Multilocus genotyping of Giardia duodenalis isolates from calves in Oromia Special Zone, Central Ethiopia

Infection, Genetics and Evolution 43 (2016) 281–288

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Multilocus genotyping of Giardia duodenalis isolates from calves in Oromia Special Zone, Central Ethiopia Teklu Wegayehu a,b,⁎, Md Robiul Karim c,d, Berhanu Erko a, Longxian Zhang d,⁎, Getachew Tilahun a a

Aklilu Lemma Institute of Pathobiology, Addis Ababa University, Addis Ababa, Ethiopia College of Natural Sciences, Arba Minch University, Arba Minch, Ethiopia Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, China d College of Animal Sciences and Veterinary Medicine, Henan Agricultural University, Zhengzhou, Henan, China b c

a r t i c l e

i n f o

Article history: Received 28 November 2015 Received in revised form 28 May 2016 Accepted 2 June 2016 Available online 04 June 2016 Keywords: Giardia duodenalis Assemblages Zoonotic transmission Calves Ethiopia

a b s t r a c t Giardia duodenalis is a widespread protozoan parasite that infects human and other mammals. Assessing the zoonotic transmission of the infection requires molecular characterization as there is considerable genetic variation within the species. This study was conducted to identify assemblages of Giardia duodenalis in dairy calves; and to assess the potential role of cattle isolates in zoonotic transmission in central Ethiopia. A total of 449 fecal samples were collected and screened using microscopy and PCR targeting the small-subunit (ssu) rRNA, triose phosphate isomerase (tpi), β-giardin (bg) and glutamate dehydrogenase (gdh) genes. The overall prevalence of Giardia duodenalis in dairy calves was found to be 9.6% (43/449). The prevalence of infection based on sex, age and breed difference was statistically not significant (p N 0.05). Genotyping results revealed the presence of assemblage E and assemblage A (AI). The genotypic frequency reported was 95.3% (41/43) for assemblage E and 4.7% (2/43) for assemblage A. There was one mixed infection with assemblages AI and E. Sequence analyses showed the existence of 10 genotypes within assemblage E. One genotype that showed novel nucleotide substitution was identified at the ssu rRNA locus. The other 9 genotypes, 3 at each locus, were identified at the tpi, the bg and the gdh loci with two of the gdh genotypes were novel. Findings of the current study indicate the occurrence of the livestock-specific assemblage E and the potentially zoonotic assemblage A, with the former being more prevalent. Although the zoonotic assemblage was less prevalent, there is a possibility of zoonotic human infection as AI is reported from both animals and humans. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Giardiasis is a gastrointestinal disease caused by species of protozoan parasites belonging to the genus Giardia. Among the six accepted species of Giardia, G. duodenalis (syn. Giardia intestinalis, Giardia lamblia) is the species with great public and veterinary health importance. The public health impact of giardiasis is significant because of its tendency to cause major outbreaks and emergency responses, and because of its adverse effects on growth and cognitive functions in children (Berkman et al., 2002; Halliez and Buret, 2013). Clinical manifestations of the disease in human are quite variable, ranging from asymptomatic to acute or chronic diarrhea, dehydration, abdominal pain, nausea, vomiting, and weight loss (Eckmann, 2003). Although subclinical infection is often reported in animals, infection can result in the onset of diarrhea, ill thrift and decreased weight in young animals (Geurden et al., 2010).

* Corresponding authors. E-mail addresses: [email protected] (T. Wegayehu), [email protected] (M.R. Karim), [email protected] (B. Erko), [email protected] (L. Zhang), [email protected] (G. Tilahun).

http://dx.doi.org/10.1016/j.meegid.2016.06.005 1567-1348/© 2016 Elsevier B.V. All rights reserved.

It is well documented that G. duodenalis represents a species complex and has the broadest host range (Caccio and Ryan, 2008; Feng and Xiao, 2011; Ryan and Caccio, 2013). Molecular studies have revealed at least eight major genetic groups (assemblages) (A-H) that have different host specificities. Assemblages A and B are known to infect humans and other animals. The remaining six assemblages (C to H) are host-specific (Feng and Xiao, 2011; Ryan and Caccio, 2013; Santin et al., 2012). However, assemblages C, D, E, and F have been reported from human at lower frequency in sporadic cases (Feng and Xiao, 2011; Liu et al., 2014; Strkolcova et al., 2015). The use of subtyping tools has identified five sub-assemblages within assemblages A and B, named AI-III and BIII-IV, some of which may have zoonotic potential. Sub-assemblages AI and AII are found in both humans and animals but appear to differ in host preference (Sprong et al., 2009; Xiao and Fayer, 2008). Sub-assemblage AI is preferentially found in livestock and pets whereas subassemblage AII is predominantly found in humans. Sub-assemblage AIII is almost exclusively found in wild ungulates and is likely to be non-zoonotic. The host distribution of assemblage B is predominantly in human and non-human primates (Feng and Xiao, 2011; Ryan and Caccio, 2013).

