- Email: [email protected]
Musashi2 modulates K562 leukemic cell proliferation and apoptosis involving the MAPK pathway
E XP E RI ME N TAL CE L L R ES E ARC H
3 2 0 ( 2 0 14 ) 119 – 1 2 7
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/yexcr
Research Article
Musashi2 modulates K562 leukemic cell proliferation and apoptosis involving the MAPK pathway Huijuan Zhang, Shi Tan, Juan Wang, Shana Chen, Jing Quan, Jingrong Xian, Shuai shuai Zhang, Jingang He, Ling Zhangn Key Laboratory of Laboratory Medical Diagnostics Designated by the Ministry of Education, College of Laboratory Medicine, Chongqing Medical University, 1#, Yixueyuan Road, Chongqing 400016, China
article information
abstract
Article Chronology:
The RNA-binding protein Musashi2 (Msi2) has been identified as a master regulator within a
Received 22 June 2013
variety of stem cell populations via the regulation of translational gene expression. A recent study
Received in revised form
has suggested that Msi2 is strongly expressed in leukemic cells of acute myeloid leukemia
15 September 2013
patients, and elevated Msi2 is associated with poor prognosis. However, the potential role of Msi2
Accepted 17 September 2013
in leukemogenesis is still not well understood. Here, we investigated the effect of Msi2
Available online 26 September 2013
knockdown on the biological properties of leukemic cells. High expression of Msi2 was found
Keywords: Musashi2 Leukemia K562 Proliferation Apoptosis MAPK
in K562 and KG-1a leukemic cell lines, and low expression was observed in the U937 cell line. We transduced K562 cells with two independent adenoviral shRNA vectors targeting Msi2 and confirmed knockdown of Msi2 at the mRNA and protein levels. Msi2 silencing inhibited cell growth and caused cell cycle arrest by increasing the expression of p21 and decreasing the expression of cyclin D1 and cdk2. In addition, knockdown of Msi2 promoted cellular apoptosis via the upregulation of Bax and downregulation of Bcl-2 expression. Furthermore, Msi2 knockdown resulted in the inactivation of the ERK/MAPK and p38/MAPK pathways, but no remarkable change in p-AKT was observed. These data provide evidence that Msi2 plays an important role in leukemogenesis involving the MAPK signaling pathway, which indicates that Msi2 may be a novel target for leukemia treatment. & 2013 Elsevier Inc. All rights reserved.
Introduction The Musashi (Msi) family consists of a group of RNA-binding proteins that can act as a translational repressor of target mRNAs [1]. Msi proteins affect asymmetric cell division, stem cell function and cell fate determination in various somatic tissues [2]. The Msi
family includes two Msi homologs, Msi1 and Msi2 [3]. Msi1 has been described as having pivotal functions in stem cell maintenance, nervous system development, and tumorigenesis [4]. In contrast, Msi2 is preferentially expressed in the hematopoietic system. Recent work has identified Msi2 as a master regulator of the hematopoietic stem cells (HSCs) and leukemic stem cells [5].
Abbreviations: Msi, Musashi; Msi2, Musashi2; HSCs, hematopoietic stem cells; AML, acute myeloid leukemia; CML, chronic myelogenous leukemia; MAPK, mitogen-activated protein kinase; MTT, methyl thiazolyl tetrazolium solution; FITC, fluorescein isothiocyanate n
Corresponding author. Fax: þ86 23 68485240. E-mail address: [email protected] (L. Zhang).
0014-4827/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.yexcr.2013.09.009
120
E X PE R IM ENTA L C ELL R E S EA RC H
In addition to demonstrating a central role in the maintenance of cell ‘stemness’, more recently, Msi2 has been shown to play an important role in hematopoietic malignancies. Increased expression of Msi2 at both the mRNA and protein levels, have been associated with a worse clinical prognosis in acute myeloid leukemia (AML) [6,7]. Similarly, upregulation of Msi2 has been demonstrated in blast crisis chronic myelogenous leukemia (CML) compared with the chronic phase and correlates with a higher risk of CML relapse [8]. In addition, high Msi2 expression indicates poor prognosis in adult B-cell acute lymphoblastic leukemia [9]. Although Msi2 has been regarded as a new prognostic biomarker in leukemia, no direct Msi2 targets have yet been described. Ito et al. [8] has reported that Msi2 expression suppresses Numb translation, allowing upregulation of Notch signaling and CML progression in a murine model. Nevertheless, data obtained from clinical analysis demonstrated that the correlation of Msi2 and Numb expression levels was not observed in a large and well-characterized cohort of AML patients, suggesting Msi2 might mediate its biological effects via several alternative signaling pathways [10]. However, a relevant mechanism of Msi2 in the context of AML remains unknown. To explore the potential roles of Msi2 in leukemia, we examined whether Msi2 affected the proliferation and apoptotic properties of the human leukemic cell line K562 in vitro using RNA interference. Furthermore, the potential molecular mechanisms modulated by Msi2 in leukemogenesis were explored. Our data demonstrated that Msi2 silencing inhibited leukemic cell growth and promoted apoptosis involving the mitogen-activated protein kinase (MAPK) signaling pathway.
Materials and methods Cell culture The 293A (Ad5 E1-transformed human embryo kidney cell line) cell line was cultured in Dulbecco's modified Eagle's medium and human leukemic cell lines containing KG-1a (AML M1), HL-60 (AML M2), OCI-AML3 (AML M4), THP-1(AML M5), U937 (AML M5) and K562 (blast phase CML) were maintained in RPMI 1640 medium with 10% FBS and incubated at 37 1C in a humidified incubator with 5% CO2. OCI-AML3 was kindly provided by The University of Texas MD Anderson Cancer Center, Houston, USA. Other cell lines were purchased from the Shanghai Institutes for Biological Science, China.
Construction of adenoviral vectors Two independent shRNA constructs (shMsi2-1 and shMsi2-2) were used to knockdown Msi2. The target sequences for Msi2
3 2 0 ( 2 0 14 ) 119 – 1 2 7
RNA interference were selected according to Kharas et al. [5]. The scramble sequence, which was used as a negative control, was obtained from GenScript software. The shMsi2 and scramble sequences used were the following: shMsi2-1: 5′-CCAGCAAGTGTAGATAAAGTA-3′; shMsi2-2: 5′-CCCAACTTCGT-GGCGACCTAT-3′; scramble: 5′–GTGCCCTCCTAGCCCTGTAAA-3′. The sequence was cloned into the pSES-HUS shuttle plasmid with a U6 and H1 double promoter-driven RFP expression cassette. After the plasmids were successfully sequenced, three plasmids were recombined with a backbone vector Adeasy-1 in BJ5183 bacteria.
Transfection and infection After digestion with PacI (Fermentas, CA), 1.2 μg of recombinant DNA was transfected into 293 A cells with 3 μl of Lipofectamine™ 2000 (Invitrogen, USA) in a 24-well plate. Adenovirus collection, amplification and titer detection were performed according to Luo et al. [11]. K562 cells were initially cultured in serum-free RPMI 1640 medium for 2 h, and then incubated with adenovirus and 4 μg/ml polybrene (Sigma, USA) for the final concentration. After absorption for 8 h, the serum-free medium was replaced with fresh medium containing 10% FBS.
