- Email: [email protected]
Multiplex PCR for rapid differentiation of three species in the “Clostridium clostridioforme group”
FEMS Microbiology Letters 244 (2005) 391–395 www.fems-microbiology.org
Multiplex PCR for rapid differentiation of three species in the ‘‘Clostridium clostridioforme group’’ Song Yuli a
a,*
, Liu Chengxu a, Finegold Sydney M.
b,c,d
Research Service, VA Medical Center West Los Angeles, 11301 Wilshire Blvd., Room E3-237, Bldg. 304, Los Angeles, CA 90073, USA b Infectious Diseases Section, VA Medical Center West Los Angeles, Los Angeles, USA c Department of Medicine, UCLA School of Medicine, Los Angeles, USA d Department of Microbiology, Immunology, and Molecular Genetics, UCLA School of Medicine, Los Angeles, USA Received 27 December 2004; received in revised form 2 February 2005; accepted 11 February 2005 First published online 21 February 2005 Edited by W. Wade
Abstract Clostridium clostridioforme is a relatively antimicrobial resistant, phenotypically heterogeneous anaerobe that has been involved in a variety of infections. 16S rDNA sequencing analysis revealed three principal species in what has been called Clostridium clostridioforme – Clostridium bolteae, C. clostridioforme, and Clostridium hathewayi. Based on the 16S rDNA sequence information we obtained, we developed a cost-effective, timesaving one-step multiplex PCR assay for rapid and accurate differentiation of these three species. The established multiplex PCR identification scheme was applied to the identification of 88 clinical isolates that had previously been identified phenotypically as C. clostridioforme. The identification obtained from multiplex PCR assays showed 100% agreement with 16S rDNA sequencing identification. This scheme will permit more accurate assessment of the role of these three Clostridium species in infection and of the degree of antimicrobial resistance in each of the species. Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Clostridium clostridioforme; Multiplex PCR
1. Introduction Clostridium clostridioforme is a relatively antimicrobial resistant anaerobe that has been involved in a variety of infections, including bacteremia. Allen et al. [1] reported C. clostridioforme as the second most frequently encountered species of Clostridium in clinical specimens at Indiana University Hospital Anaerobe Laboratory, from 1989 through 2001. Identification of C. clostridioforme can pose a problem for the routine
*
Corresponding author. Tel.: +1 310 478 3711x49151; fax: +1 310 268 4458. E-mail address: [email protected] (S. Yuli).
clinical laboratory because it typically stains gram-negative, and the spores are often difficult to observe [2,3]. The traditional methods for identifying Clostridium isolates include morphological examination, various biochemical tests including carbohydrate fermentation reactions, analysis of volatile and nonvolatile fatty acid production [4,5], and gas–liquid chromatography of bacterial cellular fatty acids [6]. These methods are labor-intensive, time-consuming, and sometimes result in inconclusive identification [2]. Commercial kits represent a considerable advance in identification methods in terms of speed and simplicity. However, databases accompanying the kits are often incomplete or inaccurate, especially with the recent rapid increase of newly described or reclassified species. In addition, interpreta-
0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2005.02.017
392
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
tion of test results sometimes involves substantial subjective judgment. It has been well noted that C. clostridioforme is phenotypically heterogeneous and shows considerable variability in antimicrobial susceptibility patterns [2,3], suggesting it might be more than a single species. A recent study of ours based on 16S rDNA sequencing revealed that there are three principal species in what has been called C. clostridioforme – Clostridium bolteae, C. clostridioforme, and Clostridium hathewayi, and that there are differences between the three species in terms of phenotypic characteristics, antimicrobial susceptibility and role in disease [7]. Thus, it is important for microbiology laboratories to distinguish between them and for clinicians to be aware of differences between them. Thus far it has been difficult to distinguish the three species because the identification schemes have been based on incorrect taxonomy. In the present study, based on the accurate identification we obtained by 16S rDNA sequencing, we developed a one-step multiplex PCR scheme for rapid and accurate identification of the three major species in the ‘‘C. clostridioforme group’’.
2. Materials and methods 2.1. Bacterial strains and culture conditions Altogether, 88 isolates including 46 C. hathewayi, 21 C. bolteae and 21 C. clostridioforme that were previously identified to species level by 16s rDNA sequencing were included in this study. The organisms were isolated from various clinical specimens as well as from stool specimens from four institutions. In addition, this study included one ATCC type strain each of C. clostridioforme, C. bolteae and C. hathewayi and 32 other ATCC, DSMZ or CCUG strains of phylogenetically related species, and morphologically similar species; some of the major clostridial pathogens were used to verify the specificity of the established multiplex PCR assay (Table 1). All strains were cultured anaerobically overnight on Brucella blood agar (Anaerobe Systems, Morgan Hill, CA) or CDC ANA blood agar (BBL Microbiology Systems, Franklin lakes, NJ) at 37 °C and were characterized phenotypically by conventional tests as described in the Wadsworth-KTL Anaerobic Bacteriology Manual [5] and genetically by 16S rDNA sequence analysis. 2.2. Development of species-specific primers 16S rDNA sequences of the type strains of C. clostridioforme, C. bolteae and C. hathewayi determined in our previous study [7], as well as the related sequences retrieved from GenBank, were analyzed by multialignment using CLUSTAL-W (http://genome.kribb.re.kr).