282

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

Cattle are commonly infected with assemblages A and E, with E being more prevalent than A (Dixon et al., 2011; Inpankaew et al., 2015; Paz e Silva et al., 2012; Minetti et al., 2014; Santin et al., 2012; Wang et al., 2014). Although assemblage B is less prevalent, it has been reported from many countries (Coklin et al., 2007; Dixon et al., 2011; Lalle et al., 2005; Ng et al., 2011; Ryan and Caccio, 2013; Winkworth et al., 2008). In addition, assemblages C, D and F have been reported from cattle in the United Kingdom (Minetti et al., 2014); and assemblage F from cattle in Spain (Cardona et al., 2015). An age-related distribution of assemblages A and E has also been reported in cattle. Assemblage A was mainly identified in pre-weaned calves and assemblage E was more common in older animals (Mark-Carew et al., 2012; Trout et al., 2007). Molecular studies conducted in Ethiopia have shown the occurrence of assemblages A and B in humans (Gelanew et al., 2007; Flecha et al., 2015; Wegayehu et al., 2016). Mixed infections of assemblages A and F

have also been reported (Gelanew et al., 2007). However, no investigation has been conducted in describing the assemblages of G. duodenalis in cattle from Ethiopia. The objective of this study was to characterize the assemblage and sub-assemblage of G. duodenalis in calves; and to assess the potential role of cattle isolates in zoonotic transmission. 2. Materials and methods 2.1. Study area This cross-sectional study was conducted in Holetta, Sendafa and Chancho and their surroundings of Oromia Special Zone, central Ethiopia between January and June 2014 (Fig. 1). The three study areas are located at a distance of ~40 km west, northeast and north of the capital city, Addis Ababa. Based on the available climatological data, the mean

Fig. 1. Map of Ethiopia showing the location of study sites, Holetta, Sendafa and Chancho.

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

annual rainfall varies from 700 mm to 1400 mm in lowlands and highlands, respectively. The mean annual temperature of the Zone is found between 20–25 °C in the lowlands and 10–15 °C in the highlands. Mixed farming is the major livelihood of the people in the area. The owned livestock includes cattle, sheep and poultry. 2.2. The study animals The target population of this study was indigenous zebu and crossbred (Holstein Friesian X indigenous zebu) dairy calves. The indigenous zebu was widespread and owned by farmers in small number, on average 5 cattle per household. The crossbred, on the other hand, was mainly owned by private smallholder dairy farms (Abebe et al., 2008). A total of 449 dairy calves (153 from Holetta, 176 from Sendafa and 120 from Chancho), age younger than five months, were included in this study. 2.3. Specimen collection and microscopy Single fresh fecal sample was collected from each calf in a labeled and sterile stool container. The specimens were taken directly from the rectum of each animal or immediately after defecation using sterile disposable gloves. During sample collection identification number, sex, age and breed of calves were recorded. A portion of each specimen was examined under light microscope to detect cysts of G. duodenalis using the Lugol's iodine staining at 10X and 40X magnifications. Few diarrheic stools were also examined by direct wet mount with saline (0.85% sodium chloride solution) to observe trophozoites. The remaining specimen was preserved in 2.5% potassium dichromate and transported to Animal Health Parasitology Laboratory, Aklilu Lemma Institute of Pathobiology (ALIPB) at ambient temperature and stored at 4 ° C prior to DNA extraction. 2.4. DNA extraction The preserved fecal specimens were washed with deionized water until the potassium dichromate was removed. Genomic DNA was extracted from each fecal sample using the E.Z.N.A.® Stool DNA kit (Omega Biotek Inc., Norcross, USA). Briefly, about 50–100 mg of stool sample was added in a 2 mL centrifuge tube containing 200 mg of glass beads and placed on ice. Following, 300 µL buffer SP1 and proteinase K were added into the mix, and incubated at 70 °C for 10 min. Subsequently, all the procedures outlined in product manual were performed according to the manufacturer's protocol. Finally, DNA was eluted in 200 μL of elution buffer and the extract was stored at −20 °C until PCR.

283

2.5. Genotyping of G. duodenalis The assemblages of the G. duodenalis were determined using PCR amplification of the small-subunit (ssu) rRNA, triose phosphate isomerase (tpi), β-giardin (bg) and glutamate dehydrogenase (gdh) genes. Nested PCR was conducted based on previously described PCR conditions to amplify fragments of the ssu rRNA gene (Appelbee et al., 2003), the tpi gene (Sulaiman et al., 2003), the bg gene (Caccio et al., 2002), and the gdh gene (Read et al., 2004), with some modifications. The primers used, the gene targets, the annealing temperature, and the expected sizes of PCR products are summarized in Table 1. The PCR reactions were conducted in 25 µL reaction volume. The ssu rRNA protocol was contained 1 × GC buffer II, 200 μM each dNTP, 0.4 μM each primer, 1 unit of LA Taq DNA polymerase, and 2 μL of DNA sample. The PCR reaction of the tpi and gdh genes was contained 1× PCR buffer, 200 μM each dNTP, 0.4 μM each primer, 1 unit of rTaq DNA polymerase, and 2 μL of DNA sample. In the bg protocol, Ex Taq buffer and Ex Taq DNA polymerase were used instead of 1× PCR buffer and rTaq DNA polymerase. The PCR reagent kit was purchased from Takara Shuzo Co., Ltd., Kyoto, Japan. The secondary PCR reactions were similar to the primary PCR with the exception that 2 µL of the primary PCR product was used as a template. In addition, the annealing temperature of ssu rRNA and bg gene was changed (Table 1). Both positive and negative controls were included in each round of PCR to validate results. The amplified products were separated by electrophoresis on 1% agarose gel stained with ethidium bromide and visualized under UV trans-illuminator. The molecular techniques (DNA extraction, PCR and sequencing) were conducted at the International Joint Research Laboratory for Zoonotic Diseases at Henan Agricultural University, China. 2.6. DNA sequence analysis All positive PCR products were purified using Montage PCR filters (Millipore, Bedford, MA) and sequenced using an ABI BigDye Terminator v. 3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA) on an ABI 3100 automated sequencer (Applied Biosystems). Sequence accuracy was confirmed by sequencing both directions with primers used for the secondary PCRs. The raw nucleotide sequences and chromatograms of both forward and reverse directions were viewed using the EditSeq 5.0 and Chromas 2.4 program, respectively. The presence of double peaks at the chromatogram level was verified and the sequences were aligned and analyzed using ClustalX software. Consensus sequences were then compared to homologous sequences in GenBank using the Basic Local Alignment Search Tool (BLAST) (http://www. ncbi.nlm.nih.gov/blast/) to determine the assemblages and sub-assemblages of G. duodenalis. The representative nucleotide sequences

