- Email: [email protected]
Multiplex PCR development for the differential detection of four medically important echinostomes (Trematoda: Echinostomatidae) in Thailand
Acta Tropica 204 (2020) 105304
Contents lists available at ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Multiplex PCR development for the differential detection of four medically important echinostomes (Trematoda: Echinostomatidae) in Thailand Chairat Tantrawatpana, Weerachai Saijunthab, a b
T
⁎
Division of Cell Biology, Department of Preclinical Sciences, Faculty of Medicine, Thammasat University, Rangsit Campus, Pathumthani 12120, Thailand Walai Rukhavej Botanical Research Institute, Mahasarakham University, Maha Sarakham 44150, Thailand
A R T I C LE I N FO
A B S T R A C T
Keywords: Echinostomiasis NADH dehydrogenase subunit 1 Molecular differentiation Specific primer
Four species of echinostomes, Echinostoma revolutum (Froelich, 1802), Echinostoma ilocanum (Garrison, 1908), Hypoderaeum conoideum (Bloch, 1872) Dietz, 1909, and Artyfechinostomum malayanum (Leiper, 1911) Mendheim, 1943 commonly infect humans in Thailand, but their eggs present similar morphologies resulting in difficult differentiation for diagnosis. Present molecular methods have a great potential to provide superior detection/diagnosis. DNA sequences, especially the mitochondrial NADH dehydrogenase subunit 1 (ND1) gene, have already been used to differentiate among echinostomes; thus, we aimed to develop species-specific primers for the differential detection of four medically important echinostomes by multiplex PCR. The species-specific reverse primers and a forward primer were based on variable regions and conserved regions of the ND1 gene, respectively. Four reverse primers and a forward primer were combined in a multiplex PCR reaction to amplify the ND1 fragment. Different ND1 fragment sizes were amplified: 108, 209, 384 and 419 bp of E. revolutum H. conoideum, E. ilocanum and A. malayanum, respectively. Specificity was tested with other medically important parasite DNA; no cross-reaction occurred. Sensitivity ranged between 0.1 and 0.05 ng. The species-specific primers developed in this study could be of further use in differential diagnosis for these medically important echinostomes infection in human and animal hosts.
1. Introduction Echinostomiasis is a foodborne, intestinal, zoonotic, snail-mediated parasitosis caused by distomate digenean trematodes belonging to the family Echinostomatidae. Human echinostomiasis is attributed to at least 20 species belonging to ten genera, Southeast Asia having the highest worldwide incidence (Toledo and Esteban, 2016; Chai, 2019). In Thailand, at least four echinostomes, namely Echinostoma revolutum (Froelich, 1802), Echinostoma ilocanum (Garrison, 1908), Hypoderaeum conoideum (Bloch, 1872) Dietz, 1909 and Artyfechinostomum malayanum (Leiper, 1911) Mendheim, 1943 (syn. Echinostoma malayanum) are causative agents of human echinostomiasis (Toledo and Esteban, 2016; Chai, 2019). A wide range of aquatic animals, e.g. snails, bivalves, crustaceans, fish, and amphibians, serve as the second intermediate hosts. Thus, eating these raw or partially cooked aquatic animals has been identified as the primary mode of transmission (Chai, 2009; Toledo and Esteban, 2016). However, the echinostomiasis risk continues to grow due to factors such as growing international markets, improved transportation systems, demographic changes, and the importation of new eating habits in developed countries (Toledo and
⁎
Esteban, 2016). Co-endemic and mixed infection of the medically important echinostomes in their hosts, e.g. co-infection of E. revolutum and H. conoideum in free-grazing ducks in Thailand has been reported (Saijuntha et al., 2013). It is difficult to morphologically differentiate among the eggs or immature stages of these echinostomes. At present, the standard diagnostic method for human or animals echinostomiasis in Thailand is based on microscopic examination to detect eggs in feces. Echinostome egg morphology is very similar to other trematode eggs, especially fasiolids flukes, which are co-endemic with these echinostomes in Thailand; this, again, makes differentiation difficult (Tantrawatpan et al., 2016). Even though a specific diagnosis can be made through careful observations and measurements of the eggs, the recovery and identification of the adult fluke is strongly required for definitive diagnosis (Toledo et al., 2019). The taxonomic characteristics used to distinguish between genera and species of the echinostomes include the circumoral disk structure, amount of collar-spines themselves along with the number of their rows and arrangements, as well as testicular characteristics (Radomyos et al., 2004; Chai, 2019). Moreover, many adult stages appear morphologically very similar in a wide
Corresponding author. E-mail address: [email protected] (W. Saijuntha).
https://doi.org/10.1016/j.actatropica.2019.105304 Received 27 October 2019; Received in revised form 13 December 2019; Accepted 15 December 2019 Available online 16 December 2019 0001-706X/ © 2019 Elsevier B.V. All rights reserved.
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
and Table 1). Primers were made to yield different sizes of amplification products, namely 108, 209, 384, and 419 bp for E. revolutum, H. conoideum, E. ilocanum, and A. malayanum, respectively (Table 1).