Table 1 Reference strains used in this study Species
Source
Clostridium spp. C. bolteae C. indolis C. sporogenes C. celerecresens C. clostridioforme C. coccoides C. difficile C. hathewayi C. innocuum C. oroticum C. perfringens C. ramosum C. septicum C. sphenoides C. symbiosum C. tertium C. xylanolyticum
ATCC BAA-613T ATCC 25771T ATCC 13732 DSMZ 5628T ATCC 25537T ATCC 29236T ATCC 9689T CCUG 43506T ATCC 14501T ATCC 13619T ATCC 13124T ATCC 25582T ATCC 12464T ATCC 19403T ATCC 14940T ATCC 14573T DSMZ 6555T
Fusobacterium spp. F. nucleatum subsp. nucleatum F. naviforme F. russii F. necrophorum subsp.
ATCC ATCC ATCC ATCC
Ruminococcus spp. R. gnavus R. productus
CCUG 43222T CCUG 10976T
Anaerococcus spp. A. lactolyticus A. octavius A. prevotii A. tetradius A. vaginalis
CCUG CCUG CCUG CCUG CCUG
31351T 38493 41932T 46590T 31349T
Peptoniphilus spp. P. asaccharolyticus P. harei P. indolicus P. ivorii P. lacrimalis
CCUG CCUG CCUG CCUG CCUG
9988T 38491T 17639T 38492T 31350T
Peptostreptococcus spp. P. anaerobius P. micros
CCUG 7835T CCUG 46357T
25586T 25832T 25533T 25286T
Based on the multialignment analysis data, three potential species-specific primer pairs, Clos-F1 and ClosR2 for C. clostridioforme, Cfe-1 and Cfe-2 for C. bolteae, and Cha-F1 and Cha-4R for C. hathewayi, were selected from the 16S rRNA gene (Table 2). The primer sequences were analyzed for secondary structure formation, G + C content, and primer–dimer formation with the NetPrimer analysis software (http://www. premierbiosoft.com/netprimer). The specificities of these primers were predicted by comparison to the aligned SSU_rRNAdatabase of the RDP using the CHECK_PROBE utility [8] and were further confirmed with DNAs from 32 reference strains (Table 1). These primers were designed with minimal differences in their
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
393
Table 2 Oligonucleotide primers used in this study Primer
Sequence (5 0 -3 0 )
Target
Product size (bp)
Cfe-1 Cfe-2
CCTCTTGACCGGCGTGT CCTAGAGTGCCCAGCTTTACCTG
C. bolteae
153
Clos-F1 Clos-R2
GCCGCATGGCAGTGTGT ACCGGCCCGTCAGGGGGAT
C. clostridioforme
800
Cha-F1 Cha-4R
GGAGCGTAGACGGTTTAG CGGTTAAAGTGTTTTCAGTG
C. hathewayi
444
annealing temperature within each primer set, and to yield amplification products that ranged between 150 and 800 bp and differed by at least 100 bp. We also synthesized another primer pair (8UA and 341B) that corresponds to a region of the 16S rRNA gene that is conserved in all eubacteria [9]. These primers, which amplify an approximately 330 bp fragment, were used in independent amplification (i.e., not as part of the multiplex protocol) to ensure that the lack of an amplification product from species other than our targeted species reflected the specificity of our protocol rather than the lack of suitable template DNA. 2.3. Identification of three Clostridium species by multiplex PCR assay The multiplex PCR assay was applied to identify a total of 88 clinical isolates. PCR amplification was carried out in a total volume of 50 ll containing 1.25 U of Taq polymerase (Promega, WI), 50 mM KCL, 10 mM Tris– HCl [pH9.0], 0.1% Triton, 2.5 mM MgCl2, 0.5 mM (each) primer, 0.2 mM dNTPs, and 3 ll of bacterial lysate as the DNA template. PCR was carried out for 35 cycles. Each cycle consisted of 95 °C for 20 s for denaturation, 58 °C for 1 min for annealing, 72 °C for 30 s for extension. A cycle of 72 °C for 5 min was added to the final extension. PCR products were analyzed by electrophoresis on a 2% agarose gel followed by ethidium bromide staining. 2.4. Sensitivity of multiplex PCR assay The sensitivity of the multiplex PCR assay was evaluated by titrating cultures of the type strains of the three Clostridium species. The strains were suspended in Tris– HCl (pH 7.5) and the density was adjusted to approximately 108 CFU ml1 using a 0.5 McFarland standard. Thereafter, serial 10-fold dilutions of cultures were made in Tris–HCl. Equal volumes (100 ll) of dilutions were plated onto Brucella blood agar plates, and were used for DNA preparation for subsequent multiplex PCR assay. Colonies were counted after 3 days incubation under anaerobic conditions. The DNA templates were obtained by heating cells at 95 °C for 10 min and by
extraction and purification by QIAamp DNA Mini kit (Qiagen Inc., Chatsworth, CA)]. The detection limit of the multiplex PCR assay was determined with known numbers of bacteria diluted in Tris–HCl (pH 7.5).