Real-time PCR analysis Total RNA were extracted using the RNAiso Plus reagent (Takara, Japan) and then reverse-transcribed to cDNA according to the manufacturer's instructions. The transcribed cDNA was mixed with SYBRs Premix Ex Taq™ II reagent (Takara, Japan) and genespecific primers. The cDNA was amplified in the CFX48 system (Bio-Rad, USA) according to the manufacturer's instructions. The forward and reverse primers for each mRNA, and the length of each PCR product are listed in Table 1. For quantification, the samples were normalized against the expression of the actin gene transcript.
Western blotting analyses Cells were lysed on ice in lysis buffer and the cleared lysates were collected by centrifugation at 12,000g for 30 min at 4 1C. Protein concentrations were measured using the Bradford method. In this study, 100 μg of protein samples were separated using SDS-PAGE and transferred onto PVDF membranes. PVDF membranes were blocked with 5% non-fat dry milk for 2 h at room temperature and then incubated with primary antibody overnight at 4 1C. AntiMsi2 was purchased from Abcam (Cambridge, MA), and anti-p21 and anti-cyclin D1 were purchased from Biosynthesis Biotechnology
Table 1 – The sequence of PCR primers for each gene. Genes
Forward primer
Reverse primer
PCR fragment size (bp)
Actin Msi2 p21 Cyclin D1 cdk2 Bax Bcl-2
TAGTTGCGTTACACCCTTTCTTG GTTATCTGCGAACACAGTAGTG CCCGTGAGCGATGGAAC CCTGTCGCTGGAGCCCGTG AACAAGTTGACGGGAGAGGT GGATGCGTCCACCAAGAA TTGTGGCCTTCTTTGAGTTCG
TGCTGTCACCTTCACCGTTC ACCCTCTGTGCCTGTTGGTAG CCCGTGGGAAGGTAGAGC TCCGCCTCTGGCATTTTGG GAAGAGGAATGCCAGTGAGA GCACTCCCGCCACAAAGA CACCTACCCAGCCTCCGTTAT
156 110 110 252 238 386 153
E XP ER I ME NTAL C E LL RE S E ARCH
(Bioss, China). Anti-cdk2 and anti-c-fos were obtained from Immunoway Biotechnology Company (Immunoway, USA) and anti-β-actin, anti-Bax and anti-Bcl-2 were purchased from Santa Cruz Biotechnology (Santa Cruz, USA). Anti-c-myc, anti-ERK, antip-ERK, anti-p38, anti-p-p38, anti-MAPKAPK2, anti-p-MAPKAPK2, anti-AKT and anti-p-AKT were purchased from Bioworld Technology (Bioworld, USA). Membranes were washed with TBST (20 mM Tris–HCl, pH 7.6, 137 mM NaCl, 0.1% Tween 20) three times for 10 min each and then incubated with alkaline horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibody (ZSGB, China) for 1 h at room temperature. Protein bands were visualized by incubating the membranes in chemiluminescence HRP substrate (Millipore, USA). Quantification of protein expression was normalized against the expression of β-actin protein and phosphorylation of the protein was compared to the total protein.
Cell proliferation assay K562 cells were plated at 2 103 cells/well in a 96-well plate and maintained in 50 μl of RPMI 1640 serum-free medium. After 2 h, either scramble or shMsi2 adenovirus was added to the cells and RPMI 1640 medium with 20% FBS was supplemented to a final volume of 100 μl in each well. Next, 20 μl of 2.5 mg/ml methyl thiazolyl tetrazolium solution (MTT) (Sigma, USA) reagent was added to each well at 0, 1, 2, 3, 4 or 5 days after infection and the cells were further incubated for 4 h at 37 1C and 5% CO2. The MTT solution was then replaced with 150 μl DMSO (Sigma, USA), and the absorbance was measured at 490 nm on a microplate reader. The experiment was performed in triplicate.
Colony formation assay K562 cells infected with the scramble or shMsi2 adenovirus were inoculated in 0.9% methylcellulose (Sigma, USA) at 103 cells/well in a 24 well-plate. The number of colonies in each well was quantified under a microscope (Olympus, Japan) 7 days later. The experiment was performed in triplicate.
Flow cytometric analysis of cell cycle and apoptosis K562 cells were infected with the scramble or shMsi2 adenovirus for 72 h. Next, the cells were harvested and washed with PBS. For cell cycle detection, cells were fixed using 70% ice-cold ethanol and placed at 4 1C overnight. The cell pellet was then treated with
3 2 0 ( 2 0 14 ) 119 – 1 2 7
121
RNase and stained with propidium iodide. For apoptotic detection, the cells were suspended with 100 μl of binding buffer and incubated with fluorescein isothiocyanate (FITC)-conjugated Annexin V (BD Biosciences, CA). Both the cell cycle and apoptosis were analyzed using a FACSCalibur flow cytometer (BD Biosciences, CA).
Wright–Giemsa stain K562 cells infected with the scramble or shMsi2 adenovirus for 72 h were washed twice with PBS. The cell pellet was fixed on a clean slide and stained according to the manufacturer's instructions (KeyGen BioTECH, China). The morphology of cells was observed under a microscope (Olympus, Japan).
Statistics Statistical analysis for data obtained from different groups was performed using SPSS 17.0 Statistical software. The data were expressed as the mean7standard deviation (SD) (nZ3) and compared using one-way analysis of variance (ANOVA). po0.05 was considered statistically significant in different groups.
Results Expression of Msi2 in leukemic cell lines To analyze the Msi2 level in human leukemic cell lines, Msi2 protein expression was examined in five AML cell lines (KG-1a, HL-60, OCI-AML3, THP-1 and U937) and a blast crisis CML cell line (K562). Western blotting analyses showed high expression of Msi2 protein in KG-1a and K562 cells, and low expression in U937 and OCI-AML3 cells (Fig. 1).
Downregulation of Msi2 expression in K562 cells To identify whether Msi2 expression was reduced in K562 cells after infection with adenovirus expressing Msi2-shRNA, real-time PCR and Western blotting analyses were performed to detect the mRNA and protein expression levels of Msi2, respectively. The results indicated that the expression levels of Msi2 mRNA and protein in the shMsi2 group were decreased significantly compared to the scramble group (Fig. 2).
Fig. 1 – Levels of Msi2 protein expression in leukemic cell lines. (A) Western blotting analysis demonstrating Msi2 protein expression in KG-1a, HL-60, OCI-AML3, THP-1, U937 and K562 leukemic cell lines. (B) Msi2 protein levels were quantified using image software and normalized against β-actin. β-Actin was used as a loading control. *po0.05 versus other cell lines.
122
E X PE R IM ENTA L C ELL R E S EA RC H
3 2 0 ( 2 0 14 ) 119 – 1 2 7
Fig. 2 – Downregulation of Msi2 mRNA and protein levels in K562 cells. (A) Msi2 mRNA expression was examined in K562 cells after infection of adenovirus for 48 h using real-time PCR. (B) The protein expression of Msi2 was assayed after infection of adenovirus for 72 h using Western blotting analyses. Msi2 protein levels were quantified using image software and normalized against β-actin. β-Actin was used as a loading control. *po0.05 versus the scramble group.
Fig. 3 – Knockdown of Msi2 decreased K562 cell growth. (A) MTT assay for cell growth curves of K562 cells infected with the scramble or shMsi2 adenovirus. K562 cells were plated at a density of 2 103 cells/well. (B) The colonies of K562 cells infected with the scramble or shMsi2 adenovirus were quantified under a microscope (40 ). Colonies were grown in methylcellulose for 7 days. (C) Statistical analyses for the number of colonies in each group. *po0.05 versus the scramble group.