Table 1 Summary of target genes, primers, annealing temperature and amplicon size of G. duodenalis.

Target Gene

Primer (sequence 5´-3´)

ssu rRNA

Gia2029 (AAGTGTGGTGCAGACGGACTC) Gia2150c (CTGCTGCCGTCCTTGGATGT) RH11 (CATCCGGTCGATCCTGCC) RH4 (AGTCGAACCCTGATTCTCCGCCCAGG) AL3543 (AAATIATGCCTGCTCGTCG) AL3546 (CAAACCTTITCCGCAAACC) AL3544 (CCCTTCATCGGIGGTAACTT) AL3545 (GTGGCCACCACICCCGTGCC) G7 (AAGCCCGACGACCTCACCCGCAGTGC) G759 (GAGGCCGCCCTGGATCTTCGAGACGAC) BG-F2 (GAACGAACGAGATCGAGGTCCG) BG-R2 (CTCGACGAGCTTCGTGTT) Ghd1 (TTCCGTRTYCAGTACAACTC) Gdh2 (ACCTCGTTCTGRGTGGCGCA) Gdh3 (ATGACYGAGCTYCAGAGGCACGT) Gdh4 (GTGGCGCARGGCATGATGCA)

tpi

bg

gdh

Annealing temp (°C)

length (bp)

Reference

55

497

Trout et al. (2005)

59

292

50

605

50

530

65

753

55

511

50

–

50

520

Caccio et al. (2008)

Liu et al. (2012)

Caccio et al. (2002)

284

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

obtained in this study were deposited in the GenBank database under the accession numbers: KT922263, KT922257 to KT922259, KT922247 to KT922249, and KT922252 to KT922255 for ssu rRNA, tpi, bg and gdh genes, respectively.

However, the difference was not statistically significant (p N 0.05). Similarly, the prevalence of infection based on sex, age, and breed group did not show significant difference.

2.7. Phylogenetic analysis

3.2. Assemblages of G. duodenalis

A phylogenetic tree was built using the Molecular Evolutionary Genetics Analysis (MEGA) program version 4.0 to estimate the evolutionary relationship, based on genetic distance calculated by Kimura-2parameter. The reliability of the phylogenetic tree groupings was assessed by bootstrap analysis with 1000 replicates.

The assemblages of G. duodenalis identified in this study are presented in Tables 4 and 5. Multi-locus genotyping (MLG) of the 43 positive samples revealed the occurrence of the livestock-specific assemblage E and the zoonotic assemblage A. There was one mixed infection with assemblages AI and E. G. duodenalis assemblage E was the most prevalent detected from 95.3% (41/43); whereas assemblage A was less prevalent identified from 4.7% (2/43). Assemblage A was identified in Holetta and Chancho at the gdh gene.

2.8. Statistical analysis Data were computerized using EpiData version 3.1 and transferred to STATA Software for analysis. Chi square test was used to verify possible association of G. duodenalis infection with study areas, sex, age and breed of the calves. Values were considered to be statistically significant when the p value was b0.05. 2.9. Ethical statement Ethical clearance was obtained from the Institutional Review Board of ALIPB, Addis Ababa University and the National Health Research Ethics Review Committee. Support letters were obtained from Oromia Special Zone Animal Health Office and Agriculture Offices at community level. The objectives of the study were explained to owners of the calves before the collection of the specimens and permission was obtained. 3. Results From a total of 449 calves included in this study, 229 (51.0%) were indigenous zebu and 220 (49.0%) were crossbred calves (Table 3). The calves were also stratified in three age groups: b 1 month, 1– 3 months and N 3 months making 113 (25.2%), 152 (33.9%) and 184 (41.0%), respectively. The mean age of the calves was 2.5 months (ranged: 0.1 to 5 months). The number of male and female calves was 200 (44.5%) and 249 (55.5%) respectively with male to female ratio of 1:0.8. The calves were apparently healthy except few cases of diarrhea observed during sample collection. 3.1. Prevalence of G. duodenalis From the fecal samples collected from calves, 4.5% (20/449) and 9.6% (43/449) were found positive by microscopy and PCR, respectively. PCR-positive result was an isolate that tested positive by any of the PCR protocols used. The diagnostic performance of the ssu rRNA, tpi, bg and gdh genes of the G. duodenalis was shown in Table 2. As noted from the Table, the ssu rRNA and gdh were able to detect 4.9% (22/ 449) of G. duodenalis positives from the whole samples. The prevalence of G. duodenalis infection varied across the study areas with higher prevalence 17 (11.1%) recorded in Holetta (Table 3).