3. Results and discussion The data of our parallel clinical study based on 16S rDNA sequence analysis of ‘‘C. clostridioforme group’’ isolates showed that there are three distinct species in the so-called ‘‘C. clostridioforme group’’ – C. bolteae, C. clostridioforme, and C. hathewayi [7]. The sequence similarities between C. clostridioforme and C. bolteae, C. clostridioforme and C. hathewayi, and C. bolteae and C. hathewayi were 97.0%, 94.3% and 94.4%, respectively. In this study, based on the 16S rDNA sequence information we developed a more cost-effective, timesaving one-step multiplex PCR assay for rapid and accurate identification of the three principal species in the ‘‘C. clostridioforme group’’. Three pairs of speciesspecific primers were selected from the 16S rRNA genes for C. clostridioforme, C. bolteae and C. hathewayi. The species were identified to species level by producing a unique DNA fragment (C. bolteae, 153 bp; C. clostridioforme, 800 bp; C. hathewayi, 444 bp) as expected (Fig. 1). The sequence analysis showed that C. clostridioforme and C. bolteae shared high sequence similarity [10]; there is only one hypervariable region between these two species so that region was used for primer selection. All the forward and reverse primers are species-specific except for the reverse primer for C. bolteae, which shares the same sequences as those of C. clostridioforme. However, the specificity of these primers was verified by multiplex PCR amplification with DNA from 32 reference strains of phylogenetically related species, resulting in amplification only with the DNA from strains of the target species (data not shown). The quality of all the DNA samples that gave negative multiplex PCR results were checked by running PCR with the 16S rRNA gene universal primer pair (8UA and 341B). All DNA samples gave an expected band of about 300 bp, indicating that the lack of an amplification product from species other than our targeted
394
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
Fig. 1. Polyacrylamide gel electrophoresis of PCR products from multiplex PCR assay. Lanes M, molecular marker (X174 RF DNA/Hae III). Lane 1, C. bolteae ATCC BAA-613T with an amplicon of ca. 150 bp, lanes 2–4, C. bolteae clinical isolates; lane 5, C. hathewayi CCUG 43506T with an amplicon of ca. 440 bp, lanes 6–8, C. hathewayi clinical isolates; lane 9, C. clostridioforme ATCC 25537T with an amplicon of ca. 800 bp, lanes 10–12, C. clostridioforme clinical isolates.
organisms reflected the specificity of our protocol rather than the lack of suitable template DNA (data not shown). However, since the primers were designed on the basis of currently available 16S rRNA sequences, the specificity is not guaranteed for uncharacterized bacteria. Thus, the multiplex PCR developed in this study may not detect additional diversity among the target organisms; there may be additional species in this group that share the annealing sites of our primers. It is an advantage, then, that these primers were designed from the very variable regions of the 16S rRNA genes and that only the same species are more likely to have the same target sequences. This assay was used to identify a total of 88 isolates of the ‘‘C. clostridioforme group’’; the identification obtained from the multiplex PCR assay showed 100% agreement with 16S rDNA sequencing identification. The developed multiplex PCR assay detected between 50 and 500 CFU/PCR reaction of each species. Using purified DNA as the PCR template increased the sensitivity of our procedure to 5 cells (data not shown). Clostridium species are commonly encountered in a variety of polymicrobial infections involving the abdomen, including peritonitis, intra-abdominal abscess and septicemia. Accurate identification of Clostridium isolates helps in evaluating the clinical significance of a positive culture and is important for predicting effective antibiotic therapy. C. clostridioforme has been listed as the second most frequently isolated Clostridium species from clinical specimens by one group [1] and described as very heterogenous [3]. Observations from the above study showed the clinical importance of C. hathewayi, which had previously been described only from stool specimens [11], and perhaps even greater clinical significance for C. clostridioforme which was the organism found in highest frequency from bacteremia. Three recent studies also highlight the importance of C. hathewayi as a potential human pathogen [12–14]. There are also some differences in antimicrobial susceptibility between these three species. Therefore, it is important for
microbiology laboratories to distinguish between these species and for clinicians to be aware of differences between them. Sequence determination of the 16S rRNA gene represents a highly accurate and versatile method for identification of bacteria to the species level; however, cost is a critical issue in the use of 16S rDNA sequence analysis as a diagnostic tool. The multiplex PCR-based identification scheme developed in this study can be considered (in terms of reduction of labor time (<24 h), relatively low cost (6$5/strain), easy application, and reliable and repeatable PCR results) a powerful potential tool for routine clinical differentiation of these Clostridium species. In conclusion, we developed a one-step multiplex PCR assay for rapid and reliable identification of the three Clostridium species that are often misidentified as C. clostridioforme phenotypically. Further experiments will be necessary to determine the conditions needed to detect these species directly from clinical specimens.