Knockdown of Msi2 inhibited K562 cell proliferation To examine whether Msi2 had an effect on K562 cell proliferation, MTT and colony formation assays were performed. As shown in Fig. 3A, the growth rate of K562 cells was attenuated in the shMsi2 group compared to the scramble group. Similarly, knockdown of Msi2 reduced the number of K562 cell colonies, which indicated that cell colony formation was impaired after Msi2 inhibition (Fig. 3B and C).
Knockdown of Msi2 caused cell cycle arrest in the G0/G1 phase To determine whether Msi2 affected the cell cycle of K562 cells, flow cytometry was employed to assay the cell cycle distribution. These results showed that Msi2-shRNA resulted in an increase of K562 cells in the G0/G1 phase and a decrease of cells in the S phase (Fig. 4A and B). Moreover, we detected the mRNA and protein levels of the cell cycle regulators p21, cyclin D1 and cdk2.
E XP ER I ME NTAL C E LL RE S E ARCH
3 2 0 ( 2 0 14 ) 119 – 1 2 7
123
Fig. 4 – Knockdown of Msi2 affected the cell cycle of K562 cells. (A) Cell cycle analysis showed that Msi2 knockdown increased the number of K562 cells in the G0/G1 phase and decreased the number of cells in the S phase. (B) The percentages of living cells in G0/G1, S and G2/M phases of the cell cycle are indicated. (C, E and G) The mRNA expression of cell cycle regulators, p21, cyclin D1 and cdk2 was analyzed using real-time PCR. (D, F and H) p21, cyclin D1 and cdk2 protein expression was examined using Western blotting analyses. The protein levels were quantified using image software and normalized to β-actin. β-Actin was used as a loading control. *po0.05 versus the scramble group.
124
E X PE R IM ENTA L C ELL R E S EA RC H
Real-time PCR and Western blotting analyses indicated that Msi2 silencing increased p21, but significantly inhibited cyclin D1 and cdk2 expression at both the mRNA and protein levels compared to the scramble group (Fig. 4C–H).
Knockdown of Msi2 induced K562 cell apoptosis To explore whether and how Msi2 regulated apoptosis in K562 cells, the early apoptosis of K562 cells was examined using Annexin V-FITC staining followed by flow cytometry. The percentage of K562 cells in early apoptosis was increased in the Msi2-2 group (15.1472.32%) compared to the scramble group (4.5971.21%) (Fig. 5A). In addition, the Wright–Giemsa stain revealed characterized features of late apoptosis, including nuclear condensation and apoptotic small bodies in the shMsi2-2 group (Fig. 5B). We further found that the levels of pro-apoptotic factor Bax were increased and the levels of antiapoptotic factor Bcl-2 were decreased significantly in the shMsi2-2 group compared to the scramble group (Fig. 5C and D).
Knockdown of Msi2 inactivated the MAPK pathway To further define the molecular mechanisms modulated by Msi2 in the growth and apoptosis of K562 cells, activation of the MAPK signaling pathway and AKT were examined. Knockdown of Msi2 resulted in the inactivation of the ERK/MAPK pathway with decreases in the phosphorylation of ERK and the expression of its downstream targets, c-myc and c-fos (Fig. 6A). Similarly, the phosphorylation of both p38 and its downstream target MAPKAPK2
3 2 0 ( 2 0 14 ) 119 – 1 2 7
were also decreased after Msi2 silencing (Fig. 6B). However, no change in p-AKT was detected after knockdown of Msi2 (Fig. 6C).
Discussion The RNA-binding protein Msi exhibits translational control via a sequence-specific interaction with the 3′ UTR of target mRNAs within a variety of stem cell populations [12]. Several recent reports have linked Msi family members to the pathogenesis of solid tumors [13–15]. Most recently, Msi2 has emerged as a significant indicator of myeloid leukemia, where upregulation of Msi2 was linked to rapid progression and poor prognosis [16]. However, the specific biological effects and the relevant mechanism mediated by Msi2 in leukemia remain poorly understood. Here, we observed that knockdown of Msi2 inhibited leukemic cell proliferation and induced apoptosis in vitro involving the MAPK pathway. In this study, we first observed Msi2 expression in six myeloid leukemic cell lines. Msi2 was highly expressed in both the AML and CML cell lines. Among the five AML cell lines, high Msi2 levels were found in KG-1a (FAB M1), whereas low Msi2 levels were detected in the U937 (FAB M5) cell line. These results were consistent with the report that patients with high Msi2 expression were more often classified as FAB M1 and less likely as FAB M5, compared to patients with low Msi2 expression [10]. To investigate the functional role of increased Msi2 expression in leukemic cells, we transduced the CML cell line K562 with adenoviral shRNA vectors targeting Msi2. K562 cell was selected as a cellular model due to its high expression of
Fig. 5 – Knockdown of Msi2 induced K562 cell apoptosis. (A) K562 cells infected with the scramble or shMsi2-2 adenovirus were stained with Annexin V-FITC prior to flow cytometry. (B) Morphological feature of apoptosis was examined using the Wright– Giemsa stain. K562 cells infected with the shMsi2-2 adenovirus displayed typical features of late apoptosis, which consisted of nuclear condensation and apoptotic bodies. Black arrows indicate the apoptotic cells. (C and D) The expression of Bax and Bcl2 mRNA and protein was examined using real-time PCR and Western blotting analyses, respectively. Bax and Bcl-2 protein levels were quantified using image software and normalized against β-actin. β-Actin was used as a loading control. *po0.05 versus the scramble group.
E XP ER I ME NTAL C E LL RE S E ARCH
3 2 0 ( 2 0 14 ) 119 – 1 2 7
125
Fig. 6 – Knockdown of Msi2 inhibited the MAPK signaling pathway. K562 cells were infected with the scramble or shMsi2 adenovirus for 72 h. (A) The ERK/MAPK pathway and its downstream target proteins were detected by Western blotting analyses. (B) The p38/MAPK pathway and its downstream target proteins were also detected using Western blotting analyses. (C) p-AKT and total AKT expression were examined using Western blotting analyses. All the phosphorylated proteins were quantified using image software and normalized against total proteins. The c-myc and c-fos protein levels were quantified using Image software and normalized against β-actin. β-actin was used as a loading control. npo0.05 versus the scramble group.