variety of species, due to a long history of inadequate descriptions, poor specific diagnoses and extensive synonymy (Kostadinova et al., 2003). As a consequence, genetic markers including nuclear DNA and mitochondrial DNA (mtDNA), and newer techniques such as random amplify polymorphic DNA (RAPD) and allozymes, are now used to differentiate among echinostome species (Kostadinova et al., 2003; Saijuntha et al., 2010a, 2010b, 2011; Buddhachat and Chontananarth, 2019). Based on nucleotide sequence variations, several molecular detection and differentiation techniques for echinostomes have been developed, such as species-specific detection of E. revolutum based on cytochrome b sequences (Anucherngchai et al., 2019) and the discrimination of A. malayanum from Paragonimus heterotremus and Fasciola gigantica eggs by singleplex real-time PCR (Tantrawatpan et al., 2016). Multiplex PCR has been proven to be a potentially useful method for differential diagnosis as well as for multiple agent species discrimination causing similar or identical clinical syndromes and/or sharing similar epidemiological features (Markoulatos et al., 2002). Multiplex PCR can also differentiate between sibling/closely related species of parasitic helminths, such as Opisthorchis viverrini and Clonorchis sinensis (Le et al., 2006), O. viverrini and Haplorchis taichui (Wongsawad and Wongsawad, 2012), Calicophoron daubneyi and Fasciola hepatica (Martínez-Ibeas et al., 2013), Schistosoma haematobium and S. bovis (Webster et al., 2010). The mitochondrial NADH dehydrogenase subunit 1 (ND1) gene has been proven to be an appropriate marker to explore the genetic diversity of and differentiate medically important echinostomes in Thailand (Nagataki et al., 2015). Thus, our study aims to develop a multiplex PCR reaction using species-specific primers based on the ND1 gene variable nucleotide for differential detection of four medically important echinostomes, E. revolutum, E. ilocanum, H. conoideum and A. malayanum in Thailand.
DNA concentration of each species was measured by using DU®730 UV–Vis Spectrophotometer (Beckman-Coulter, USA) before serial dilution to 5, 1, 0.5, 0.1, and 0.05 ng/µl. Then one µl of each species DNA was tested by multiplex PCR reaction for sensitivity. The specificity of all specific primers was tested with human parasite DNA available in our laboratory, namely O. viverrini, H. taichui, P. heterotremus, F. gigantica, F. hepatica, Strongyloides stercolaris, hookworm, Taenia saginata, Taenia solium, Hymenolepis diminuta, Enterobius vermicularis, and Ascaris lumbricoides.
2. Materials and methods
3. Results
2.1. Samples collection and identification
We successfully designed four species-specific reversed primers (Table 1) to amplify the different ND1 fragment sizes of E. revolutum, H. conoideum, E. ilocanum, and A. malayanum by multiplex PCR reaction as expected, using 108, 209, 384, and 419 bp fragment sizes, respectively (Fig. 2). Multiplex PCR was adjusted to ensure appropriate amplification of each target, based on the Tm of all reverse primers, ranging between 48.9–53.8 °C; forward primer Tm was 55.7 °C (Table 1). The most appropriate and optimal annealing temperature for the multiplex PCR conditions was 59 °C. The combined DNA of four species at first, then three species, followed by two species, as well as only one species were all able to be amplified by multiplex PCR reaction (Fig. 2). No cross-hybridization of primers occurred, nor were any cross-reactions between a particular species-specific primer and other DNA templates observed. As the fragment size difference between E. ilocanum and A. malayanum was only 35 bp, the agarose gel concentration had to be at least 1.2% w/v to separate these PCR products clearly (Fig. 2). We tested the multiplex PCR reaction with other medically important parasitic DNA, and there was no cross-reaction observed with any parasitic DNA tested in our study (data not shown). The detection limit, using serial dilutions of DNA concentrations, revealed the lowest DNA concentration that could be used as a template with amplification by multiplex PCR reactions of E. revolutum, E. ilocanum, and A. malayanum was 0.1 ng, whereas for H. conoideum it was 0.05 ng (Fig. 3).
2.3. Multiplex PCR reaction Multiplex PCR assays were performed using reaction volumes of 25 µl containing 10 ng of genomic DNA, deionized water, 1X Ex Taq buffer, 2.0 mM MgCl2, 0.2 mM dNTPs, 1.2 µM of forward primer (EchinoND1-F), 0.6 µM of each reverse primer (ErevND1-R, EiloND1-R, AmalND1-R and HconND1-R), and 1 U Ex Taq polymerase (TaKaRa, Japan). The negative control for all experiments was the multiplex PCR reaction with no genomic DNA. The PCR (conduced in the PTC-200 thermal cycler: Watertown, Massachusetts, USA) comprised initial denaturation at 95 °C for 5 min, followed by 35 cycles with 30 s denaturation at 95 °C, 30 s for primer annealing, which varied between 50 60 °C, and 30 s for primer extension at 72 °C, with a final extension step at 72 °C for 8 min. After this, the PCR products were run and separated by 1.2% agarose gel electrophoresis. 2.4. Sensitivity and specificity test