Acknowledgements This work has been carried out, in part, with financial support from Veterans Administration Merit Review funds. Some of the strains of the ‘‘C. clostridioforme group’’ used in this study have been provided to us by Stephen D. Allen, Eija Ko¨no¨nen, and David W. Hecht.
References [1] Allen, S.D., Emery, C.L. and Lyerly, D.M. (2003) Clostridium In: Manual of Clinical Microbiology (Murray, P.R., Baron, E.J., Pfaller, M.A., Jorgensen, J.H. and Yolken, R.H., Eds.), 8th edn, pp. 835–856. American Society for Microbiology, Washington, DC. [2] Alexander, C.J., Citron, D.M., Brazier, J.S. and Goldstein, E.J. (1995) Identification and antimicrobial resistance patterns of
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
[3]
[4]
[5]
[6]
[7]
clinical isolates of Clostridium clostridioforme, Clostridium innocuum, and Clostridium ramosum compared with those of clinical isolates of Clostridium perfringens. J. Clin. Microbiol. 33, 3209– 3215. Cato, E.P., George, W.L. and Finegold, S.M. (1986) Genus Clostridium In: BergeyÕs Manual of Systematic Bacteriology Sneath (Sneath, P.H.A., Ed.), 8th edn, pp. 1141–1200. Williams and Wilkins, Baltimore. Holdeman, L.V., Cato, E.P. and Moore, W.E.C. (1977) Anaerobe Laboratory Manual, 4th edn. Virginia Polytechnic Institute and State University, Blacksburg, Virginia. Jousimies-Somer, H.R., Summanen, P., Citron, D.M., Baron, E.J., Wexler, H.M. and Finegold, S.M. (2002) Wadsworth Anaerobic Bacteriology Manual, 6th edn. Star Publishing Co., Belmont, California. Allen, S.D., Siders, J.A., Riddell, M.J., Fill, J.A. and Wegener, W.S. (1995) Cellular fatty acid analysis in the differentiation of Clostridium in the clinical microbiology laboratory. Clin. Infect. Dis. Suppl. 2, S198–S201. Finegold, S.M., Song, Y., Liu, C., Hecht, D.W., Summanen, P., Ko¨no¨nen, E., and Allen, S. D. (2005) Clostridium clostridioforme, a mixed breed with a big bite. Eur. J. Clin. Microbiol; Infect. Dis. (in press).
395
[8] Maidak, B.L., Cole, J.R., Lilburn Jr., T.G., Parker, C.T., Saxman, P.R., Farris, R.J., Garrity, G.M., Olsen, G.J., Schmidt, T.M. and Tiedje, J.M. (2001) The RDP-II (Ribosomal Database Project). Nucleic Acids Res. 29, 173–174. [9] Brosius, J., Palmer, M.L., Kennedy, P.J. and Noller, H.F. (1978) Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. Proc. Natl. Acad. Sci. USA 75, 4801–4805. [10] Song, Y., Liu, C., Molitoris, D.R., Tomzynski, T.J., Lawson, P.A., Collins, M.D. and Finegold, S.M. (2003) Clostridium bolteae sp.nov., isolated from human sources. Syst. Appl. Microbiol. 26, 84–89. [11] Steer, T., Collins, M.D., Gibson, G.R., Hippe, H. and Lawson, P.A. (2001) Clostridium hathewayi sp. nov., from human faeces. Syst. Appl. Microbiol. 24, 353–357. [12] Elsayed, S. (2004) Human infection caused by Clostridium hathewayi. Emerg. Infect. Dis. 10, 1950–1952. [13] Woo, P.C., Lau, S.K., Woo, G.K., Fung, A.M., Yiu, V.P. and Yuen, K.Y. (2004) Bacteremia due to Clostridium hathewayi in a patient with acute appendicitis. J. Clin. Microbiol. 42, 5947– 5949. [14] Linscott, A.J., Flamholtz, R.B., Shukla, D., Song, Y., Liu, C., Finegold, S, M. (2004) Fatal septicemia due to Clostridium hathewayi and Campylobacter hominis. Anaerobe (in press).