Msi2. Successful inhibition of Msi2 expression was observed in K562 cells as demonstrated by decreases of Msi2 mRNA and protein. We found that Msi2 knockdown suppressed K562 cell growth, which resulted in a decreased cell growth rate and a reduction in the number of colonies. Consistent with our results, Msi2 silencing resulted in a decrease in proliferation in the AML cell lines, NOMO-1 and THP-1, and the blast crisis CML cell lines, AR230 and LAMA-84 [5]. Currently, it is unclear why knockdown of Msi2
reduces the growth of leukemic cells. Our data herein demonstrated that downregulation of Msi2 suppressed the cell cycle transition from G0/G1 to S phase by increasing the expression of p21 and decreasing cyclin D1 and cdk2 expression. Similarly, knockdown of Msi2 significantly decreased murine HSCs in the S-G2/M phase by regulating p21, cyclin D1 and ckd2 expression [17,18]. It has been proposed that as a cell fate determinant, Msi2 promoted cell cycle progression in normal and malignant hematopoiesis. We also
126
E X PE R IM ENTA L C ELL R E S EA RC H
observed that knockdown of Msi2 increased the percentage of early apoptotic cells as demonstrated by Annexin V-FITC staining and late apoptotic cells as evidenced by morphological detection. These findings were consistent with the observation that knockdown of Msi2 using lentiviral shRNA vectors caused a marked induction of apoptosis in leukemic cell lines [5]. Moreover, Bax and Bcl-2 are important pro-apoptotic and anti-apoptotic factors, respectively. In this study, we found increased expression of Bax, whereas Bcl-2 was decreased significantly after Msi2 silencing. However, further studies will be needed to verify whether Msi2 affects the expression of other important genes. The MAPK pathway coordinately regulates diverse cellular programs, such as proliferation, apoptosis and differentiation. In this study, we showed that Msi2 knockdown resulted in remarkable decreases in the expression of p-ERK, c-myc and c-fos in the ERK/MAPK pathway. Activation of ERK indirectly allowed Bcl-2 to form homodimers to produce an anti-apoptotic effect [19]. As an important oncogene, c-myc enhanced cdk2, but suppressed p21 expression to subsequently promote cell proliferation [20]. In addition, our results demonstrated that Msi2 knockdown blocked the phosphorylation of p38 and its downstream target protein MAPKAPK2. Although previous studies have reported that gene targets activated by several pathways (i.e. MAPK, Wnt and Myc) were suppressed using bioinformatic analysis of Msi2 shRNA microarray data [5], to the best of our knowledge, this is the first experimental identification that the MAPK pathway is involved in Msi2-mediated leukemogenesis. In addition to the MAPK pathway, the PI3K/AKT pathway also plays a central role in leukemic cell proliferation, growth and survival [21]. Enhanced AKT activation is an important mechanism of the transformation in AML [22]. However, we found that Msi2 silencing exhibited no remarkable effect on the phosphorylation of AKT. Thus, it is essential to further determine the functional role of the PI3K/AKT pathway in Msi2mediated leukemogenesis. In summary, our data demonstrated that Msi2 knockdown inhibited leukemic cell proliferation and promoted cell apoptosis involving the MAPK signaling pathway. This study provides novel insight into the mechanisms of leukemogenesis. We propose future studies specifically targeting Msi2 as a therapeutic option for diagnosis and treatment response.
Conflict of interests The authors have declared that no conflict of interest exists.
Acknowledgments This project was supported by a grant obtained from the National Natural Science Foundation of China (No. 81271913).
references [1] H. Okano, T. Imai, M. Okabe, Musashi: a translational regulator of cell fate, J. Cell Sci. 115 (2002) 1355–1359. [2] H. Okano, H. Kawahara, M. Toriya, K. Nakao, S. Shibata, T. Imai, Function of RNA-binding protein Musashi-1 in stem cells, Exp. Cell. Res. 306 (2005) 349–356.
3 2 0 ( 2 0 14 ) 119 – 1 2 7
[3] S. Sakakibara, Y. Nakamura, H. Satoh, H. Okano, Rna-binding protein Musashi2: developmentally regulated expression in neural precursor cells and subpopulations of neurons in mammalian CNS, J. Neurosci. 21 (2001) 8091–8107. [4] J.M. Sutherland, E.A. McLaughlin, G.R. Hime, N.A. Siddall, The musashi family of RNA binding proteins: master regulators of multiple stem cell populations, Adv. Exp. Med. Biol. 786 (2013) 233–245. [5] M.G. Kharas, C.J. Lengner, F. Al-Shahrour, L. Bullinger, B. Ball, S. Zaidi, K. Morgan, W. Tam, M. Paktinat, R. Okabe, M. Gozo, W. Einhorn, S.W. Lane, C. Scholl, S. Frohling, M. Fleming, B.L. Ebert, D.G. Gilliland, R. Jaenisch, G.Q. Daley, Musashi-2 regulates normal hematopoiesis and promotes aggressive myeloid leukemia, Nat. Med. 16 (2010) 903–908. [6] L. Bullinger, K. Dohner, E. Bair, S. Frohling, R.F. Schlenk, R. Tibshirani, H. Dohner, J.R. Pollack, Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia, N. Engl. J. Med. 350 (2004) 1605–1616. [7] R.J. Byers, T. Currie, E. Tholouli, S.J. Rodig, J.L. Kutok, MSI2 protein expression predicts unfavorable outcome in acute myeloid leukemia, Blood 118 (2011) 2857–2867. [8] T. Ito, H.Y. Kwon, B. Zimdahl, K.L. Congdon, J. Blum, W.E. Lento, C. Zhao, A. Lagoo, G. Gerrard, L. Foroni, J. Goldman, H. Goh, S.H. Kim, D.W. Kim, C. Chuah, V.G. Oehler, J.P. Radich, C.T. Jordan, T. Reya, Regulation of myeloid leukaemia by the cell-fate determinant Musashi, Nature 466 (2010) 765–768. [9] Q. Mu, Y. Wang, B. Chen, W. Qian, H. Meng, H. Tong, F. Chen, Q. Ma, W. Ni, S. Chen, J. Jin, High expression of Musashi-2 indicates poor prognosis in adult B-cell acute lymphoblastic leukemia, Leuk. Res. (2013). [10] F. Thol, C. Winschel, A.K. Sonntag, F. Damm, K. Wagner, A. Chaturvedi, G. Gohring, B. Schlegelberger, M. Lubbert, W. Fiedler, H. Kirchner, J. Krauter, A. Ganser, M. Heuser, Prognostic significance of expression levels of stem cell regulators MSI2 and NUMB in acute myeloid leukemia, Ann. Hematol. 92 (2013) 315–323. [11] J. Luo, Z.L. Deng, X. Luo, N. Tang, W.X. Song, J. Chen, K.A. Sharff, H.H. Luu, R.C. Haydon, K.W. Kinzler, B. Vogelstein, T.C. He, A protocol for rapid generation of recombinant adenoviruses using the AdEasy system, Nat. Protoc. 2 (2007) 1236–1247. [12] A.M. MacNicol, A. Wilczynska, M.C. MacNicol, Function and regulation of the mammalian Musashi mRNA translational regulator, Biochem. Soc. Trans. 36 (2008) 528–530. [13] A. Nakano, Y. Kanemura, K. Mori, E. Kodama, A. Yamamoto, H. Sakamoto, Y. Nakamura, H. Okano, M. Yamasaki, N. Arita, Expression of the Neural RNA-binding protein Musashi1 in pediatric brain tumors, Pediatr. Neurosurg. 43 (2007) 279–284. [14] S.M. Sureban, R. May, R.J. George, B.K. Dieckgraefe, H.L. McLeod, S. Ramalingam, K.S. Bishnupuri, G. Natarajan, S. Anant, C.W. Houchen, Knockdown of RNA binding protein musashi-1 leads to tumor regression in vivo, Gastroenterology 134 (2008) 1448–1458. [15] A.L. Moreira, M. Gonen, N. Rekhtman, R.J. Downey, Progenitor stem cell marker expression by pulmonary carcinomas, Mod. Pathol. 23 (2010) 889–895. [16] L. de Andres-Aguayo, F. Varas, T. Graf, Musashi 2 in hematopoiesis, Curr. Opin. Hematol. 19 (2012) 268–272. [17] L. de Andres-Aguayo, F. Varas, E.M. Kallin, J.F. Infante, W. Wurst, T. Floss, T. Graf, Musashi 2 is a regulator of the HSC compartment identified by a retroviral insertion screen and knockout mice, Blood 118 (2011) 554–564. [18] K.J. Hope, S. Cellot, S.B. Ting, T. MacRae, N. Mayotte, N.N. Iscove, G. Sauvageau, An RNAi screen identifies Msi2 and Prox1 as having opposite roles in the regulation of hematopoietic stem cell activity, Cell Stem Cell 7 (2010) 101–113. [19] J.A. McCubrey, L.S. Steelman, W.H. Chappell, S.L. Abrams, E.W. Wong, F. Chang, B. Lehmann, D.M. Terrian, M. Milella, A. Tafuri, F. Stivala, M. Libra, J. Basecke, C. Evangelisti,
E XP ER I ME NTAL C E LL RE S E ARCH
A.M. Martelli, R.A. Franklin, Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance, Biochim. Biophys. Acta 1773 (2007) 1263–1284. [20] F. Marampon, C. Ciccarelli, B.M. Zani, Down-regulation of c-Myc following MEK/ERK inhibition halts the expression of malignant phenotype in rhabdomyosarcoma and in non muscle-derived human tumors, Mol. Cancer (2006) 31.
