Table 1 Primer sequences for Kir used for RT-PCR Gene
GenBank number
Primer sequences (5 0 to 3 0 )
Product length (bp)
Kir2.1
AF021137
372
Kir3.1
L25264
Kir6.1
D42145
Kir6.2
U44897
Sense Antisense Sense Antisense Sense Antisense Sense Antisense
TGCCCGATTGCTGTTTTC GGCTGTCTTCGTCTATTT GCACCAGCCATAACCAAC TTGCCAGGAACCGAACTT GAGTGAACTGTCGCACCAGA CGATCACCAGAACTCAGCAA CTTTGCCCACGGTGACTTG CCCAGCATTATGGCGTTGAT
221 247 213
X.-H. Xu et al. / Neuroscience Letters 322 (2002) 25–28
27
Fig. 2. Comparison of the mRNA expression of Kir in cortex and hippocampus after ibotenic acid lesions of nbm by RT-PCR. M: DNA marker; CC, C3, C7, C14, C28, HC, H3, H7, H14, H28: cortex and hippocampus from control group or 3, 7, 14, 28 days following nbm lesions group, respectively. mRNA levels of Kir were quantified by densitometric scanning and normalized to 18S rRNA. Values are means ^ SEM of six independent experiments. *P , 0:05 compared with the control group.
with the control group. Meanwhile, the expression of Kir6.1 in the hippocampus was significantly increased by 172.1% after 28 days following ibotenic acid lesioning of nbm (Fig. 2). There are maybe two mechanisms involved in the increase of KATP expression in the cortex and hippocampus after ibotenic acid lesions in our study. Ibotenic acid is a neurotoxin which can induce damage and death of neurons. Recently, it has been reported that 192 IgG-saporin (a cholinergic selective neurotoxin) lesioned rats showed marked reduction in glucose utilization in a number of regions including the cortex and hippocampus [4]. Therefore, ibotenic acid might also impair glucose uptake or transport into neurons. Both reasons may result in intracellular ATP decrease and KATP opening. Opening KATP can shift the membrane potential to a more negative direction, thus suppressing the excitability of neurons, which may contribute to cognitive deficits seen in AD. KATP openers were found to produce an amnesic effect and potassium channel blockers prevented the amnesia [9]. The present study indicates that the mRNA expression of Kir6.2 was increased significantly in the cortex and that of
Kir6.1 was increased in the hippocampus in cholinergic impaired rats. We suppose that KATP might play an important role in the process of AD. This work was supported by grants from National 973 Fundamental Project of China (number G1998051106) and the National Natural Science Foundation of China (number 39425014).
[1] Aguilar-Bryan, L., Clement, J.P., Gonzalez, G., Kunjilwar, K., Babenko, A. and Bryan, J., Toward understanding the assembly and structure of KATP channels, Physiol. Rev., 78 (1998) 227–245. [2] Ashcroft, S.J. and Ashcroft, F.M., Properties and functions of ATP-sensitive K-channels, Cell. Signal., 2 (1990) 197–214. [3] Bartus, R.T., Dean 3rd, R.L., Beer, B. and Lippa, A.S., The cholinergic hypothesis of geriatric memory dysfunction, Science, 217 (1982) 408–417. [4] Browne, S.E., Muir, J.L., Robbins, T.W., Page, K.J., Everitt, B.J. and McCulloch, J., The cerebral metabolic effects of manipulating glutamatergic systems within the basal forebrain in conscious rats, Eur. J. Neurosci., 10 (1999) 649–663. [5] Connor, D.J., Langlaris, P.J. and Thal, L.J., Behavioral
28
[6]
[7]
[8]
[9]
[10]
X.-H. Xu et al. / Neuroscience Letters 322 (2002) 25–28 impairments after lesions of the nucleus basalis by ibotenic acid and quisqualic, Brain Res., 555 (1991) 84–90. Coyle, J.D., Price, D.L. and Delong, M.R., Alzheimer’s disease: a disorder of cortical cholinergic innervation, Science, 219 (1983) 1184–1190. Ellman, G.L., Courtney, K.D., Andres Jr., V. and Feathersone, R.M., A new and rapid colorimetric determination of acetylcholinesterase activity, Biochem. Pharmacol., 7 (1961) 88–95. Etcheberrigaray, R., Ito, E., Oka, K., Tofel-Grehl, B., Gibson, G.E. and Alkon, D.L., Potassium channel dysfunction in fibroblasts identifies patients with Alzheimer disease, Proc. Natl. Acad. Sci. USA, 90 (1993) 8209–8213. Ghelardini, C., Galeotti, N. and Bartolini, A., Influence of potassium channel modulators on cognitive processes in mice, Br. J. Pharmacol., 123 (1998) 1079–1084. Lesage, F., Guillemare, E., Fink, M., Duprat, F., Heurteaux, C., Fosset, M., Romey, G., Barhanin, J. and Lazdunski, M., Molecular properties of neuronal G-protein-activated inwardly rectifying K 1 channels, J. Biol. Chem., 270 (1995) 28660–28667.