Multiplex PCR for rapid differentiation of three species in the ‘‘Clostridium clostridioforme group’’ Song Yuli a
a,*
, Liu Chengxu a, Finegold Sydney M.
b,c,d
Research Service, VA Medical Center West Los Angeles, 11301 Wilshire Blvd., Room E3-237, Bldg. 304, Los Angeles, CA 90073, USA b Infectious Diseases Section, VA Medical Center West Los Angeles, Los Angeles, USA c Department of Medicine, UCLA School of Medicine, Los Angeles, USA d Department of Microbiology, Immunology, and Molecular Genetics, UCLA School of Medicine, Los Angeles, USA Received 27 December 2004; received in revised form 2 February 2005; accepted 11 February 2005 First published online 21 February 2005 Edited by W. Wade
Abstract Clostridium clostridioforme is a relatively antimicrobial resistant, phenotypically heterogeneous anaerobe that has been involved in a variety of infections. 16S rDNA sequencing analysis revealed three principal species in what has been called Clostridium clostridioforme – Clostridium bolteae, C. clostridioforme, and Clostridium hathewayi. Based on the 16S rDNA sequence information we obtained, we developed a cost-effective, timesaving one-step multiplex PCR assay for rapid and accurate differentiation of these three species. The established multiplex PCR identification scheme was applied to the identification of 88 clinical isolates that had previously been identified phenotypically as C. clostridioforme. The identification obtained from multiplex PCR assays showed 100% agreement with 16S rDNA sequencing identification. This scheme will permit more accurate assessment of the role of these three Clostridium species in infection and of the degree of antimicrobial resistance in each of the species. Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Clostridium clostridioforme; Multiplex PCR
1. Introduction Clostridium clostridioforme is a relatively antimicrobial resistant anaerobe that has been involved in a variety of infections, including bacteremia. Allen et al. [1] reported C. clostridioforme as the second most frequently encountered species of Clostridium in clinical specimens at Indiana University Hospital Anaerobe Laboratory, from 1989 through 2001. Identification of C. clostridioforme can pose a problem for the routine
*
Corresponding author. Tel.: +1 310 478 3711x49151; fax: +1 310 268 4458. E-mail address: [email protected] (S. Yuli).
clinical laboratory because it typically stains gram-negative, and the spores are often difficult to observe [2,3]. The traditional methods for identifying Clostridium isolates include morphological examination, various biochemical tests including carbohydrate fermentation reactions, analysis of volatile and nonvolatile fatty acid production [4,5], and gas–liquid chromatography of bacterial cellular fatty acids [6]. These methods are labor-intensive, time-consuming, and sometimes result in inconclusive identification [2]. Commercial kits represent a considerable advance in identification methods in terms of speed and simplicity. However, databases accompanying the kits are often incomplete or inaccurate, especially with the recent rapid increase of newly described or reclassified species. In addition, interpreta-
0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2005.02.017
392
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
tion of test results sometimes involves substantial subjective judgment. It has been well noted that C. clostridioforme is phenotypically heterogeneous and shows considerable variability in antimicrobial susceptibility patterns [2,3], suggesting it might be more than a single species. A recent study of ours based on 16S rDNA sequencing revealed that there are three principal species in what has been called C. clostridioforme – Clostridium bolteae, C. clostridioforme, and Clostridium hathewayi, and that there are differences between the three species in terms of phenotypic characteristics, antimicrobial susceptibility and role in disease [7]. Thus, it is important for microbiology laboratories to distinguish between them and for clinicians to be aware of differences between them. Thus far it has been difficult to distinguish the three species because the identification schemes have been based on incorrect taxonomy. In the present study, based on the accurate identification we obtained by 16S rDNA sequencing, we developed a one-step multiplex PCR scheme for rapid and accurate identification of the three major species in the ‘‘C. clostridioforme group’’.
2. Materials and methods 2.1. Bacterial strains and culture conditions Altogether, 88 isolates including 46 C. hathewayi, 21 C. bolteae and 21 C. clostridioforme that were previously identified to species level by 16s rDNA sequencing were included in this study. The organisms were isolated from various clinical specimens as well as from stool specimens from four institutions. In addition, this study included one ATCC type strain each of C. clostridioforme, C. bolteae and C. hathewayi and 32 other ATCC, DSMZ or CCUG strains of phylogenetically related species, and morphologically similar species; some of the major clostridial pathogens were used to verify the specificity of the established multiplex PCR assay (Table 1). All strains were cultured anaerobically overnight on Brucella blood agar (Anaerobe Systems, Morgan Hill, CA) or CDC ANA blood agar (BBL Microbiology Systems, Franklin lakes, NJ) at 37 °C and were characterized phenotypically by conventional tests as described in the Wadsworth-KTL Anaerobic Bacteriology Manual [5] and genetically by 16S rDNA sequence analysis. 2.2. Development of species-specific primers 16S rDNA sequences of the type strains of C. clostridioforme, C. bolteae and C. hathewayi determined in our previous study [7], as well as the related sequences retrieved from GenBank, were analyzed by multialignment using CLUSTAL-W (http://genome.kribb.re.kr).