The adult worms of H. conoideum and E. revolutum were collected from the intestines of domestic ducks in abattoirs at Khon Kaen Province, Thailand. The adult worms of A. malayanum and E. ilocanum were collected from dead rice field rats (Mus sp.) trapped and provided by farmers in the Mueang District, Khon Kaen Province and Sahatsakhan District, Kalasin Province, respectively. The recovered adult worms were identified under a light microscope based on the number of collar-spines, the shape of the collar head and testicles (Radomyos et al., 2004), and by using the morphological key to the Echinostomatidae genera (Kostadinova, 2005). After that, adult worms were intensively washed in NSS several times before being preserved in 80% alcohol and kept at −20 °C for further DNA extraction. The biosafety ethics for this research was approved by the Institute Biosafety Committee (157/2561) of Thammasat University. 2.2. DNA extraction and primer design After morphology identification, DNA extraction of each individual worm took place, following the E.Z.N.A.® Tissue DNA kit (Omega Biotek, USA) with manufacturer's instructions. All DNA samples were stored at −20 °C until use. The ND1 sequences of all species were retrieved from GenBank, namely sequence accession numbers AF026286 and AF026287 of E. revolutum, AJ564381 and AY168949 of H. conoideum, MN549982 and MN549983 of E. ilocanum, JF412732 and JF412733 of A. malayanum. All sequences were multiply aligned using the BioEdit program (Hall, 1999). Four variable regions were selected to design our species-specific reverse primers, namely ErevND1-R, HconND1-R, EiloND1-R and AmalND1-R for E. revolutum, H. conoideum, E. ilocanum, and A. malayanum, respectively. Our forward primer, EchinoND1-F, was created at the conserved regions of all species (Fig. 1
4. Discussion To the best of our knowledge, this work would be the first to combine four species-specific reverse primers with a forward primer, targeting this ND1 gene of these medically important echinostomes, for use in a PCR reaction. Using the amplicons’ inherent different sizes, E. revolutum, E. ilocanum, H. conoideum, and A. malayanum can be easily differentiated with 1.2% w/v agarose gel electrophoresis. While there 2
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
Fig. 1. Nucleotide positions used for primers design. Table 1 List of primer sequences. Echinostome species
Primer name
Sequence (5′-3′)
Size (bp)
Tm (°C)
Product size (bp)
All species E. revolutum H. conoideum E. ilocanum A. malayanum
EchinoND1-F ErevND1-R HconND1-R EiloND1-R AmalND1-R
GTAAGGGGCCTAATAAGGTGGG ACCAACTACGTTTCTGAAAGAAA CAGCATTAAATTTCTGCAACTCG CAACATAAGTCCTCAAAATAACA CTGACAAACCACGAATCAACC
22 23 23 23 21
55.7 52.4 53.2 48.9 53.8
– 108 209 384 419
are several other medically important trematodes of the family Echinostomatidae endemic in Southeast Asia, they were not able to be included in our study: Echinostoma cinetorchis, Echinostoma echinatum, Echinoparyphium recurvatum, Echinochasmus japonicus and Episthmium caninum (Toledo et al., 2019). These species should be considered for further molecular differential diagnosis in human cases as they are problematic in Southeast Asia. Multiplex PCR technique is epidemiologically useful for both human and intermediate hosts, throughout endemic areas, for specifying the species of these medically important echinostomes. A specific PCR and high-resolution melting analysis was previously developed to detect metacercariae of E. revolutum isolated from the snail hosts endemic in northern Thailand (Anucherngchai et al., 2019; Buddhachat and Chontananarth, 2019), but it was unable to detect other echinostomes. The advantage of our multiplex PCR is that it is using mtDNA targets versus nuclear DNA as mitochondrial genomes are present in hundreds or thousands of copies per cell (McManus et al., 2004). Therefore, the limit of detection is much lower. With to its high polymorphism, the mitochondrial ND1 gene is an ideal potential genetic marker to differentiate echinostomes
Fig. 2. Multiplex PCR performance using combined and separated DNA of the four echinostomes.Lane M, 100 bp marker; lane 1, mixed four species; lane 2 to 5, mixed three species; lane 6 to 11, mixed two species; lane 12 to 15, one species.
3
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
Fig. 3. Multiplex PCR reaction sensitivity with a serial dilution of each echinostome DNA. In all figures: lane M, 100 bp marker; lane A, 5 ng/µl; lane B, 1 ng/µl; lane C, 0.5 ng/µl; lane D, 0.1 ng/µl; lane E, 0.05 ng/µl.
References
(Morgan and Blair, 1998; Kostadinova and Gibson, 2000; Nagataki et al., 2015). It has been used for differential diagnosis of other complex echinostomes groups, such as for the 37 collar-spined complex group which contains at least 11 morpho-species; this latter group's taxonomic and systematic status remains rather controversial (Kostadinova and Gibson, 2000; Faltynkova et al., 2015). For example, with E. revolutum and E. miyagawai co-infections in free-grazing ducks, the morphologies appear very similar and cannot be differentiated. But with the use of the ND1 sequence, these sibling species can be distinguished (Nagataki et al., 2015). Thus, based on ND1 sequence differences, species-specific primers may be designed in combination for a multiplex PCR reaction to differentiate these sibling species. As our multiplex PCR technique demonstrated no cross-reaction between four human echinostomes or with other medically important parasite DNA, it is likely that this PCR technique can also accurately identify echinostome-like eggs in feces such as Paragonimus, Fasciola and Fasciolopsis. The results also suggest our multiplex PCR reaction/ condition is a sensitive, specific and suitable method for differential detection of these four human echinostomes, namely E. revolutum, E. ilocanum, H. conoideum, and A. malayanum infections, and, thus, should be of particular value for epidemiological study where and when coendemics occur. However, combinations with more species-specific primers for differential detection of other human echinostomes which co-occur in Southeast Asia, need to be developed; Southeast Asia currently has the highest incidence of echinostomiasis (Toledo and Esteban, 2016; Chai, 2019). Finally, our multiplex PCR reaction/condition needs to be further validated with infected human/animals feces, metacercariae, cercariae or other developing stages isolated from their intermediate hosts.