[11] Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randll, R.J., Protein measurement with the Follin phenol agent, J. Biol. Chem., 193 (1951) 265–275. [12] Miller, T.R., Taber, R.D., Molinari, E.J., Whiteaker, K.L., Monteggia, L.M., Scott, V.E., Brioni, J.D., Sullivan, J.P. and Gopalakrishnan, M., Pharmacological and molecular characterization of ATP-sensitive K 1 channels in the TE671 human medulloblastoma cell line, Eur. J. Pharmacol., 370 (1999) 179–185. [13] Morris, R.G.M., Development of a water maze procedure for studying spatial learning in the rat, J. Neurosci. Methods, 11 (1984) 47–60. [14] Muir, J.L., Acetylcholine, aging, and Alzheimer’s disease, Pharmacol. Biochem. Behav., 56 (1997) 687–696. [15] Paxinos, G. and Watson, P., The Rat Brain in Stereotaxic Coordinates, Academic Press, New York, 1986. [16] Rattan, A.K. and Tejwani, G.A., The neurotoxic actions of ibotenic acid on cholinergic and opioid peptidergic systems in the central nervous system of the rat, Brain Res., 571 (1992) 298–305.
mRNA expression alterations of inward rectifier potassium channels in rat brain with cholinergic impairment Xiang-Hua Xu, Ya-Ping Pan, Xiao-Liang Wang* Department of Pharmacology, Institute of Materia Medica, Peking Union Medical College and Chinese Academy of Medical Sciences, 1 Xiannongtan Street, Beijing 100050, China Received 21 November 2001; received in revised form 27 December 2001; accepted 7 January 2002
Abstract Potassium channel dysfunction has been indicated in Alzheimer’s disease. In the present study, spatial memory, the activity of cortical acetylcholinesterase (AChE) and the expressions of inward rectifier potassium channels (Kir) were measured after ibotenic acid lesions of nucleus basalis magnocellularis (nbm) in rats. Expressions of Kir (Kir2.1, Kir3.1, Kir6.1 and Kir6.2) at mRNA level were assessed using reverse transcription-polymerase chain reaction. At 28 days after ibotenic acid injection, the spatial memory of rats was significantly impaired accompanied by a 32% reduction of cortical AChE activity. Furthermore, the expression of Kir6.2 was increased by 79.3% in cortex, and that of Kir6.1 was increased by 172.1% in hippocampus, while no obvious changes in the mRNA expression of Kir2.1 and Kir3.1 were detected. This study indicated that the expression of adenosine triphosphate-sensitive potassium channel was area and channel subtype specifically increased following nbm lesions. q 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Ibotenic acid; Nucleus basalis magnocellularis; Adenosine triphosphate-sensitive potassium channel; Inward rectifier; Acetylcholinesterase; Alzheimer’s disease
The discovery that cholinergic neurons in the basal forebrain degenerate in Alzheimer’s disease (AD) inspires major research to establish the role of cholinergic neurons in this disease [3,6]. Some of these cholinergic neurons are found in nucleus basalis magnocellularis (nbm). Excitotoxic lesions of this nucleus in rats result in an extensive loss of cholinergic neurons paralleled by impaired behavioral functions [5] and have been used to study the role of cholinergic neurons in AD. There have been a few reports about changes of potassium currents in AD patients [8], but the corresponding potassium channel subunits of these currents are still unknown. Acetylcholine (ACh) plays a critical role in the central nervous system via muscarinic and nicotinic receptors. Inward rectifier potassium channel (Kir) is a major superfamily of potassium channels coupled with receptors. ACh level in brain has been shown to be decreased in AD patients [14]. However, changes in electrophysiological properties and potassium channel subtypes remain unclear. In the present study, we determined the alterations of Kir2.1,
* Corresponding author. Tel.: 186-10-6316-5193; fax: 186-106301-7757. E-mail address: [email protected] (X.-L. Wang).