3.3. Genetic characterization Sequences obtained from the 43 isolates were further analyzed and compared with similar sequences at the GenBank database to determine genetic polymorphism within assemblages of G. duodenalis. The entire 22 isolates found at the ssu rRNA gene were identical to each other and identified as assemblage E. These isolates showed a novel nucleotide substitution compared with the reference isolate sequence (JF957620), and named as EE1 (first E for Ethiopia). Seventeen isolates obtained at the tpi gene were identified as assemblage E. The nucleotide sequences of these isolates showed three distinct genotypes, named as tpiE1, tpiE2 and tpiE3, for a convenient description (Table 6). Eight of the 17 isolates were identified as tpiE1 and the remaining 9 were identified as tpiE2 (n = 6) and tpiE3 (n = 3). When compared to other sequences in the GenBank database tpiE1, tpiE2 and tpiE3 showed 100% nucleotide sequence identity to the assemblage E from cattle in Bangladesh (KJ363351), sheep in Spain (JF792419) and cattle in Japan (AB569406), respectively. The tpiE2 had two single nucleotide polymorphism (SNPs) at positions 57 (T to C) and 78 (T to C), whereas tpiE3 only has the later compared to the reference KJ363351. All the 16 isolates obtained at the bg gene were identified as assemblage E and revealed the presence of three distinct genotypes, named as bgE1 (n = 8), bgE2 (n = 4) and bgE3 (n = 4) (Table 6). BLAST analysis of nucleotide sequences of bgE1, bgE2 and bgE3 showed 100% sequence similarity to the assemblage E reported from dairy calves in USA (AY655703), goat kids in Spain (EU189361) and from wastewater in USA (DQ116624), respectively. The SNPs are shown in Table 6. Of the 22 isolates found at the gdh gene, 20 were identified as assemblage E (three distinct genotypes, named as gdhE1, gdhE2 and gdhE3) and the remaining 2 were identified as assemblage A (Table 6). Fifteen of the 20 isolates identified as assemblage E were gdhE1 and 100% identical to isolates registered with GenBank accession numbers KP635110, KF843923, EF507645, EF507644 and KC960651 among others. The other isolates: gdhE2 (n = 3) and gdhE3 (n = 2) were novel, named as EE2 and EE3, respectively.

Table 2 Diagnostic performance of the four genes in examining G. duodenalis infection in dairy calves. Diagnostic performance of each marker Number of positives (%) Study areas

Number of samples examined

ssu rRNA

tpi

bg

gdh

Holeta Sendafa Chancho Total

153 176 120 449

13(8.5) 9(5.1) – 22(4.9)

5(3.3) 4(2.3) 8(8.3) 17(3.8)

4(2.6) 6(3.4) 6(5.0) 16 (3.6)

7(4.6) 7(4.0) 8(6.7) 22(4.9)

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

285

Table 3 Prevalence of G. duodenalis in dairy calves by study site, sex, age and breed groups in Oromia Special Zone, central Ethiopia (January–June, 2014). Demographic characteristics Study Site Holetta Sendafa Chancho Sex Male Female Age group b1 month 1–3 months N3 months Breed group Indigenous zebu Crossbred

No of Samples examined

No of Samples positives (%)

χ2

p value

153 176 120

17 (11.1) 16 (9.1) 10 (8.3)

0.678

0.712

200 249

18(9.0) 25(10.0)

0.138

0.710

113 152 184

12(10.6) 15(9.9) 16(8.7)

0.321

0.851

229 220

25(10.9) 18(8.2)

0.969

0.325

Key: χ2 and p values compare the prevalence among study sites, sex, age and breed group.

Multiple alignment analysis revealed that nucleotide sequences of these isolates differ from reference sequence KF843925 by 1 to 3 SNPs. The isolates identified as assemblage A (KT922255) were sub-assemblage AI. Sequence analysis of these isolates showed 100% similarity with the reference sequences in the GebBank (KF843930, HM134217, EF507642 and GQ329675). Sequence analysis also revealed that isolate HC-14 was identified as assemblage E at the ssu rRNA gene but assemblage A at the gdh gene (Table 5). 3.4. Phylogenetic analysis The phylogenetic tree was built using 6 representative sequences from isolates identified at gdh locus in this study and 8 references sequences from the GenBank (Fig. 2). The nucleotide sequence (AF069060) of G. ardeae was used as an out-group to root the tree. The analysis showed that cattle isolates of assemblage A identified in this study were clustered with the sub-assemblage AI of human isolates (EF685690). The phylogenetic analysis also indicated that the novel isolate EE2 (KT922253) was sub-clustered nearby assemblage E of cattle isolate. However, the other novel isolate EE3 (KT922254) was clustered with assemblage E of the pig isolate. 4. Discussion G. duodenalis is widespread protozoan parasite both in humans and animals worldwide. The use of subtyping tools, especially the MLG tools, in well-designed studies is necessary to understand the genetic diversity and in so doing have helped to resolve questions about their transmission patterns and associated impacts on public health (Caccio et al., 2008; Thompson and Ash, 2015). The occurrence and distribution of assemblages and sub-assemblages of G. duodenalis have been widely studied in cattle, particularly in developed nations. However, to date, there is no report describing the assemblages of G. duodenalis in cattle from Ethiopia. The present study determines the prevalence and assemblages of G. duodenalis among dairy calves in three districts in Oromia Special Zone, central Ethiopia to assess the potential role of cattle isolates in zoonotic transmission. In this study, the overall prevalence of G. duodenalis in dairy calves was found to be 9.6%. This rate was higher than the previous microscopy based prevalence (2.3%), reported in cattle from Ethiopia (Wegayehu et al., 2013). This observation supports the superior sensitivity of PCR in detecting G. duodenalis as expected. The infection rate of G. duodenalis in cattle has shown wide variation within and between countries (Geurden et al., 2008; Helmy et al., 2014; Minetti et al., 2014; Wang et al., 2014; Winkworth et al., 2008). Therefore, it is difficult to compare the result obtained in this study with the results from other countries as the prevalence could be affected by complex determining factors