Anucherngchai, S., Chontananarth, T., Tejangkura, T., Chai, J.Y., 2019. The study of Cytochrome B (CYTB): species-specific detection and phylogenetic relationship of Echinostoma revolutum, (Froelich, 1802). J. Parasit. Dis. 43, 66–74. Buddhachat, K., Chontananarth, T., 2019. Is species identification of Echinostome revolutum using mitochondrial DNA barcoding feasible with high-resolution melting analysis? Parasitol. Res. 118, 1799–1810. Chai, J.Y., 2009. Echinostomes in humans. In: Fried, B., Toledo, R. (Eds.), The Biology of Echinostomes: from the Molecule to the Community. Springer, New York, pp. 147–183. Chai, J.Y., 2019. Echinostomes. In: Chai, J.Y. (Ed.), Human Intestinal Flukes From discovery to Treatment and Control. Springer Nature B.V., Netherland, pp. 169–344. Faltynkova, A., Georgieva, S., Soldanova, M., Kostadinova, A., 2015. A re-assessment of species diversity within the ‘revolutum’ group of Echinostoma Rudolphi, 1809 (Digenea: Echinostomatidae) in Europe. Syst. Parasitol. 90, 1–25. Hall, T., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98. Kostadinova, A., Gibson, D.I., 2000. The systematics of the echinostomes. In: Fried, B., Graczyk, T.K. (Eds.), Echinostomes As Experimental Models For Biological Research. Springer, Dordrecht, pp. 31–57. Kostadinova, A., Herniou, E.A., Barrett, J., Littlewood, D.T., 2003. Phylogenetic relationships of Echinostoma Rudolphi, 1809 (Digenea: Echinostomatidae) and related genera re-assessed via DNA and morphological analyses. Syst. Parasitol. 54, 159–176. Kostadinova, A., 2005. Family Echinostomatidae. In: Jones, A., Bray, R.A., Gibson, D.I. (Eds.), Keys to the Trematoda, Vol. 2. CAB International, Wallingford & The Natural History Museum, London, UK, pp. 9–64. Le, T.H., Van De, N., Blair, D., Sithithaworn, P., McManus, D.P., 2006. Clonorchis sinensis and Opisthorchis viverrini: development of a mitochondrial-based multiplex PCR for their identification and discrimination. Exp. Parasitol. 112, 109–114. Markoulatos, P., Siafakas, N., Moncany, M., 2002. Multiplex polymerase chain reaction: a practical approach. J. Clin. Lab. Anal. 16, 47–51. Martínez-Ibeas, A.M., González-Warleta, M., Martínez-Valladares, M., Castro-Hermida, J.A., González-Lanza, C., Miñambres, B., Ferreras, C., Mezo, M., Manga-González, M.Y., 2013. Development and validation of a mtDNA multiplex PCR for identification and discrimination of Calicophoron daubneyi and Fasciola hepatica in the Galba truncatula snail. Vet. Parasitol. 195, 57–64. McManus, D.P., Le, T.H., Blair, D., 2004. Genomics of parasitic flatworms. Int. J. Parasitol. 34, 153–158. Morgan, J.A., Blair, D., 1998. Mitochondrial ND1 gene sequences used to identify echinostome isolates from Australia and New Zealand. Int. J. Parasitol. 28, 493–502. Nagataki, M., Tantrawatpan, C., Agatsuma, T., Sugiura, T., Duenngai, K., Sithithaworn, P., Andrews, R.H., Petney, T.N., Saijuntha, W., 2015. Mitochondrial DNA sequences of 37 collar-spined echinostomes (Digenea: Echinostomatidae) in Thailand and Lao PDR reveals presence of two species: echinostoma revolutum and E. miyagawai. Infect. Genet. Evol. 35, 56–62. Radomyos, P., Tangtrongchitr, A., Krudsood, S., Wilairatana, P., Looareesuwan, S., 2004. Atlas of Medical Parasitology [in Thai], 7th ed. Parbpim press, Bangkok. Saijuntha, W., Sithithaworn, P., Andrews, R.H., 2010a. Genetic differentiation of Echinostoma revolutum and Hypodereaum conoideum from domestic ducks in Thailand by multilocus enzyme electrophoresis. J. Helminthol 84, 143–148. Saijuntha, W., Tapdara, S., Tantrawatpan, C., 2010b. Multilocus enzyme electrophoresis analysis of Echinostoma revolutum and Echinostoma malayanum (Trematoda: Echinostomatidae) isolated from Khon Kaen Province. Thailand. Asian Pac. J. Trop. Med. 3, 633–636. Saijuntha, W., Sithithaworn, P., Duenngai, K., Kiatsopit, N., Andrews, R.H., Petney, T.N., 2011. Genetic variation and relationships of four species of medically important echinostomes (Trematoda: Echinostomatidae) in South-East Asia. Infect. Genet. Evol. 11, 375–381. Saijuntha, W., Duenngai, K., Tantrawatpan, C., 2013. Zoonotic echinostome infections in free-grazing ducks in Thailand. Korean J. Parasitol. 51, 663–667. Tantrawatpan, C., Saijuntha, W., Manochanrt, S., Kheolamai, P., Thanchomnang, T., Sadaow, L., Intapan, P.M., Maleewong, W., 2016. A singleplex real-time fluorescence resonance energy transfer PCR with melting curve analysis for the differential
CRediT authorship contribution statement Chairat Tantrawatpan: Conceptualization, Methodology, Writing original draft, Writing - review & editing. Weerachai Saijuntha: Conceptualization, Methodology, Writing - original draft, Writing - review & editing.
Declaration of Competing Interest None.
Acknowledgements This research was financially supported by joint funding of Thailand Research Fund, Commission on Higher Education, and Mahasarakham University (TRF-CHE-MSU), grant no. MRG5480009 to Weerachai Saijuntha. 4
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
Webster, B.L., Rollinson, D., Stothard, J.R., Huyse, T., 2010. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma heamatobium and S. bovis. J. Helminthol. 84, 107–114. Wongsawad, C., Wongsawad, P., 2012. Opisthorchis viverrini and Haplorchis taichui: development of a multiplex PCR assay for their detection and differentiation using specific primers derived from HAT-RAPD. Exp. Parasitol. 132, 237–242.
detection of Paragonimus heterotremus, Echinostoma malayanum and Fasciola gigantica eggs in faeces. Trans. R. Soc. Trop. Med. Hyg. 110, 74–83. Toledo, R., Esteban, J.G., 2016. An update on human echinostomiasis. Trans. R. Soc. Trop. Med. Hyg. 110, 37–45. Toledo, R., Muñoz-Antoli, C., Esteban, J.G., 2019. Intestinal trematode infections. Adv. Exp. Med. Biol. 1154, 181–213.