Kir3.1, Kir6.1 and Kir6.2 mRNA expression in the cortex and hippocampus of nbm lesioned rats. Adult male Wistar rats (Animal Center of Chinese Academy of Medical Sciences) weighing 260–300 g were anaesthetized with sodium pentobarbital (45 mg/kg, i.p.). Neurotoxic lesions of the basal forebrain were produced by injecting ibotenic acid. Animals were divided into two major subgroups, one group received ibotenic acid (Sigma-Aldrich, USA) microinjections (12 mg/ml and 0.5 ml per side during 5 min) into the nucleus basalis (A ¼ 0:9 mm posterior to bregma, L ¼ 2:6 mm lateral to midline and V ¼ 6:8 mm below dura) [15] and the other group received phosphatebuffered saline microinjections into the same position. Three weeks after the surgery, animals were tested on the acquisition of a task in a Morris water maze [13]. For each training trial, the latency to escape onto the hidden platform was recorded. If the rat was unable to find the platform within 60 s, the training trial was terminated and a maximum score of 60 s was assigned. Training trials were given on 6 successive days, and rats received four training trials each day. Rats were sacrificed by decapitation at 3, 7, 14, 28 days, respectively after the surgery. Cortical samples of 28 days after surgery were homogenized in 10 mM EDTA (50 mg/ml). Acetylcholinesterase (AChE) activity was measured by using the method of Ellman et al. [7]. Protein was measured
0304-3940/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 2) 00 07 1- X
X.-H. Xu et al. / Neuroscience Letters 322 (2002) 25–28
26
with the Lowry method and bovine serum albumin was used as the standard [11]. Total RNA was extracted from tissue homogenate by Trizol agents (Promega, USA) according to the manufacturer’s instructions. For quantification of mRNA expression of Kir (Kir2.1, Kir3.1, Kir6.1 and Kir6.2), semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was established for each gene studied. DNase-treated total RNA (2 mg) was converted to cDNA using random nonamer and Moloney Murine Leukemia Virus Reverse Transcriptase reverse transcription (RT; Gibco) in a 20 ml reaction mixture. PCR reaction was performed in 25 ml reaction volume, consisting of 1 ml of RT mix, 10 pmol gene-specific primers (see Table 1 for primer sequences), 1 £ ExTaq buffer, 50 mM of deoxynucleotide triphosphate and 1 unit of ExTaq polymerase (Takara). PCRs were run for 25–32 cycles of 94 8C for 30 s, 60 8C for 1 min and 72 8C for 2 min. To normalize for differences in the amount of total RNA added to the reaction, amplification of 18S ribosomal RNA was performed as an endogenous control. The optimal cycle number for each gene was determined in the preliminary experiments so that the PCR products resulting from serial dilutions of 1-1/16 of RT mix fell in a linear range after amplification. These were: 25 cycles for Kir2.1, Kir3.1 and 18S rRNA; 32 cycles for Kir6.1 and Kir6.2. The PCR products were separated by 1.5% agarose gels electrophoresed with ethidium bromide. Quantification of differences in mRNA levels was performed using the Kodak Digital Science Electrophoresis Documentation and Analysis System 120 (Eastman Kodak Co., NY, USA). We used ibotenic acid to induce lesions of nbm and impaired the spatial memory of rats successfully. Rats with ibotenic acid lesions showed a marked increase in escape latencies compared with sham rats each day (Fig. 1). The total escape latency of the nbm lesions group for 6 days was significantly increased from 109.8 ^ 8.7 to 195.6 ^ 21.0 s (P , 0:05; n ¼ 10). In order to directly determine whether cholinergic neurons had been damaged, we measured AChE activity in homogenates of the cortex at 28 days after ibotenic acid microinjection and found that cortical AChE activity was significantly lower in the nbm lesions group than that in sham rats (6.6 ^ 0.56 and 9.7 ^ 1.02 mmol/mg protein per hour, respectively) (P , 0:05; n ¼ 6), which was consistent with previous reports [16].