3 2 0 ( 2 0 14 ) 119 – 1 2 7
127
[21] A.M. Martelli, C. Evangelisti, F. Chiarini, J.A. McCubrey, The phosphatidylinositol 3-kinase/Akt/mTOR signaling network as a therapeutic target in acute myelogenous leukemia patients, Oncotarget 1 (2010) 89–103. [22] M.G. Kharas, R. Okabe, J.J. Ganis, M. Gozo, T. Khandan, M. Paktinat, D.G. Gilliland, K. Gritsman, Constitutively active AKT depletes hematopoietic stem cells and induces leukemia in mice, Blood 115 (2010) 1406–1415.
3 2 0 ( 2 0 14 ) 119 – 1 2 7
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/yexcr
Research Article
Musashi2 modulates K562 leukemic cell proliferation and apoptosis involving the MAPK pathway Huijuan Zhang, Shi Tan, Juan Wang, Shana Chen, Jing Quan, Jingrong Xian, Shuai shuai Zhang, Jingang He, Ling Zhangn Key Laboratory of Laboratory Medical Diagnostics Designated by the Ministry of Education, College of Laboratory Medicine, Chongqing Medical University, 1#, Yixueyuan Road, Chongqing 400016, China
article information
abstract
Article Chronology:
The RNA-binding protein Musashi2 (Msi2) has been identified as a master regulator within a
Received 22 June 2013
variety of stem cell populations via the regulation of translational gene expression. A recent study
Received in revised form
has suggested that Msi2 is strongly expressed in leukemic cells of acute myeloid leukemia
15 September 2013
patients, and elevated Msi2 is associated with poor prognosis. However, the potential role of Msi2
Accepted 17 September 2013
in leukemogenesis is still not well understood. Here, we investigated the effect of Msi2
Available online 26 September 2013
knockdown on the biological properties of leukemic cells. High expression of Msi2 was found
Keywords: Musashi2 Leukemia K562 Proliferation Apoptosis MAPK
in K562 and KG-1a leukemic cell lines, and low expression was observed in the U937 cell line. We transduced K562 cells with two independent adenoviral shRNA vectors targeting Msi2 and confirmed knockdown of Msi2 at the mRNA and protein levels. Msi2 silencing inhibited cell growth and caused cell cycle arrest by increasing the expression of p21 and decreasing the expression of cyclin D1 and cdk2. In addition, knockdown of Msi2 promoted cellular apoptosis via the upregulation of Bax and downregulation of Bcl-2 expression. Furthermore, Msi2 knockdown resulted in the inactivation of the ERK/MAPK and p38/MAPK pathways, but no remarkable change in p-AKT was observed. These data provide evidence that Msi2 plays an important role in leukemogenesis involving the MAPK signaling pathway, which indicates that Msi2 may be a novel target for leukemia treatment. & 2013 Elsevier Inc. All rights reserved.
Introduction The Musashi (Msi) family consists of a group of RNA-binding proteins that can act as a translational repressor of target mRNAs [1]. Msi proteins affect asymmetric cell division, stem cell function and cell fate determination in various somatic tissues [2]. The Msi
family includes two Msi homologs, Msi1 and Msi2 [3]. Msi1 has been described as having pivotal functions in stem cell maintenance, nervous system development, and tumorigenesis [4]. In contrast, Msi2 is preferentially expressed in the hematopoietic system. Recent work has identified Msi2 as a master regulator of the hematopoietic stem cells (HSCs) and leukemic stem cells [5].
Abbreviations: Msi, Musashi; Msi2, Musashi2; HSCs, hematopoietic stem cells; AML, acute myeloid leukemia; CML, chronic myelogenous leukemia; MAPK, mitogen-activated protein kinase; MTT, methyl thiazolyl tetrazolium solution; FITC, fluorescein isothiocyanate n
Corresponding author. Fax: þ86 23 68485240. E-mail address: [email protected] (L. Zhang).
0014-4827/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.yexcr.2013.09.009
120
E X PE R IM ENTA L C ELL R E S EA RC H
In addition to demonstrating a central role in the maintenance of cell ‘stemness’, more recently, Msi2 has been shown to play an important role in hematopoietic malignancies. Increased expression of Msi2 at both the mRNA and protein levels, have been associated with a worse clinical prognosis in acute myeloid leukemia (AML) [6,7]. Similarly, upregulation of Msi2 has been demonstrated in blast crisis chronic myelogenous leukemia (CML) compared with the chronic phase and correlates with a higher risk of CML relapse [8]. In addition, high Msi2 expression indicates poor prognosis in adult B-cell acute lymphoblastic leukemia [9]. Although Msi2 has been regarded as a new prognostic biomarker in leukemia, no direct Msi2 targets have yet been described. Ito et al. [8] has reported that Msi2 expression suppresses Numb translation, allowing upregulation of Notch signaling and CML progression in a murine model. Nevertheless, data obtained from clinical analysis demonstrated that the correlation of Msi2 and Numb expression levels was not observed in a large and well-characterized cohort of AML patients, suggesting Msi2 might mediate its biological effects via several alternative signaling pathways [10]. However, a relevant mechanism of Msi2 in the context of AML remains unknown. To explore the potential roles of Msi2 in leukemia, we examined whether Msi2 affected the proliferation and apoptotic properties of the human leukemic cell line K562 in vitro using RNA interference. Furthermore, the potential molecular mechanisms modulated by Msi2 in leukemogenesis were explored. Our data demonstrated that Msi2 silencing inhibited leukemic cell growth and promoted apoptosis involving the mitogen-activated protein kinase (MAPK) signaling pathway.
Materials and methods Cell culture The 293A (Ad5 E1-transformed human embryo kidney cell line) cell line was cultured in Dulbecco's modified Eagle's medium and human leukemic cell lines containing KG-1a (AML M1), HL-60 (AML M2), OCI-AML3 (AML M4), THP-1(AML M5), U937 (AML M5) and K562 (blast phase CML) were maintained in RPMI 1640 medium with 10% FBS and incubated at 37 1C in a humidified incubator with 5% CO2. OCI-AML3 was kindly provided by The University of Texas MD Anderson Cancer Center, Houston, USA. Other cell lines were purchased from the Shanghai Institutes for Biological Science, China.