Table 1 Reference strains used in this study Species
Source
Clostridium spp. C. bolteae C. indolis C. sporogenes C. celerecresens C. clostridioforme C. coccoides C. difficile C. hathewayi C. innocuum C. oroticum C. perfringens C. ramosum C. septicum C. sphenoides C. symbiosum C. tertium C. xylanolyticum
ATCC BAA-613T ATCC 25771T ATCC 13732 DSMZ 5628T ATCC 25537T ATCC 29236T ATCC 9689T CCUG 43506T ATCC 14501T ATCC 13619T ATCC 13124T ATCC 25582T ATCC 12464T ATCC 19403T ATCC 14940T ATCC 14573T DSMZ 6555T
Fusobacterium spp. F. nucleatum subsp. nucleatum F. naviforme F. russii F. necrophorum subsp.
ATCC ATCC ATCC ATCC
Ruminococcus spp. R. gnavus R. productus
CCUG 43222T CCUG 10976T
Anaerococcus spp. A. lactolyticus A. octavius A. prevotii A. tetradius A. vaginalis
CCUG CCUG CCUG CCUG CCUG
31351T 38493 41932T 46590T 31349T
Peptoniphilus spp. P. asaccharolyticus P. harei P. indolicus P. ivorii P. lacrimalis
CCUG CCUG CCUG CCUG CCUG
9988T 38491T 17639T 38492T 31350T
Peptostreptococcus spp. P. anaerobius P. micros
CCUG 7835T CCUG 46357T
25586T 25832T 25533T 25286T
Based on the multialignment analysis data, three potential species-specific primer pairs, Clos-F1 and ClosR2 for C. clostridioforme, Cfe-1 and Cfe-2 for C. bolteae, and Cha-F1 and Cha-4R for C. hathewayi, were selected from the 16S rRNA gene (Table 2). The primer sequences were analyzed for secondary structure formation, G + C content, and primer–dimer formation with the NetPrimer analysis software (http://www. premierbiosoft.com/netprimer). The specificities of these primers were predicted by comparison to the aligned SSU_rRNAdatabase of the RDP using the CHECK_PROBE utility [8] and were further confirmed with DNAs from 32 reference strains (Table 1). These primers were designed with minimal differences in their
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
393
Table 2 Oligonucleotide primers used in this study Primer
Sequence (5 0 -3 0 )
Target
Product size (bp)
Cfe-1 Cfe-2
CCTCTTGACCGGCGTGT CCTAGAGTGCCCAGCTTTACCTG
C. bolteae
153
Clos-F1 Clos-R2
GCCGCATGGCAGTGTGT ACCGGCCCGTCAGGGGGAT
C. clostridioforme
800
Cha-F1 Cha-4R
GGAGCGTAGACGGTTTAG CGGTTAAAGTGTTTTCAGTG
C. hathewayi
444
annealing temperature within each primer set, and to yield amplification products that ranged between 150 and 800 bp and differed by at least 100 bp. We also synthesized another primer pair (8UA and 341B) that corresponds to a region of the 16S rRNA gene that is conserved in all eubacteria [9]. These primers, which amplify an approximately 330 bp fragment, were used in independent amplification (i.e., not as part of the multiplex protocol) to ensure that the lack of an amplification product from species other than our targeted species reflected the specificity of our protocol rather than the lack of suitable template DNA. 2.3. Identification of three Clostridium species by multiplex PCR assay The multiplex PCR assay was applied to identify a total of 88 clinical isolates. PCR amplification was carried out in a total volume of 50 ll containing 1.25 U of Taq polymerase (Promega, WI), 50 mM KCL, 10 mM Tris– HCl [pH9.0], 0.1% Triton, 2.5 mM MgCl2, 0.5 mM (each) primer, 0.2 mM dNTPs, and 3 ll of bacterial lysate as the DNA template. PCR was carried out for 35 cycles. Each cycle consisted of 95 °C for 20 s for denaturation, 58 °C for 1 min for annealing, 72 °C for 30 s for extension. A cycle of 72 °C for 5 min was added to the final extension. PCR products were analyzed by electrophoresis on a 2% agarose gel followed by ethidium bromide staining. 2.4. Sensitivity of multiplex PCR assay The sensitivity of the multiplex PCR assay was evaluated by titrating cultures of the type strains of the three Clostridium species. The strains were suspended in Tris– HCl (pH 7.5) and the density was adjusted to approximately 108 CFU ml1 using a 0.5 McFarland standard. Thereafter, serial 10-fold dilutions of cultures were made in Tris–HCl. Equal volumes (100 ll) of dilutions were plated onto Brucella blood agar plates, and were used for DNA preparation for subsequent multiplex PCR assay. Colonies were counted after 3 days incubation under anaerobic conditions. The DNA templates were obtained by heating cells at 95 °C for 10 min and by
extraction and purification by QIAamp DNA Mini kit (Qiagen Inc., Chatsworth, CA)]. The detection limit of the multiplex PCR assay was determined with known numbers of bacteria diluted in Tris–HCl (pH 7.5).