such as the husbandry and management system, hygienic conditions inside and around the farms, cattle stocking density, the nursing condition and water supply among others. In addition, the difference in prevalence reported worldwide are dependent on the test used and its diagnostic performance. Molecular typing at the ssu rRNA, tpi, bg and gdh genes revealed the presence of two assemblages of G. duodenalis in calves. The results confirmed the predominance of livestock-specific assemblage E (95.3%) in dairy calves. Although the zoonotic assemblage A was less prevalent (4.7%) in this survey, one mixed infection with assemblages A and E were reported. Previous studies have also shown assemblage E to be the predominant assemblage, being found in 80–100% of the specimens in dairy and beef cattle (Dixon et al., 2011; Inpankaew et al., 2015; Minetti et al., 2014; O'Handley et al., 2000; Paz e Silva et al., 2012; Santin et al., 2009; Santin et al., 2012; Trout et al., 2007; Wang et al., 2014). Mixed infections with assemblages of G. duodenalis have also been reported (Caccio et al., 2008; Gomez-Munoz et al., 2012; Read et al., 2004; Sprong et al., 2009; Wang et al., 2014). Most interests in the zoonotic transmission of G. duodenalis focus on sub-assemblages AI and AII, as they are reported both in humans and animals (Feng and Xiao, 2011; Ryan and Caccio, 2013). The occurrence of sub-assemblage AI in calves in the current study supports the observation that this sub-assemblage predominates in animals than in humans (Xiao and Fayer, 2008; Sprong et al., 2009). The previous molecular studies conducted in Ethiopia showed the occurrence of sub-assemblage AI, AII, BIII and BIV in humans (Gelanew et al., 2007; Flecha et al., 2015; Wegayehu et al., 2016). Hence, the occurrence of assemblage AI isolates both in cattle and humans warrants further investigation due to the zoonotic potential of sub-assemblage within this assemblage. Although assemblage B has been reported in cattle in previous studies (Lalle et al., 2005; Paz e Silva et al., 2012), it was not identified in any of the calves in this survey. The distribution of assemblages A and E in dairy cattle appears agerelated. Previous reports showed that assemblage A is more prevalent in pre-weaned calves than the older cattle (Mark-Carew et al., 2012; Trout et al., 2007; Wang et al., 2014). In our study, however, the vast majority of G. duodenalis isolates detected in calves were characterized as assemblage E. This finding was in accordance with previous reports regarding giardiasis as a common infection in younger farm animals (Liu et al., 2012; Wade et al., 2000). In the present study, the genotyping result of isolate HC-14 obtained at the ssu rRNA and gdh loci was not consistent. The ssu rRNA locus classified the isolate as assemblage E whereas the gdh gene classified the isolate as assemblage A. Several studies based on MLG approach have been reported similar results showing a number of human and animal isolates that could not be unequivocally assigned at the assemblage level (Caccio et al., 2008; Read et al., 2004; Santin et al., 2013; Traub et al., 2004). The identification of inconsistent assemblage by different

286

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

Table 4 Assemblages of G. duodenalis identified in dairy calves in Oromia Special Zone, central Ethiopia (January–June, 2014). No. of assemblages among positives (%) Study areas

No. of samples examined

No. of samples positive (%)

A

E

Holetta Sendafa Chancho Total

153 176 120 449

17(11.1) 16(9.1) 10(8.3) 43(9.6)

1(5.9) 1(6.3) 0 2(4.7)

16(94.1) 15(93.8) 10(100.0) 41(95.3)

genes for the same isolate could be the result of recombination or the presence of mixed infection with more than one assemblage (Beck et al., 2012; Teodorovic et al., 2007). DNA sequence analysis also revealed genetic variations within G. duodenalis assemblage E at the tpi, bg and gdh genes. Three distinct variant copies of the tpi gene were obtained from 17 isolates with tpiE1being the most prevalent. Likewise, three distinct bg gene variant were identified from 16 isolates. One of them (bgE2) appeared to show 3 SNPs. Of the three districts variants at the gdh gene, two were novel genotypes and had 3 SNPs each at different positions. Similar genetic polymorphism was reported in assemblage E from dairy cattle at the tpi gene (Feng et al., 2008) and at the bg and gdh genes (Wang et al., 2014). Phylogenetic analysis also showed that the novel genotypes

were clustered with reference isolates obtained from cattle and pig. The findings might show genetic diversity within G. duodenalis assemblage E in dairy calves in the study areas. G. duodenalis has been better characterized using MLGs in humans and animals (Caccio et al., 2008). The ssu rRNA gene is particularly suitable for screening large numbers of samples as it is easy to amplify because of its multicopy nature. Moreover, it shows no crossamplification with the DNA of other organisms (Hopkins et al., 1997). However, this locus is too conserved to detect variability at the sub-assemblage level (Wielinga and Thompson, 2007), and the use of more variable markers such as bg, tpi and gdh is needed to identify potentially zoonotic sub-assemblage (Sprong et al., 2009).