5
Contents lists available at ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Multiplex PCR development for the differential detection of four medically important echinostomes (Trematoda: Echinostomatidae) in Thailand Chairat Tantrawatpana, Weerachai Saijunthab, a b
T
⁎
Division of Cell Biology, Department of Preclinical Sciences, Faculty of Medicine, Thammasat University, Rangsit Campus, Pathumthani 12120, Thailand Walai Rukhavej Botanical Research Institute, Mahasarakham University, Maha Sarakham 44150, Thailand
A R T I C LE I N FO
A B S T R A C T
Keywords: Echinostomiasis NADH dehydrogenase subunit 1 Molecular differentiation Specific primer
Four species of echinostomes, Echinostoma revolutum (Froelich, 1802), Echinostoma ilocanum (Garrison, 1908), Hypoderaeum conoideum (Bloch, 1872) Dietz, 1909, and Artyfechinostomum malayanum (Leiper, 1911) Mendheim, 1943 commonly infect humans in Thailand, but their eggs present similar morphologies resulting in difficult differentiation for diagnosis. Present molecular methods have a great potential to provide superior detection/diagnosis. DNA sequences, especially the mitochondrial NADH dehydrogenase subunit 1 (ND1) gene, have already been used to differentiate among echinostomes; thus, we aimed to develop species-specific primers for the differential detection of four medically important echinostomes by multiplex PCR. The species-specific reverse primers and a forward primer were based on variable regions and conserved regions of the ND1 gene, respectively. Four reverse primers and a forward primer were combined in a multiplex PCR reaction to amplify the ND1 fragment. Different ND1 fragment sizes were amplified: 108, 209, 384 and 419 bp of E. revolutum H. conoideum, E. ilocanum and A. malayanum, respectively. Specificity was tested with other medically important parasite DNA; no cross-reaction occurred. Sensitivity ranged between 0.1 and 0.05 ng. The species-specific primers developed in this study could be of further use in differential diagnosis for these medically important echinostomes infection in human and animal hosts.
1. Introduction Echinostomiasis is a foodborne, intestinal, zoonotic, snail-mediated parasitosis caused by distomate digenean trematodes belonging to the family Echinostomatidae. Human echinostomiasis is attributed to at least 20 species belonging to ten genera, Southeast Asia having the highest worldwide incidence (Toledo and Esteban, 2016; Chai, 2019). In Thailand, at least four echinostomes, namely Echinostoma revolutum (Froelich, 1802), Echinostoma ilocanum (Garrison, 1908), Hypoderaeum conoideum (Bloch, 1872) Dietz, 1909 and Artyfechinostomum malayanum (Leiper, 1911) Mendheim, 1943 (syn. Echinostoma malayanum) are causative agents of human echinostomiasis (Toledo and Esteban, 2016; Chai, 2019). A wide range of aquatic animals, e.g. snails, bivalves, crustaceans, fish, and amphibians, serve as the second intermediate hosts. Thus, eating these raw or partially cooked aquatic animals has been identified as the primary mode of transmission (Chai, 2009; Toledo and Esteban, 2016). However, the echinostomiasis risk continues to grow due to factors such as growing international markets, improved transportation systems, demographic changes, and the importation of new eating habits in developed countries (Toledo and
⁎
Esteban, 2016). Co-endemic and mixed infection of the medically important echinostomes in their hosts, e.g. co-infection of E. revolutum and H. conoideum in free-grazing ducks in Thailand has been reported (Saijuntha et al., 2013). It is difficult to morphologically differentiate among the eggs or immature stages of these echinostomes. At present, the standard diagnostic method for human or animals echinostomiasis in Thailand is based on microscopic examination to detect eggs in feces. Echinostome egg morphology is very similar to other trematode eggs, especially fasiolids flukes, which are co-endemic with these echinostomes in Thailand; this, again, makes differentiation difficult (Tantrawatpan et al., 2016). Even though a specific diagnosis can be made through careful observations and measurements of the eggs, the recovery and identification of the adult fluke is strongly required for definitive diagnosis (Toledo et al., 2019). The taxonomic characteristics used to distinguish between genera and species of the echinostomes include the circumoral disk structure, amount of collar-spines themselves along with the number of their rows and arrangements, as well as testicular characteristics (Radomyos et al., 2004; Chai, 2019). Moreover, many adult stages appear morphologically very similar in a wide
Corresponding author. E-mail address: [email protected] (W. Saijuntha).
https://doi.org/10.1016/j.actatropica.2019.105304 Received 27 October 2019; Received in revised form 13 December 2019; Accepted 15 December 2019 Available online 16 December 2019 0001-706X/ © 2019 Elsevier B.V. All rights reserved.
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
and Table 1). Primers were made to yield different sizes of amplification products, namely 108, 209, 384, and 419 bp for E. revolutum, H. conoideum, E. ilocanum, and A. malayanum, respectively (Table 1).