Construction of adenoviral vectors Two independent shRNA constructs (shMsi2-1 and shMsi2-2) were used to knockdown Msi2. The target sequences for Msi2
3 2 0 ( 2 0 14 ) 119 – 1 2 7
RNA interference were selected according to Kharas et al. [5]. The scramble sequence, which was used as a negative control, was obtained from GenScript software. The shMsi2 and scramble sequences used were the following: shMsi2-1: 5′-CCAGCAAGTGTAGATAAAGTA-3′; shMsi2-2: 5′-CCCAACTTCGT-GGCGACCTAT-3′; scramble: 5′–GTGCCCTCCTAGCCCTGTAAA-3′. The sequence was cloned into the pSES-HUS shuttle plasmid with a U6 and H1 double promoter-driven RFP expression cassette. After the plasmids were successfully sequenced, three plasmids were recombined with a backbone vector Adeasy-1 in BJ5183 bacteria.
Transfection and infection After digestion with PacI (Fermentas, CA), 1.2 μg of recombinant DNA was transfected into 293 A cells with 3 μl of Lipofectamine™ 2000 (Invitrogen, USA) in a 24-well plate. Adenovirus collection, amplification and titer detection were performed according to Luo et al. [11]. K562 cells were initially cultured in serum-free RPMI 1640 medium for 2 h, and then incubated with adenovirus and 4 μg/ml polybrene (Sigma, USA) for the final concentration. After absorption for 8 h, the serum-free medium was replaced with fresh medium containing 10% FBS.
Real-time PCR analysis Total RNA were extracted using the RNAiso Plus reagent (Takara, Japan) and then reverse-transcribed to cDNA according to the manufacturer's instructions. The transcribed cDNA was mixed with SYBRs Premix Ex Taq™ II reagent (Takara, Japan) and genespecific primers. The cDNA was amplified in the CFX48 system (Bio-Rad, USA) according to the manufacturer's instructions. The forward and reverse primers for each mRNA, and the length of each PCR product are listed in Table 1. For quantification, the samples were normalized against the expression of the actin gene transcript.
Western blotting analyses Cells were lysed on ice in lysis buffer and the cleared lysates were collected by centrifugation at 12,000g for 30 min at 4 1C. Protein concentrations were measured using the Bradford method. In this study, 100 μg of protein samples were separated using SDS-PAGE and transferred onto PVDF membranes. PVDF membranes were blocked with 5% non-fat dry milk for 2 h at room temperature and then incubated with primary antibody overnight at 4 1C. AntiMsi2 was purchased from Abcam (Cambridge, MA), and anti-p21 and anti-cyclin D1 were purchased from Biosynthesis Biotechnology
Table 1 – The sequence of PCR primers for each gene. Genes
Forward primer
Reverse primer
PCR fragment size (bp)
Actin Msi2 p21 Cyclin D1 cdk2 Bax Bcl-2
TAGTTGCGTTACACCCTTTCTTG GTTATCTGCGAACACAGTAGTG CCCGTGAGCGATGGAAC CCTGTCGCTGGAGCCCGTG AACAAGTTGACGGGAGAGGT GGATGCGTCCACCAAGAA TTGTGGCCTTCTTTGAGTTCG
TGCTGTCACCTTCACCGTTC ACCCTCTGTGCCTGTTGGTAG CCCGTGGGAAGGTAGAGC TCCGCCTCTGGCATTTTGG GAAGAGGAATGCCAGTGAGA GCACTCCCGCCACAAAGA CACCTACCCAGCCTCCGTTAT
156 110 110 252 238 386 153
E XP ER I ME NTAL C E LL RE S E ARCH
(Bioss, China). Anti-cdk2 and anti-c-fos were obtained from Immunoway Biotechnology Company (Immunoway, USA) and anti-β-actin, anti-Bax and anti-Bcl-2 were purchased from Santa Cruz Biotechnology (Santa Cruz, USA). Anti-c-myc, anti-ERK, antip-ERK, anti-p38, anti-p-p38, anti-MAPKAPK2, anti-p-MAPKAPK2, anti-AKT and anti-p-AKT were purchased from Bioworld Technology (Bioworld, USA). Membranes were washed with TBST (20 mM Tris–HCl, pH 7.6, 137 mM NaCl, 0.1% Tween 20) three times for 10 min each and then incubated with alkaline horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibody (ZSGB, China) for 1 h at room temperature. Protein bands were visualized by incubating the membranes in chemiluminescence HRP substrate (Millipore, USA). Quantification of protein expression was normalized against the expression of β-actin protein and phosphorylation of the protein was compared to the total protein.
Cell proliferation assay K562 cells were plated at 2 103 cells/well in a 96-well plate and maintained in 50 μl of RPMI 1640 serum-free medium. After 2 h, either scramble or shMsi2 adenovirus was added to the cells and RPMI 1640 medium with 20% FBS was supplemented to a final volume of 100 μl in each well. Next, 20 μl of 2.5 mg/ml methyl thiazolyl tetrazolium solution (MTT) (Sigma, USA) reagent was added to each well at 0, 1, 2, 3, 4 or 5 days after infection and the cells were further incubated for 4 h at 37 1C and 5% CO2. The MTT solution was then replaced with 150 μl DMSO (Sigma, USA), and the absorbance was measured at 490 nm on a microplate reader. The experiment was performed in triplicate.
Colony formation assay K562 cells infected with the scramble or shMsi2 adenovirus were inoculated in 0.9% methylcellulose (Sigma, USA) at 103 cells/well in a 24 well-plate. The number of colonies in each well was quantified under a microscope (Olympus, Japan) 7 days later. The experiment was performed in triplicate.
Flow cytometric analysis of cell cycle and apoptosis K562 cells were infected with the scramble or shMsi2 adenovirus for 72 h. Next, the cells were harvested and washed with PBS. For cell cycle detection, cells were fixed using 70% ice-cold ethanol and placed at 4 1C overnight. The cell pellet was then treated with
3 2 0 ( 2 0 14 ) 119 – 1 2 7
121
RNase and stained with propidium iodide. For apoptotic detection, the cells were suspended with 100 μl of binding buffer and incubated with fluorescein isothiocyanate (FITC)-conjugated Annexin V (BD Biosciences, CA). Both the cell cycle and apoptosis were analyzed using a FACSCalibur flow cytometer (BD Biosciences, CA).
Wright–Giemsa stain K562 cells infected with the scramble or shMsi2 adenovirus for 72 h were washed twice with PBS. The cell pellet was fixed on a clean slide and stained according to the manufacturer's instructions (KeyGen BioTECH, China). The morphology of cells was observed under a microscope (Olympus, Japan).
Statistics Statistical analysis for data obtained from different groups was performed using SPSS 17.0 Statistical software. The data were expressed as the mean7standard deviation (SD) (nZ3) and compared using one-way analysis of variance (ANOVA). po0.05 was considered statistically significant in different groups.
Results Expression of Msi2 in leukemic cell lines To analyze the Msi2 level in human leukemic cell lines, Msi2 protein expression was examined in five AML cell lines (KG-1a, HL-60, OCI-AML3, THP-1 and U937) and a blast crisis CML cell line (K562). Western blotting analyses showed high expression of Msi2 protein in KG-1a and K562 cells, and low expression in U937 and OCI-AML3 cells (Fig. 1).