Table 5 Assemblages and sub-assemblages of G. duodenalis as determined by sequence analysis of ssu rRNA, tpi, bg and gdh genes in calves. Calves

Assemblages/sub-assemblages under genes

Study site

Isolate code

Sex

Age

ssu rRNA

tpi

bg

gdh

Holetta

HC-12 HC-14 HC-15 HC-26 HC-27 HC-32 HC-44 HC-49 HC-58 HC-69 HC-71 HC-77 HC-78 HC-86 HC-93 SC-33 SC-37 SC-51 SC-55 SC-57 SC-63 SC-64 SC-76 SC-82 SC-86 SC-91 SC-93 SC-95 CC-35 CC-47 CC-58 CC-60 CC-70 CC-81 CC-87 CC-94 CC-96 CC-112 CC-115 CC-130 CC-147 CC-153 CC-155

F F F F M F M M F F M M F F M F M M F F F F F M F F M M F F M M M F M M F M M F F F M

1.6 1.5 1.5 3 3 4 3 3 2 3 1.5 2 1.5 2 1 3 0.5 3 2 4 1 2 3 0.5 4 2 3 4 1 0.5 3 3 3 2 0.5 1 2.5 4 5 0.5 0.2 2.5 2

E* E* E* E* E* E* – E* E* E* E* E* E* – E* – E* – E* – E* E* – E* E* E* E* E* – – – – – – – – – – – – – – –

– – – – E – E – E – – – E E – E – E – – – – E E – – – – E E – E E E E E E – – – – – –

– – – – E – – E – – – – E E – – E E E – – – E E – – E – E – – – E – E E – – – E – – E

E* A (AI) – – – – E E E E – E – – – – E E – E* – – E* – E E E – E* – E – – – E* – – E E – A (AI) E E

Sendafa

Chancho

Key: Asterisks (*) indicate novel sub-genotypes; hyphens (−) indicate PCR-negative results.

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

287

Table 6 The genetic variants found within genotypes of G. duodenalis assemblage E at the tpi, bg and gdh genes in calves. Nucleotide position Genetic variants tpi gene E (Ref.) tpiE1 tpiE2 tpiE3 bg gene E (Ref.) bgE1 bgE2 bgE3. gdh gene E (Ref.) gdhE1 EE2 EE3

GenBank Accession no

No. of isolates

KJ363351 KT922257 KT922258 KT922259

8 6 3

AY655703 KT922247 KT922248 KT922249 KF843925 KT922252 KT922253 KT922254

8 4 4

15 3 2

57

78

T * C * 23 A T T T 41 C * T *

T * C C 87 T * C * 95 C T * *

294 T * C C 131 A * * G

200 G * * A

272 T * * G

463 G * A *

491 C * T *

Key: Asterisks (*) indicate nucleotide identity with the reference sequence. Nucleotide positions are numbered according to the references (ref.) with the first nucleotide as position 1. The tpiE1 to tpiE3 correspond to positions 1–530 of reference sequence KJ363351; bgE1 to bgE3 to positions 23–535 of reference sequence AY655703; and gdh1 to EE3 to positions 1–520 of reference sequence KF843925.

Fig. 2. Phylogenetic tree of G. duodenalis based on nucleotide sequences of the gdh gene. The tree was constructed using the neighbor-joining method based on genetic distance calculated by the Kimura 2-parameter model, implemented in MEGA version 5.2. Bootstrap values N50% from 1000 replicates is shown on nodes. The tree is rooted by G. ardea (AF069060). Reference sequences from the GenBank have accession number, sub-assemblage designation and host origin, and are written in bold. Isolates showed known and novel sequences are marked by rectangles and triangles respectively, and are written in light blue color.

In conclusion, this study demonstrated substantial levels of G. duodenalis infection in dairy calves. This level appears to be sufficient to provide a reservoir of infectious organism to other calves. MLG demonstrated that most calves were infected with the livestock-specific assemblage E though only a minority of the calves harbored the potentially zoonotic assemblage A (AI). Although sub-assemblage AI appears low, calves in cow-calf operations could be considered as potential sources of zoonotic sub-assemblage.

Minch University was also remarkable. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. We would like to express our gratitude to colleagues of International Joint Research Laboratory for Zoonotic Diseases, Henan Agricultural University (China) for their technical assistance during the molecular work. Our special thanks also go to Dr. Anto Arkato for his language edition.

Acknowledgements

References

This study was supported by the Office of Graduate Studies and the Office of the Vice President for Research and Technology Transfer, Thematic Research Fund, Addis Ababa University; and the State Key Program of National Natural Science Foundation of China (No. 31330079), and Innovation Scientists and Technicians Troop Construction Projects of Henan Province (No. 134200510012). The contribution of Arba

Abebe, R., Wossene, A., Kumsa, B., 2008. An epidemiological study of Cryptosporidium infection in dairy calves on selected dairy farms of Central Ethiopia. Rev. Med. Vet. 159, 107–111. Appelbee, A.J., Frederick, L.M., Heitman, T.L., Olson, M.E., 2003. Prevalence and genotyping of Giardia duodenalis from beef calves in Alberta, Canada. Vet. Parasitol. 112, 289–294. Beck, R., Sprong, H., Pozio, E., Caccio, S.M., 2012. Genotyping G. duodenalis isolates from dogs: lesson from a multilocus sequence typing study. Vector borne Zoonotic Dis. 12, 206–213.