3. Results and discussion The data of our parallel clinical study based on 16S rDNA sequence analysis of ‘‘C. clostridioforme group’’ isolates showed that there are three distinct species in the so-called ‘‘C. clostridioforme group’’ – C. bolteae, C. clostridioforme, and C. hathewayi [7]. The sequence similarities between C. clostridioforme and C. bolteae, C. clostridioforme and C. hathewayi, and C. bolteae and C. hathewayi were 97.0%, 94.3% and 94.4%, respectively. In this study, based on the 16S rDNA sequence information we developed a more cost-effective, timesaving one-step multiplex PCR assay for rapid and accurate identification of the three principal species in the ‘‘C. clostridioforme group’’. Three pairs of speciesspecific primers were selected from the 16S rRNA genes for C. clostridioforme, C. bolteae and C. hathewayi. The species were identified to species level by producing a unique DNA fragment (C. bolteae, 153 bp; C. clostridioforme, 800 bp; C. hathewayi, 444 bp) as expected (Fig. 1). The sequence analysis showed that C. clostridioforme and C. bolteae shared high sequence similarity [10]; there is only one hypervariable region between these two species so that region was used for primer selection. All the forward and reverse primers are species-specific except for the reverse primer for C. bolteae, which shares the same sequences as those of C. clostridioforme. However, the specificity of these primers was verified by multiplex PCR amplification with DNA from 32 reference strains of phylogenetically related species, resulting in amplification only with the DNA from strains of the target species (data not shown). The quality of all the DNA samples that gave negative multiplex PCR results were checked by running PCR with the 16S rRNA gene universal primer pair (8UA and 341B). All DNA samples gave an expected band of about 300 bp, indicating that the lack of an amplification product from species other than our targeted
394
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
Fig. 1. Polyacrylamide gel electrophoresis of PCR products from multiplex PCR assay. Lanes M, molecular marker (X174 RF DNA/Hae III). Lane 1, C. bolteae ATCC BAA-613T with an amplicon of ca. 150 bp, lanes 2–4, C. bolteae clinical isolates; lane 5, C. hathewayi CCUG 43506T with an amplicon of ca. 440 bp, lanes 6–8, C. hathewayi clinical isolates; lane 9, C. clostridioforme ATCC 25537T with an amplicon of ca. 800 bp, lanes 10–12, C. clostridioforme clinical isolates.
organisms reflected the specificity of our protocol rather than the lack of suitable template DNA (data not shown). However, since the primers were designed on the basis of currently available 16S rRNA sequences, the specificity is not guaranteed for uncharacterized bacteria. Thus, the multiplex PCR developed in this study may not detect additional diversity among the target organisms; there may be additional species in this group that share the annealing sites of our primers. It is an advantage, then, that these primers were designed from the very variable regions of the 16S rRNA genes and that only the same species are more likely to have the same target sequences. This assay was used to identify a total of 88 isolates of the ‘‘C. clostridioforme group’’; the identification obtained from the multiplex PCR assay showed 100% agreement with 16S rDNA sequencing identification. The developed multiplex PCR assay detected between 50 and 500 CFU/PCR reaction of each species. Using purified DNA as the PCR template increased the sensitivity of our procedure to 5 cells (data not shown). Clostridium species are commonly encountered in a variety of polymicrobial infections involving the abdomen, including peritonitis, intra-abdominal abscess and septicemia. Accurate identification of Clostridium isolates helps in evaluating the clinical significance of a positive culture and is important for predicting effective antibiotic therapy. C. clostridioforme has been listed as the second most frequently isolated Clostridium species from clinical specimens by one group [1] and described as very heterogenous [3]. Observations from the above study showed the clinical importance of C. hathewayi, which had previously been described only from stool specimens [11], and perhaps even greater clinical significance for C. clostridioforme which was the organism found in highest frequency from bacteremia. Three recent studies also highlight the importance of C. hathewayi as a potential human pathogen [12–14]. There are also some differences in antimicrobial susceptibility between these three species. Therefore, it is important for
microbiology laboratories to distinguish between these species and for clinicians to be aware of differences between them. Sequence determination of the 16S rRNA gene represents a highly accurate and versatile method for identification of bacteria to the species level; however, cost is a critical issue in the use of 16S rDNA sequence analysis as a diagnostic tool. The multiplex PCR-based identification scheme developed in this study can be considered (in terms of reduction of labor time (<24 h), relatively low cost (6$5/strain), easy application, and reliable and repeatable PCR results) a powerful potential tool for routine clinical differentiation of these Clostridium species. In conclusion, we developed a one-step multiplex PCR assay for rapid and reliable identification of the three Clostridium species that are often misidentified as C. clostridioforme phenotypically. Further experiments will be necessary to determine the conditions needed to detect these species directly from clinical specimens.