Downregulation of Msi2 expression in K562 cells To identify whether Msi2 expression was reduced in K562 cells after infection with adenovirus expressing Msi2-shRNA, real-time PCR and Western blotting analyses were performed to detect the mRNA and protein expression levels of Msi2, respectively. The results indicated that the expression levels of Msi2 mRNA and protein in the shMsi2 group were decreased significantly compared to the scramble group (Fig. 2).
Fig. 1 – Levels of Msi2 protein expression in leukemic cell lines. (A) Western blotting analysis demonstrating Msi2 protein expression in KG-1a, HL-60, OCI-AML3, THP-1, U937 and K562 leukemic cell lines. (B) Msi2 protein levels were quantified using image software and normalized against β-actin. β-Actin was used as a loading control. *po0.05 versus other cell lines.
122
E X PE R IM ENTA L C ELL R E S EA RC H
3 2 0 ( 2 0 14 ) 119 – 1 2 7
Fig. 2 – Downregulation of Msi2 mRNA and protein levels in K562 cells. (A) Msi2 mRNA expression was examined in K562 cells after infection of adenovirus for 48 h using real-time PCR. (B) The protein expression of Msi2 was assayed after infection of adenovirus for 72 h using Western blotting analyses. Msi2 protein levels were quantified using image software and normalized against β-actin. β-Actin was used as a loading control. *po0.05 versus the scramble group.
Fig. 3 – Knockdown of Msi2 decreased K562 cell growth. (A) MTT assay for cell growth curves of K562 cells infected with the scramble or shMsi2 adenovirus. K562 cells were plated at a density of 2 103 cells/well. (B) The colonies of K562 cells infected with the scramble or shMsi2 adenovirus were quantified under a microscope (40 ). Colonies were grown in methylcellulose for 7 days. (C) Statistical analyses for the number of colonies in each group. *po0.05 versus the scramble group.
Knockdown of Msi2 inhibited K562 cell proliferation To examine whether Msi2 had an effect on K562 cell proliferation, MTT and colony formation assays were performed. As shown in Fig. 3A, the growth rate of K562 cells was attenuated in the shMsi2 group compared to the scramble group. Similarly, knockdown of Msi2 reduced the number of K562 cell colonies, which indicated that cell colony formation was impaired after Msi2 inhibition (Fig. 3B and C).
Knockdown of Msi2 caused cell cycle arrest in the G0/G1 phase To determine whether Msi2 affected the cell cycle of K562 cells, flow cytometry was employed to assay the cell cycle distribution. These results showed that Msi2-shRNA resulted in an increase of K562 cells in the G0/G1 phase and a decrease of cells in the S phase (Fig. 4A and B). Moreover, we detected the mRNA and protein levels of the cell cycle regulators p21, cyclin D1 and cdk2.
E XP ER I ME NTAL C E LL RE S E ARCH
3 2 0 ( 2 0 14 ) 119 – 1 2 7
123
Fig. 4 – Knockdown of Msi2 affected the cell cycle of K562 cells. (A) Cell cycle analysis showed that Msi2 knockdown increased the number of K562 cells in the G0/G1 phase and decreased the number of cells in the S phase. (B) The percentages of living cells in G0/G1, S and G2/M phases of the cell cycle are indicated. (C, E and G) The mRNA expression of cell cycle regulators, p21, cyclin D1 and cdk2 was analyzed using real-time PCR. (D, F and H) p21, cyclin D1 and cdk2 protein expression was examined using Western blotting analyses. The protein levels were quantified using image software and normalized to β-actin. β-Actin was used as a loading control. *po0.05 versus the scramble group.
124
E X PE R IM ENTA L C ELL R E S EA RC H
Real-time PCR and Western blotting analyses indicated that Msi2 silencing increased p21, but significantly inhibited cyclin D1 and cdk2 expression at both the mRNA and protein levels compared to the scramble group (Fig. 4C–H).
Knockdown of Msi2 induced K562 cell apoptosis To explore whether and how Msi2 regulated apoptosis in K562 cells, the early apoptosis of K562 cells was examined using Annexin V-FITC staining followed by flow cytometry. The percentage of K562 cells in early apoptosis was increased in the Msi2-2 group (15.1472.32%) compared to the scramble group (4.5971.21%) (Fig. 5A). In addition, the Wright–Giemsa stain revealed characterized features of late apoptosis, including nuclear condensation and apoptotic small bodies in the shMsi2-2 group (Fig. 5B). We further found that the levels of pro-apoptotic factor Bax were increased and the levels of antiapoptotic factor Bcl-2 were decreased significantly in the shMsi2-2 group compared to the scramble group (Fig. 5C and D).
Knockdown of Msi2 inactivated the MAPK pathway To further define the molecular mechanisms modulated by Msi2 in the growth and apoptosis of K562 cells, activation of the MAPK signaling pathway and AKT were examined. Knockdown of Msi2 resulted in the inactivation of the ERK/MAPK pathway with decreases in the phosphorylation of ERK and the expression of its downstream targets, c-myc and c-fos (Fig. 6A). Similarly, the phosphorylation of both p38 and its downstream target MAPKAPK2
3 2 0 ( 2 0 14 ) 119 – 1 2 7
were also decreased after Msi2 silencing (Fig. 6B). However, no change in p-AKT was detected after knockdown of Msi2 (Fig. 6C).
Discussion The RNA-binding protein Msi exhibits translational control via a sequence-specific interaction with the 3′ UTR of target mRNAs within a variety of stem cell populations [12]. Several recent reports have linked Msi family members to the pathogenesis of solid tumors [13–15]. Most recently, Msi2 has emerged as a significant indicator of myeloid leukemia, where upregulation of Msi2 was linked to rapid progression and poor prognosis [16]. However, the specific biological effects and the relevant mechanism mediated by Msi2 in leukemia remain poorly understood. Here, we observed that knockdown of Msi2 inhibited leukemic cell proliferation and induced apoptosis in vitro involving the MAPK pathway. In this study, we first observed Msi2 expression in six myeloid leukemic cell lines. Msi2 was highly expressed in both the AML and CML cell lines. Among the five AML cell lines, high Msi2 levels were found in KG-1a (FAB M1), whereas low Msi2 levels were detected in the U937 (FAB M5) cell line. These results were consistent with the report that patients with high Msi2 expression were more often classified as FAB M1 and less likely as FAB M5, compared to patients with low Msi2 expression [10]. To investigate the functional role of increased Msi2 expression in leukemic cells, we transduced the CML cell line K562 with adenoviral shRNA vectors targeting Msi2. K562 cell was selected as a cellular model due to its high expression of
Fig. 5 – Knockdown of Msi2 induced K562 cell apoptosis. (A) K562 cells infected with the scramble or shMsi2-2 adenovirus were stained with Annexin V-FITC prior to flow cytometry. (B) Morphological feature of apoptosis was examined using the Wright– Giemsa stain. K562 cells infected with the shMsi2-2 adenovirus displayed typical features of late apoptosis, which consisted of nuclear condensation and apoptotic bodies. Black arrows indicate the apoptotic cells. (C and D) The expression of Bax and Bcl2 mRNA and protein was examined using real-time PCR and Western blotting analyses, respectively. Bax and Bcl-2 protein levels were quantified using image software and normalized against β-actin. β-Actin was used as a loading control. *po0.05 versus the scramble group.