288

T. Wegayehu et al. / Infection, Genetics and Evolution 43 (2016) 281–288

Berkman, D.S., Lescano, A.G., Gilman, R.H., Lopez, S.L., Black, M.M., 2002. Effects of stunting, diarrhoeal disease, and parasitic infection during infancy on cognition in late childhood: a follow-up study. Lancet 359, 564–571. Caccio, S.M., Ryan, U., 2008. Molecular epidemiology of giardiasis. Mol. Biochem. Parasitol. 160, 75–80. Caccio, S.M., de Giacomo, M., Pozio, E., 2002. Sequence analysis of the b-giardin gene and development of a PCR-RFLP assay to genotype Giardia duodenalis cysts from human faecal samples. Int. J. Parasitol. 32, 1023–1030. Caccio, S.M., Beck, R., Lalle, M., Marinculic, A., Pozio, E., 2008. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int. J. Parasitol. 38, 1523–1531. Cardona, G.A., de Lucio, A., Bailo, B., Cano, L., de Fuentes, I., Carmena, D., 2015. Unexpected finding of feline-specific Giardia duodenalis assemblage F and Cryptosporidium felis in asymptomatic adult cattle in northern Spain. Vet. Parasitol. 209, 258–263. Coklin, T., Farber, J., Parrington, L., Dixon, B., 2007. Prevalence and molecular characterization of Giardia duodenalis and Cryptosporidium spp. in dairy cattle in Ontario, Canada. Vet. Parasitol. 150, 297–305. Dixon, B., Parrington, L., Cook, A., Pintar, K., Pollari, F., Kelton, D., Farber, J., 2011. The potential for zoonotic transmission of Giardia duodenalis and Cryptosporidium spp. from beef and dairy cattle in Ontario, Canada. Vet. Parasitol. 175, 20–26. Eckmann, L., 2003. Mucosal defenses against Giardia. Parasite Immunol. 25, 259–270. Feng, Y., Xiao, L., 2011. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 24, 110–140. Feng, Y., Ortega, Y., Cama, V., Terrel, J., Xiao, L., 2008. High intra-genotypic diversity of Giardia duodenalis in dairy cattle on three farms. Parasitol. Res. 103, 87–92. Flecha, M.J., Benavides, C.M., Tissiano, G., Tesfamariam, A., Cuadros, J., de Lucio, A., Bailo, B., Cano, L., Fuentes, I., Carmena, D., 2015. Detection and molecular characterization of Giardia duodenalis, Cryptosporidium spp. and Entamoeba spp. among patients with gastrointestinal symptoms in Gambo hospital, Oromia region, southern Ethiopia. Tropical Med. Int. Health 20, 1213–1222. Gelanew, T., Lalle, M., Hailu, A., Pozio, E., Caccio, S.M., 2007. Molecular characterization of human isolates of Giardia duodenalis from Ethiopia. Acta Tropica 120, 92–99. Geurden, T., Geldhof, P., Levecke, B., Martens, C., Berkvens, D., Casaert, S., Vercruysse, J., Claerebout, E., 2008. Mixed Giardia duodenalis A and E infections in calves. Int. J. Parasitol. 38, 259–264. Geurden, T., Vandenhoute, E., Pohle, H., Casaert, S., de Wilde, N., Vercruysse, J., Claerebout, E., 2010. The effect of a fenbendazole treatment on cyst excretion and weight gain in calves experimentally infected with Giardia duodenalis. Vet. Parasitol. 169, 18–23. Gomez-Munoz, M.T., Camara-Badenes, C., Martinez-Herrero Mdel, C., Dea-Ayuela, M.A., Perez-Gracia, M.T., 2012. Multilocus genotyping of Giardia duodenalis in lambs from Spain reveals a high heterogeneity. Res. Vet. Sci. 93, 836–842. Halliez, M.C., Buret, A.G., 2013. Extra-intestinal and long term consequences of Giardia duodenalis infections. World J. Gastroenterol. 19, 8974–8985. Helmy, Y.A., Klotz, C., Wilking, H., Krücken, J., Nöckler, K., Samson-Himmelstjerna, G.V., Zessin, K.H., Aebischer, T., 2014. Epidemiology of Giardia duodenalis infection in ruminant livestock and children in the Ismailia province of Egypt: insights by genetic characterization. Parasit. Vectors 7, 321. Hopkins, R.M., Meloni, B.P., Groth, D.M., Wetherall, J.D., Reynoldson, J.A., Thompson, R.C., 1997. Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. J. Parasitol. 83, 44–51. Inpankaew, T., Jiyipong, T., Thadtapong, N., Kengradomkij, C., Pinyopanuwat, N., Chimnoi, W., Jittapalapong, S., 2015. Prevalence and genotype of Giardia duodenalis in dairy cattle from northern and northeastern part of Thailand. Acta Parasitol. 60, 459–461. Lalle, M., Pozio, E., Capelli, G., Bruschi, F., Crotti, D., Caccio, S.M., 2005. Genetic heterogeneity at the beta-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int. J. Parasitol. 35, 207–213. Liu, A., Zhang, X., Zhang, L., Wang, R., Li, X., Shu, J., Zhang, X., Shen, Y., Zhang, W., Ling, H., 2012. Occurrence of bovine giardiasis and endemic genetic characterization of Giardia duodenalis isolates in Heilongjiang Province, in the northeast of China. Parasitol. Res. 111, 655–661. Liu, H., Shen, Y.J., Yin, J.H., Yuan, Z., Jiang, Y., Xu, Y., Pan, W., HU, Y., Cao, J., 2014. Prevalence and genetic characterization of Cryptosporidium, Enterocytozoon, Giardia and Cyclospora in diarrheal outpatients in China. BMC Infect. Dis. 14, 25.