Acknowledgements This work has been carried out, in part, with financial support from Veterans Administration Merit Review funds. Some of the strains of the ‘‘C. clostridioforme group’’ used in this study have been provided to us by Stephen D. Allen, Eija Ko¨no¨nen, and David W. Hecht.
References [1] Allen, S.D., Emery, C.L. and Lyerly, D.M. (2003) Clostridium In: Manual of Clinical Microbiology (Murray, P.R., Baron, E.J., Pfaller, M.A., Jorgensen, J.H. and Yolken, R.H., Eds.), 8th edn, pp. 835–856. American Society for Microbiology, Washington, DC. [2] Alexander, C.J., Citron, D.M., Brazier, J.S. and Goldstein, E.J. (1995) Identification and antimicrobial resistance patterns of
S. Yuli et al. / FEMS Microbiology Letters 244 (2005) 391–395
[3]
[4]
[5]
[6]
[7]
clinical isolates of Clostridium clostridioforme, Clostridium innocuum, and Clostridium ramosum compared with those of clinical isolates of Clostridium perfringens. J. Clin. Microbiol. 33, 3209– 3215. Cato, E.P., George, W.L. and Finegold, S.M. (1986) Genus Clostridium In: BergeyÕs Manual of Systematic Bacteriology Sneath (Sneath, P.H.A., Ed.), 8th edn, pp. 1141–1200. Williams and Wilkins, Baltimore. Holdeman, L.V., Cato, E.P. and Moore, W.E.C. (1977) Anaerobe Laboratory Manual, 4th edn. Virginia Polytechnic Institute and State University, Blacksburg, Virginia. Jousimies-Somer, H.R., Summanen, P., Citron, D.M., Baron, E.J., Wexler, H.M. and Finegold, S.M. (2002) Wadsworth Anaerobic Bacteriology Manual, 6th edn. Star Publishing Co., Belmont, California. Allen, S.D., Siders, J.A., Riddell, M.J., Fill, J.A. and Wegener, W.S. (1995) Cellular fatty acid analysis in the differentiation of Clostridium in the clinical microbiology laboratory. Clin. Infect. Dis. Suppl. 2, S198–S201. Finegold, S.M., Song, Y., Liu, C., Hecht, D.W., Summanen, P., Ko¨no¨nen, E., and Allen, S. D. (2005) Clostridium clostridioforme, a mixed breed with a big bite. Eur. J. Clin. Microbiol; Infect. Dis. (in press).
395
[8] Maidak, B.L., Cole, J.R., Lilburn Jr., T.G., Parker, C.T., Saxman, P.R., Farris, R.J., Garrity, G.M., Olsen, G.J., Schmidt, T.M. and Tiedje, J.M. (2001) The RDP-II (Ribosomal Database Project). Nucleic Acids Res. 29, 173–174. [9] Brosius, J., Palmer, M.L., Kennedy, P.J. and Noller, H.F. (1978) Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. Proc. Natl. Acad. Sci. USA 75, 4801–4805. [10] Song, Y., Liu, C., Molitoris, D.R., Tomzynski, T.J., Lawson, P.A., Collins, M.D. and Finegold, S.M. (2003) Clostridium bolteae sp.nov., isolated from human sources. Syst. Appl. Microbiol. 26, 84–89. [11] Steer, T., Collins, M.D., Gibson, G.R., Hippe, H. and Lawson, P.A. (2001) Clostridium hathewayi sp. nov., from human faeces. Syst. Appl. Microbiol. 24, 353–357. [12] Elsayed, S. (2004) Human infection caused by Clostridium hathewayi. Emerg. Infect. Dis. 10, 1950–1952. [13] Woo, P.C., Lau, S.K., Woo, G.K., Fung, A.M., Yiu, V.P. and Yuen, K.Y. (2004) Bacteremia due to Clostridium hathewayi in a patient with acute appendicitis. J. Clin. Microbiol. 42, 5947– 5949. [14] Linscott, A.J., Flamholtz, R.B., Shukla, D., Song, Y., Liu, C., Finegold, S, M. (2004) Fatal septicemia due to Clostridium hathewayi and Campylobacter hominis. Anaerobe (in press).