variety of species, due to a long history of inadequate descriptions, poor specific diagnoses and extensive synonymy (Kostadinova et al., 2003). As a consequence, genetic markers including nuclear DNA and mitochondrial DNA (mtDNA), and newer techniques such as random amplify polymorphic DNA (RAPD) and allozymes, are now used to differentiate among echinostome species (Kostadinova et al., 2003; Saijuntha et al., 2010a, 2010b, 2011; Buddhachat and Chontananarth, 2019). Based on nucleotide sequence variations, several molecular detection and differentiation techniques for echinostomes have been developed, such as species-specific detection of E. revolutum based on cytochrome b sequences (Anucherngchai et al., 2019) and the discrimination of A. malayanum from Paragonimus heterotremus and Fasciola gigantica eggs by singleplex real-time PCR (Tantrawatpan et al., 2016). Multiplex PCR has been proven to be a potentially useful method for differential diagnosis as well as for multiple agent species discrimination causing similar or identical clinical syndromes and/or sharing similar epidemiological features (Markoulatos et al., 2002). Multiplex PCR can also differentiate between sibling/closely related species of parasitic helminths, such as Opisthorchis viverrini and Clonorchis sinensis (Le et al., 2006), O. viverrini and Haplorchis taichui (Wongsawad and Wongsawad, 2012), Calicophoron daubneyi and Fasciola hepatica (Martínez-Ibeas et al., 2013), Schistosoma haematobium and S. bovis (Webster et al., 2010). The mitochondrial NADH dehydrogenase subunit 1 (ND1) gene has been proven to be an appropriate marker to explore the genetic diversity of and differentiate medically important echinostomes in Thailand (Nagataki et al., 2015). Thus, our study aims to develop a multiplex PCR reaction using species-specific primers based on the ND1 gene variable nucleotide for differential detection of four medically important echinostomes, E. revolutum, E. ilocanum, H. conoideum and A. malayanum in Thailand.
DNA concentration of each species was measured by using DU®730 UV–Vis Spectrophotometer (Beckman-Coulter, USA) before serial dilution to 5, 1, 0.5, 0.1, and 0.05 ng/µl. Then one µl of each species DNA was tested by multiplex PCR reaction for sensitivity. The specificity of all specific primers was tested with human parasite DNA available in our laboratory, namely O. viverrini, H. taichui, P. heterotremus, F. gigantica, F. hepatica, Strongyloides stercolaris, hookworm, Taenia saginata, Taenia solium, Hymenolepis diminuta, Enterobius vermicularis, and Ascaris lumbricoides.
2. Materials and methods
3. Results
2.1. Samples collection and identification
We successfully designed four species-specific reversed primers (Table 1) to amplify the different ND1 fragment sizes of E. revolutum, H. conoideum, E. ilocanum, and A. malayanum by multiplex PCR reaction as expected, using 108, 209, 384, and 419 bp fragment sizes, respectively (Fig. 2). Multiplex PCR was adjusted to ensure appropriate amplification of each target, based on the Tm of all reverse primers, ranging between 48.9–53.8 °C; forward primer Tm was 55.7 °C (Table 1). The most appropriate and optimal annealing temperature for the multiplex PCR conditions was 59 °C. The combined DNA of four species at first, then three species, followed by two species, as well as only one species were all able to be amplified by multiplex PCR reaction (Fig. 2). No cross-hybridization of primers occurred, nor were any cross-reactions between a particular species-specific primer and other DNA templates observed. As the fragment size difference between E. ilocanum and A. malayanum was only 35 bp, the agarose gel concentration had to be at least 1.2% w/v to separate these PCR products clearly (Fig. 2). We tested the multiplex PCR reaction with other medically important parasitic DNA, and there was no cross-reaction observed with any parasitic DNA tested in our study (data not shown). The detection limit, using serial dilutions of DNA concentrations, revealed the lowest DNA concentration that could be used as a template with amplification by multiplex PCR reactions of E. revolutum, E. ilocanum, and A. malayanum was 0.1 ng, whereas for H. conoideum it was 0.05 ng (Fig. 3).
2.3. Multiplex PCR reaction Multiplex PCR assays were performed using reaction volumes of 25 µl containing 10 ng of genomic DNA, deionized water, 1X Ex Taq buffer, 2.0 mM MgCl2, 0.2 mM dNTPs, 1.2 µM of forward primer (EchinoND1-F), 0.6 µM of each reverse primer (ErevND1-R, EiloND1-R, AmalND1-R and HconND1-R), and 1 U Ex Taq polymerase (TaKaRa, Japan). The negative control for all experiments was the multiplex PCR reaction with no genomic DNA. The PCR (conduced in the PTC-200 thermal cycler: Watertown, Massachusetts, USA) comprised initial denaturation at 95 °C for 5 min, followed by 35 cycles with 30 s denaturation at 95 °C, 30 s for primer annealing, which varied between 50 60 °C, and 30 s for primer extension at 72 °C, with a final extension step at 72 °C for 8 min. After this, the PCR products were run and separated by 1.2% agarose gel electrophoresis. 2.4. Sensitivity and specificity test