Fig. 1. The effect of ibotenic acid on spatial memory in the Morris water maze. Mean latencies to escape from water onto the hidden platform were measured. Each rat from control (n ¼ 10) and ibotenic acid (IBO) groups (n ¼ 10) was subjected to four trials per day for 6 consecutive days. Means ^ SEM are presented. *P , 0:05, **P , 0:01 compared with control group.
Kir may contribute to the resting membrane K 1 conductance of the cells. Members of the Kir2.0 subfamily express channels that appear to correspond to the ‘classical’ inward rectifier. Most work has focused on the first family member, Kir2.1 (IRK1), which showed properties characteristic of native strong inward rectifiers. The Kir3.0 subfamily encodes proteins that, when heterologously expressed, give rise to potassium channels modulated by G-protein activation. Functional G-protein coupled inward rectifier channels are believed to be formed by Kir3.1 and other subunits [10]. In this study, we found that the mRNA expression of Kir2.1 and Kir3.1 was not significantly changed in cortex and hippocampus between sham- and ibotenic acid-treated rats (Fig. 2). Adenosine triphosphate (ATP)-sensitive potassium (KATP) channels have the general function of linking the membrane K 1 permeability of cells to their metabolic state and electrical activity [2]. Molecular studies have revealed that KATP channels are octameric complexes of Kir6.0 subunits (Kir6.1 and Kir6.2) and sulfonylurea subunits [1]. Various permutations have been reported in neuronal cells [12]. In this study, we found the mRNA expression of Kir6.2 in cortex was decreased by 47.9% at 3 days after nbm lesions and then increased slowly. After 28 days, the expression of Kir6.2 was increased by 79.3% compared
Table 1 Primer sequences for Kir used for RT-PCR Gene
GenBank number
Primer sequences (5 0 to 3 0 )
Product length (bp)
Kir2.1
AF021137
372
Kir3.1
L25264
Kir6.1
D42145
Kir6.2
U44897
Sense Antisense Sense Antisense Sense Antisense Sense Antisense
TGCCCGATTGCTGTTTTC GGCTGTCTTCGTCTATTT GCACCAGCCATAACCAAC TTGCCAGGAACCGAACTT GAGTGAACTGTCGCACCAGA CGATCACCAGAACTCAGCAA CTTTGCCCACGGTGACTTG CCCAGCATTATGGCGTTGAT
221 247 213
X.-H. Xu et al. / Neuroscience Letters 322 (2002) 25–28
27
Fig. 2. Comparison of the mRNA expression of Kir in cortex and hippocampus after ibotenic acid lesions of nbm by RT-PCR. M: DNA marker; CC, C3, C7, C14, C28, HC, H3, H7, H14, H28: cortex and hippocampus from control group or 3, 7, 14, 28 days following nbm lesions group, respectively. mRNA levels of Kir were quantified by densitometric scanning and normalized to 18S rRNA. Values are means ^ SEM of six independent experiments. *P , 0:05 compared with the control group.
with the control group. Meanwhile, the expression of Kir6.1 in the hippocampus was significantly increased by 172.1% after 28 days following ibotenic acid lesioning of nbm (Fig. 2). There are maybe two mechanisms involved in the increase of KATP expression in the cortex and hippocampus after ibotenic acid lesions in our study. Ibotenic acid is a neurotoxin which can induce damage and death of neurons. Recently, it has been reported that 192 IgG-saporin (a cholinergic selective neurotoxin) lesioned rats showed marked reduction in glucose utilization in a number of regions including the cortex and hippocampus [4]. Therefore, ibotenic acid might also impair glucose uptake or transport into neurons. Both reasons may result in intracellular ATP decrease and KATP opening. Opening KATP can shift the membrane potential to a more negative direction, thus suppressing the excitability of neurons, which may contribute to cognitive deficits seen in AD. KATP openers were found to produce an amnesic effect and potassium channel blockers prevented the amnesia [9]. The present study indicates that the mRNA expression of Kir6.2 was increased significantly in the cortex and that of
Kir6.1 was increased in the hippocampus in cholinergic impaired rats. We suppose that KATP might play an important role in the process of AD. This work was supported by grants from National 973 Fundamental Project of China (number G1998051106) and the National Natural Science Foundation of China (number 39425014).