Mark-Carew, M.P., Wade, S.E., Chang, Y.F., Schaaf, S., Mohammed, H.O., 2012. Prevalence of Giardia duodenalis assemblages among dairy herds in the New York City watershed. Vet. Parasitol. 185, 151–157. Minetti, C., Taweenan, W., Hogg, R., Featherstone, C., Randle, N., Latham, S.M., Wastling, J.M., 2014. Occurrence and diversity of Giardia duodenalis assemblages in livestock in the UK. Transbound. Emerg. Dis. http://dx.doi.org/10.1111/tbed.12075. Ng, J., Yang, R., McCarthy, S., Gordon, C., Hijjawi, N., Ryan, U., 2011. Molecular characterization of Cryptosporidium and Giardia in pre-weaned calves in Western Australia and new South Wales. Vet. Parasitol. 176, 145–150. O'Handley, R.M., Olson, M.E., Fraser, D., Adams, P., Thompson, R.C.A., 2000. Prevalence and genotypic characterization of Giardia in dairy calves from Western Australia and western Canada. Vet. Parasitol. 90, 193–200. Paz e Silva, F.M., Raimundo Souza Lopes, R.S., Araújo Jr., J.P., 2012. Genetic characterization of Giardia duodenalis in dairy cattle in Brazil. Folia Parasitol. 59, 15–20. Read, C.M., Monis, P.T., Thompson, R.C., 2004. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect. Genet. Evol. 4, 125–130. Ryan, U., Caccio, S.M., 2013. Zoonotic potential of Giardia. Int. J. Parasitol. 43, 943–956. Santin, M., Trout, J.M., Fayer, R., 2009. A longitudinal study of Giardia duodenalis genotypes in dairy cows from birth to two years of age. Vet. Parasitol. 162, 40–45. Santin, M., Dargatz, D., Fayer, R., 2012. Prevalence of Giardia duodenalis assemblages in weaned cattle on cow-calf operations in the United States. Vet. Parasitol. 183, 231–236. Santin, M., Cortes Vecino, J.A., Fayer, R., 2013. A large scale molecular study of G. duodenalis in horses from Colombia. Vet. Parasitol. 196, 31–36. Sprong, H., Caccio, S.M., van der Giessen, J.W., 2009. Identification of zoonotic genotypes of Giardia duodenalis. PLoS Negl. Trop. Dis. 3, e558. Strkolcova, G., Madar, M., Hinney, B., Goldova, M., Mojzisova, J., Halanova, M., 2015. Dog's genotype of Giardia duodenalis in human: first evidence in Europe. Acta Paras 60, 796–799. Sulaiman, I.M., Fayer, R., Bern, C., Gilman, R.H., Trout, J.M., Schantz, P.M., Das, P., Lal, A.A., Xiao, L., 2003. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg. Infect. Dis. 9, 1444–1452. Teodorovic, S., Braverman, J.M., Elmendorf, H.G., 2007. Unusually low levels of genetic variation among Giardia lamblia isolates. Eukaryot. Cell 6, 1421–1430. Thompson, R.C.A., Ash, A., 2015. Molecular epidemiology of Giardia and Cryptosporidium infections. Infect. Genet. Evol. http://dx.doi.org/10.1016/j.meegid. Traub, R.J., Monis, P.T., Robertson, I., Irwin, P., Mencke, N., Thompson, R.C., 2004. Epidemiological and molecular evidence supports the zoonotic transmission of Giardia among humans and dogs living in the same community. Parasitology 128, 253–262. Trout, J.M., Santin, M., Greiner, E., Fayer, R., 2005. Prevalence and genotypes of Giardia duodenalis in post-weaned dairy calves. Vet. Parasitol. 130, 177–183. Trout, J.M., Santin, M., Fayer, R., 2007. Prevalence of Giardia duodenalis genotypes in adult dairy cows. Vet. Parasitol. 147, 205–209. Wade, S.E., Mohammed, H.O., Schaaf, S.L., 2000. Epidemiologic study of Giardia sp. infection in dairy cattle in southeastern New York state. Vet. Parasitol. 89, 11–21. Wang, H., Zhao, G., Chen, G., Jian, F., Zhang, S., Feng, C., Wang, R., Zhu, J., Dong, H., Hua, J., Wang, M., Zhang, L., 2014. Multilocus genotyping of Giardia duodenalis in dairy cattle in Henan, China. PLoS ONE. 9, e100453. http://dx.doi.org/10.1371/journal.pone. 0100453. Wegayehu, T., Adamu, H., Petros, B., 2013. Prevalence of Giardia duodenalis and Cryptosporidium species infections among children and cattle in north Shewa zone, Ethiopia. BMC Infect. Dis. 13, 419. Wegayehu, T., Karim, M.R., 2016. Multilocus Genotyping of Giardia duodenalis iIsolates from Children in Oromia Special Zone, Central Ethiopia. BMC Microbiol. 16, 89. Wielinga, C.M., Thompson, R.C.A., 2007. Comparative evaluation of Giardia duodenalis sequence data. Parasitology 134, 1795–1821. Winkworth, C.L., Matthaei, C.D., Townsend, C.R., 2008. Prevalence of Giardia and Cryptosporidium spp. in calves from a region in New Zealand experiencing intensification of dairying. N. Z. Vet. J. 56, 15–20. Xiao, L., Fayer, R., 2008. Molecular characterization of species and genotypes of Cryptosporidium and Giardia and assessment of zoonotic transmission. Int. J. Parasitol. 38, 1239–1255.