The adult worms of H. conoideum and E. revolutum were collected from the intestines of domestic ducks in abattoirs at Khon Kaen Province, Thailand. The adult worms of A. malayanum and E. ilocanum were collected from dead rice field rats (Mus sp.) trapped and provided by farmers in the Mueang District, Khon Kaen Province and Sahatsakhan District, Kalasin Province, respectively. The recovered adult worms were identified under a light microscope based on the number of collar-spines, the shape of the collar head and testicles (Radomyos et al., 2004), and by using the morphological key to the Echinostomatidae genera (Kostadinova, 2005). After that, adult worms were intensively washed in NSS several times before being preserved in 80% alcohol and kept at −20 °C for further DNA extraction. The biosafety ethics for this research was approved by the Institute Biosafety Committee (157/2561) of Thammasat University. 2.2. DNA extraction and primer design After morphology identification, DNA extraction of each individual worm took place, following the E.Z.N.A.® Tissue DNA kit (Omega Biotek, USA) with manufacturer's instructions. All DNA samples were stored at −20 °C until use. The ND1 sequences of all species were retrieved from GenBank, namely sequence accession numbers AF026286 and AF026287 of E. revolutum, AJ564381 and AY168949 of H. conoideum, MN549982 and MN549983 of E. ilocanum, JF412732 and JF412733 of A. malayanum. All sequences were multiply aligned using the BioEdit program (Hall, 1999). Four variable regions were selected to design our species-specific reverse primers, namely ErevND1-R, HconND1-R, EiloND1-R and AmalND1-R for E. revolutum, H. conoideum, E. ilocanum, and A. malayanum, respectively. Our forward primer, EchinoND1-F, was created at the conserved regions of all species (Fig. 1
4. Discussion To the best of our knowledge, this work would be the first to combine four species-specific reverse primers with a forward primer, targeting this ND1 gene of these medically important echinostomes, for use in a PCR reaction. Using the amplicons’ inherent different sizes, E. revolutum, E. ilocanum, H. conoideum, and A. malayanum can be easily differentiated with 1.2% w/v agarose gel electrophoresis. While there 2
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
Fig. 1. Nucleotide positions used for primers design. Table 1 List of primer sequences. Echinostome species
Primer name
Sequence (5′-3′)
Size (bp)
Tm (°C)
Product size (bp)
All species E. revolutum H. conoideum E. ilocanum A. malayanum
EchinoND1-F ErevND1-R HconND1-R EiloND1-R AmalND1-R
GTAAGGGGCCTAATAAGGTGGG ACCAACTACGTTTCTGAAAGAAA CAGCATTAAATTTCTGCAACTCG CAACATAAGTCCTCAAAATAACA CTGACAAACCACGAATCAACC
22 23 23 23 21
55.7 52.4 53.2 48.9 53.8
– 108 209 384 419
are several other medically important trematodes of the family Echinostomatidae endemic in Southeast Asia, they were not able to be included in our study: Echinostoma cinetorchis, Echinostoma echinatum, Echinoparyphium recurvatum, Echinochasmus japonicus and Episthmium caninum (Toledo et al., 2019). These species should be considered for further molecular differential diagnosis in human cases as they are problematic in Southeast Asia. Multiplex PCR technique is epidemiologically useful for both human and intermediate hosts, throughout endemic areas, for specifying the species of these medically important echinostomes. A specific PCR and high-resolution melting analysis was previously developed to detect metacercariae of E. revolutum isolated from the snail hosts endemic in northern Thailand (Anucherngchai et al., 2019; Buddhachat and Chontananarth, 2019), but it was unable to detect other echinostomes. The advantage of our multiplex PCR is that it is using mtDNA targets versus nuclear DNA as mitochondrial genomes are present in hundreds or thousands of copies per cell (McManus et al., 2004). Therefore, the limit of detection is much lower. With to its high polymorphism, the mitochondrial ND1 gene is an ideal potential genetic marker to differentiate echinostomes
Fig. 2. Multiplex PCR performance using combined and separated DNA of the four echinostomes.Lane M, 100 bp marker; lane 1, mixed four species; lane 2 to 5, mixed three species; lane 6 to 11, mixed two species; lane 12 to 15, one species.
3
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
Fig. 3. Multiplex PCR reaction sensitivity with a serial dilution of each echinostome DNA. In all figures: lane M, 100 bp marker; lane A, 5 ng/µl; lane B, 1 ng/µl; lane C, 0.5 ng/µl; lane D, 0.1 ng/µl; lane E, 0.05 ng/µl.
References
(Morgan and Blair, 1998; Kostadinova and Gibson, 2000; Nagataki et al., 2015). It has been used for differential diagnosis of other complex echinostomes groups, such as for the 37 collar-spined complex group which contains at least 11 morpho-species; this latter group's taxonomic and systematic status remains rather controversial (Kostadinova and Gibson, 2000; Faltynkova et al., 2015). For example, with E. revolutum and E. miyagawai co-infections in free-grazing ducks, the morphologies appear very similar and cannot be differentiated. But with the use of the ND1 sequence, these sibling species can be distinguished (Nagataki et al., 2015). Thus, based on ND1 sequence differences, species-specific primers may be designed in combination for a multiplex PCR reaction to differentiate these sibling species. As our multiplex PCR technique demonstrated no cross-reaction between four human echinostomes or with other medically important parasite DNA, it is likely that this PCR technique can also accurately identify echinostome-like eggs in feces such as Paragonimus, Fasciola and Fasciolopsis. The results also suggest our multiplex PCR reaction/ condition is a sensitive, specific and suitable method for differential detection of these four human echinostomes, namely E. revolutum, E. ilocanum, H. conoideum, and A. malayanum infections, and, thus, should be of particular value for epidemiological study where and when coendemics occur. However, combinations with more species-specific primers for differential detection of other human echinostomes which co-occur in Southeast Asia, need to be developed; Southeast Asia currently has the highest incidence of echinostomiasis (Toledo and Esteban, 2016; Chai, 2019). Finally, our multiplex PCR reaction/condition needs to be further validated with infected human/animals feces, metacercariae, cercariae or other developing stages isolated from their intermediate hosts.