[1] Aguilar-Bryan, L., Clement, J.P., Gonzalez, G., Kunjilwar, K., Babenko, A. and Bryan, J., Toward understanding the assembly and structure of KATP channels, Physiol. Rev., 78 (1998) 227–245. [2] Ashcroft, S.J. and Ashcroft, F.M., Properties and functions of ATP-sensitive K-channels, Cell. Signal., 2 (1990) 197–214. [3] Bartus, R.T., Dean 3rd, R.L., Beer, B. and Lippa, A.S., The cholinergic hypothesis of geriatric memory dysfunction, Science, 217 (1982) 408–417. [4] Browne, S.E., Muir, J.L., Robbins, T.W., Page, K.J., Everitt, B.J. and McCulloch, J., The cerebral metabolic effects of manipulating glutamatergic systems within the basal forebrain in conscious rats, Eur. J. Neurosci., 10 (1999) 649–663. [5] Connor, D.J., Langlaris, P.J. and Thal, L.J., Behavioral
28
[6]
[7]
[8]
[9]
[10]
X.-H. Xu et al. / Neuroscience Letters 322 (2002) 25–28 impairments after lesions of the nucleus basalis by ibotenic acid and quisqualic, Brain Res., 555 (1991) 84–90. Coyle, J.D., Price, D.L. and Delong, M.R., Alzheimer’s disease: a disorder of cortical cholinergic innervation, Science, 219 (1983) 1184–1190. Ellman, G.L., Courtney, K.D., Andres Jr., V. and Feathersone, R.M., A new and rapid colorimetric determination of acetylcholinesterase activity, Biochem. Pharmacol., 7 (1961) 88–95. Etcheberrigaray, R., Ito, E., Oka, K., Tofel-Grehl, B., Gibson, G.E. and Alkon, D.L., Potassium channel dysfunction in fibroblasts identifies patients with Alzheimer disease, Proc. Natl. Acad. Sci. USA, 90 (1993) 8209–8213. Ghelardini, C., Galeotti, N. and Bartolini, A., Influence of potassium channel modulators on cognitive processes in mice, Br. J. Pharmacol., 123 (1998) 1079–1084. Lesage, F., Guillemare, E., Fink, M., Duprat, F., Heurteaux, C., Fosset, M., Romey, G., Barhanin, J. and Lazdunski, M., Molecular properties of neuronal G-protein-activated inwardly rectifying K 1 channels, J. Biol. Chem., 270 (1995) 28660–28667.
[11] Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randll, R.J., Protein measurement with the Follin phenol agent, J. Biol. Chem., 193 (1951) 265–275. [12] Miller, T.R., Taber, R.D., Molinari, E.J., Whiteaker, K.L., Monteggia, L.M., Scott, V.E., Brioni, J.D., Sullivan, J.P. and Gopalakrishnan, M., Pharmacological and molecular characterization of ATP-sensitive K 1 channels in the TE671 human medulloblastoma cell line, Eur. J. Pharmacol., 370 (1999) 179–185. [13] Morris, R.G.M., Development of a water maze procedure for studying spatial learning in the rat, J. Neurosci. Methods, 11 (1984) 47–60. [14] Muir, J.L., Acetylcholine, aging, and Alzheimer’s disease, Pharmacol. Biochem. Behav., 56 (1997) 687–696. [15] Paxinos, G. and Watson, P., The Rat Brain in Stereotaxic Coordinates, Academic Press, New York, 1986. [16] Rattan, A.K. and Tejwani, G.A., The neurotoxic actions of ibotenic acid on cholinergic and opioid peptidergic systems in the central nervous system of the rat, Brain Res., 571 (1992) 298–305.