Anucherngchai, S., Chontananarth, T., Tejangkura, T., Chai, J.Y., 2019. The study of Cytochrome B (CYTB): species-specific detection and phylogenetic relationship of Echinostoma revolutum, (Froelich, 1802). J. Parasit. Dis. 43, 66–74. Buddhachat, K., Chontananarth, T., 2019. Is species identification of Echinostome revolutum using mitochondrial DNA barcoding feasible with high-resolution melting analysis? Parasitol. Res. 118, 1799–1810. Chai, J.Y., 2009. Echinostomes in humans. In: Fried, B., Toledo, R. (Eds.), The Biology of Echinostomes: from the Molecule to the Community. Springer, New York, pp. 147–183. Chai, J.Y., 2019. Echinostomes. In: Chai, J.Y. (Ed.), Human Intestinal Flukes From discovery to Treatment and Control. Springer Nature B.V., Netherland, pp. 169–344. Faltynkova, A., Georgieva, S., Soldanova, M., Kostadinova, A., 2015. A re-assessment of species diversity within the ‘revolutum’ group of Echinostoma Rudolphi, 1809 (Digenea: Echinostomatidae) in Europe. Syst. Parasitol. 90, 1–25. Hall, T., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95–98. Kostadinova, A., Gibson, D.I., 2000. The systematics of the echinostomes. In: Fried, B., Graczyk, T.K. (Eds.), Echinostomes As Experimental Models For Biological Research. Springer, Dordrecht, pp. 31–57. Kostadinova, A., Herniou, E.A., Barrett, J., Littlewood, D.T., 2003. Phylogenetic relationships of Echinostoma Rudolphi, 1809 (Digenea: Echinostomatidae) and related genera re-assessed via DNA and morphological analyses. Syst. Parasitol. 54, 159–176. Kostadinova, A., 2005. Family Echinostomatidae. In: Jones, A., Bray, R.A., Gibson, D.I. (Eds.), Keys to the Trematoda, Vol. 2. CAB International, Wallingford & The Natural History Museum, London, UK, pp. 9–64. Le, T.H., Van De, N., Blair, D., Sithithaworn, P., McManus, D.P., 2006. Clonorchis sinensis and Opisthorchis viverrini: development of a mitochondrial-based multiplex PCR for their identification and discrimination. Exp. Parasitol. 112, 109–114. Markoulatos, P., Siafakas, N., Moncany, M., 2002. Multiplex polymerase chain reaction: a practical approach. J. Clin. Lab. Anal. 16, 47–51. Martínez-Ibeas, A.M., González-Warleta, M., Martínez-Valladares, M., Castro-Hermida, J.A., González-Lanza, C., Miñambres, B., Ferreras, C., Mezo, M., Manga-González, M.Y., 2013. Development and validation of a mtDNA multiplex PCR for identification and discrimination of Calicophoron daubneyi and Fasciola hepatica in the Galba truncatula snail. Vet. Parasitol. 195, 57–64. McManus, D.P., Le, T.H., Blair, D., 2004. Genomics of parasitic flatworms. Int. J. Parasitol. 34, 153–158. Morgan, J.A., Blair, D., 1998. Mitochondrial ND1 gene sequences used to identify echinostome isolates from Australia and New Zealand. Int. J. Parasitol. 28, 493–502. Nagataki, M., Tantrawatpan, C., Agatsuma, T., Sugiura, T., Duenngai, K., Sithithaworn, P., Andrews, R.H., Petney, T.N., Saijuntha, W., 2015. Mitochondrial DNA sequences of 37 collar-spined echinostomes (Digenea: Echinostomatidae) in Thailand and Lao PDR reveals presence of two species: echinostoma revolutum and E. miyagawai. Infect. Genet. Evol. 35, 56–62. Radomyos, P., Tangtrongchitr, A., Krudsood, S., Wilairatana, P., Looareesuwan, S., 2004. Atlas of Medical Parasitology [in Thai], 7th ed. Parbpim press, Bangkok. Saijuntha, W., Sithithaworn, P., Andrews, R.H., 2010a. Genetic differentiation of Echinostoma revolutum and Hypodereaum conoideum from domestic ducks in Thailand by multilocus enzyme electrophoresis. J. Helminthol 84, 143–148. Saijuntha, W., Tapdara, S., Tantrawatpan, C., 2010b. Multilocus enzyme electrophoresis analysis of Echinostoma revolutum and Echinostoma malayanum (Trematoda: Echinostomatidae) isolated from Khon Kaen Province. Thailand. Asian Pac. J. Trop. Med. 3, 633–636. Saijuntha, W., Sithithaworn, P., Duenngai, K., Kiatsopit, N., Andrews, R.H., Petney, T.N., 2011. Genetic variation and relationships of four species of medically important echinostomes (Trematoda: Echinostomatidae) in South-East Asia. Infect. Genet. Evol. 11, 375–381. Saijuntha, W., Duenngai, K., Tantrawatpan, C., 2013. Zoonotic echinostome infections in free-grazing ducks in Thailand. Korean J. Parasitol. 51, 663–667. Tantrawatpan, C., Saijuntha, W., Manochanrt, S., Kheolamai, P., Thanchomnang, T., Sadaow, L., Intapan, P.M., Maleewong, W., 2016. A singleplex real-time fluorescence resonance energy transfer PCR with melting curve analysis for the differential
CRediT authorship contribution statement Chairat Tantrawatpan: Conceptualization, Methodology, Writing original draft, Writing - review & editing. Weerachai Saijuntha: Conceptualization, Methodology, Writing - original draft, Writing - review & editing.
Declaration of Competing Interest None.
Acknowledgements This research was financially supported by joint funding of Thailand Research Fund, Commission on Higher Education, and Mahasarakham University (TRF-CHE-MSU), grant no. MRG5480009 to Weerachai Saijuntha. 4
Acta Tropica 204 (2020) 105304
C. Tantrawatpan and W. Saijuntha
Webster, B.L., Rollinson, D., Stothard, J.R., Huyse, T., 2010. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma heamatobium and S. bovis. J. Helminthol. 84, 107–114. Wongsawad, C., Wongsawad, P., 2012. Opisthorchis viverrini and Haplorchis taichui: development of a multiplex PCR assay for their detection and differentiation using specific primers derived from HAT-RAPD. Exp. Parasitol. 132, 237–242.
detection of Paragonimus heterotremus, Echinostoma malayanum and Fasciola gigantica eggs in faeces. Trans. R. Soc. Trop. Med. Hyg. 110, 74–83. Toledo, R., Esteban, J.G., 2016. An update on human echinostomiasis. Trans. R. Soc. Trop. Med. Hyg. 110, 37–45. Toledo, R., Muñoz-Antoli, C., Esteban, J.G., 2019. Intestinal trematode infections. Adv. Exp. Med. Biol. 1154, 181–213.
5