E XP ER I ME NTAL C E LL RE S E ARCH
3 2 0 ( 2 0 14 ) 119 – 1 2 7
125
Fig. 6 – Knockdown of Msi2 inhibited the MAPK signaling pathway. K562 cells were infected with the scramble or shMsi2 adenovirus for 72 h. (A) The ERK/MAPK pathway and its downstream target proteins were detected by Western blotting analyses. (B) The p38/MAPK pathway and its downstream target proteins were also detected using Western blotting analyses. (C) p-AKT and total AKT expression were examined using Western blotting analyses. All the phosphorylated proteins were quantified using image software and normalized against total proteins. The c-myc and c-fos protein levels were quantified using Image software and normalized against β-actin. β-actin was used as a loading control. npo0.05 versus the scramble group.
Msi2. Successful inhibition of Msi2 expression was observed in K562 cells as demonstrated by decreases of Msi2 mRNA and protein. We found that Msi2 knockdown suppressed K562 cell growth, which resulted in a decreased cell growth rate and a reduction in the number of colonies. Consistent with our results, Msi2 silencing resulted in a decrease in proliferation in the AML cell lines, NOMO-1 and THP-1, and the blast crisis CML cell lines, AR230 and LAMA-84 [5]. Currently, it is unclear why knockdown of Msi2
reduces the growth of leukemic cells. Our data herein demonstrated that downregulation of Msi2 suppressed the cell cycle transition from G0/G1 to S phase by increasing the expression of p21 and decreasing cyclin D1 and cdk2 expression. Similarly, knockdown of Msi2 significantly decreased murine HSCs in the S-G2/M phase by regulating p21, cyclin D1 and ckd2 expression [17,18]. It has been proposed that as a cell fate determinant, Msi2 promoted cell cycle progression in normal and malignant hematopoiesis. We also
126
E X PE R IM ENTA L C ELL R E S EA RC H
observed that knockdown of Msi2 increased the percentage of early apoptotic cells as demonstrated by Annexin V-FITC staining and late apoptotic cells as evidenced by morphological detection. These findings were consistent with the observation that knockdown of Msi2 using lentiviral shRNA vectors caused a marked induction of apoptosis in leukemic cell lines [5]. Moreover, Bax and Bcl-2 are important pro-apoptotic and anti-apoptotic factors, respectively. In this study, we found increased expression of Bax, whereas Bcl-2 was decreased significantly after Msi2 silencing. However, further studies will be needed to verify whether Msi2 affects the expression of other important genes. The MAPK pathway coordinately regulates diverse cellular programs, such as proliferation, apoptosis and differentiation. In this study, we showed that Msi2 knockdown resulted in remarkable decreases in the expression of p-ERK, c-myc and c-fos in the ERK/MAPK pathway. Activation of ERK indirectly allowed Bcl-2 to form homodimers to produce an anti-apoptotic effect [19]. As an important oncogene, c-myc enhanced cdk2, but suppressed p21 expression to subsequently promote cell proliferation [20]. In addition, our results demonstrated that Msi2 knockdown blocked the phosphorylation of p38 and its downstream target protein MAPKAPK2. Although previous studies have reported that gene targets activated by several pathways (i.e. MAPK, Wnt and Myc) were suppressed using bioinformatic analysis of Msi2 shRNA microarray data [5], to the best of our knowledge, this is the first experimental identification that the MAPK pathway is involved in Msi2-mediated leukemogenesis. In addition to the MAPK pathway, the PI3K/AKT pathway also plays a central role in leukemic cell proliferation, growth and survival [21]. Enhanced AKT activation is an important mechanism of the transformation in AML [22]. However, we found that Msi2 silencing exhibited no remarkable effect on the phosphorylation of AKT. Thus, it is essential to further determine the functional role of the PI3K/AKT pathway in Msi2mediated leukemogenesis. In summary, our data demonstrated that Msi2 knockdown inhibited leukemic cell proliferation and promoted cell apoptosis involving the MAPK signaling pathway. This study provides novel insight into the mechanisms of leukemogenesis. We propose future studies specifically targeting Msi2 as a therapeutic option for diagnosis and treatment response.
Conflict of interests The authors have declared that no conflict of interest exists.
Acknowledgments This project was supported by a grant obtained from the National Natural Science Foundation of China (No. 81271913).
references [1] H. Okano, T. Imai, M. Okabe, Musashi: a translational regulator of cell fate, J. Cell Sci. 115 (2002) 1355–1359. [2] H. Okano, H. Kawahara, M. Toriya, K. Nakao, S. Shibata, T. Imai, Function of RNA-binding protein Musashi-1 in stem cells, Exp. Cell. Res. 306 (2005) 349–356.
3 2 0 ( 2 0 14 ) 119 – 1 2 7
[3] S. Sakakibara, Y. Nakamura, H. Satoh, H. Okano, Rna-binding protein Musashi2: developmentally regulated expression in neural precursor cells and subpopulations of neurons in mammalian CNS, J. Neurosci. 21 (2001) 8091–8107. [4] J.M. Sutherland, E.A. McLaughlin, G.R. Hime, N.A. Siddall, The musashi family of RNA binding proteins: master regulators of multiple stem cell populations, Adv. Exp. Med. Biol. 786 (2013) 233–245. [5] M.G. Kharas, C.J. Lengner, F. Al-Shahrour, L. Bullinger, B. Ball, S. Zaidi, K. Morgan, W. Tam, M. Paktinat, R. Okabe, M. Gozo, W. Einhorn, S.W. Lane, C. Scholl, S. Frohling, M. Fleming, B.L. Ebert, D.G. Gilliland, R. Jaenisch, G.Q. Daley, Musashi-2 regulates normal hematopoiesis and promotes aggressive myeloid leukemia, Nat. Med. 16 (2010) 903–908. [6] L. Bullinger, K. Dohner, E. Bair, S. Frohling, R.F. Schlenk, R. Tibshirani, H. Dohner, J.R. Pollack, Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia, N. Engl. J. Med. 350 (2004) 1605–1616. [7] R.J. Byers, T. Currie, E. Tholouli, S.J. Rodig, J.L. Kutok, MSI2 protein expression predicts unfavorable outcome in acute myeloid leukemia, Blood 118 (2011) 2857–2867. [8] T. Ito, H.Y. Kwon, B. Zimdahl, K.L. Congdon, J. Blum, W.E. Lento, C. Zhao, A. Lagoo, G. Gerrard, L. Foroni, J. Goldman, H. Goh, S.H. Kim, D.W. Kim, C. Chuah, V.G. Oehler, J.P. Radich, C.T. Jordan, T. Reya, Regulation of myeloid leukaemia by the cell-fate determinant Musashi, Nature 466 (2010) 765–768. [9] Q. Mu, Y. Wang, B. Chen, W. Qian, H. Meng, H. Tong, F. Chen, Q. Ma, W. Ni, S. Chen, J. Jin, High expression of Musashi-2 indicates poor prognosis in adult B-cell acute lymphoblastic leukemia, Leuk. Res. (2013). [10] F. Thol, C. Winschel, A.K. Sonntag, F. Damm, K. Wagner, A. Chaturvedi, G. Gohring, B. Schlegelberger, M. Lubbert, W. Fiedler, H. Kirchner, J. Krauter, A. Ganser, M. Heuser, Prognostic significance of expression levels of stem cell regulators MSI2 and NUMB in acute myeloid leukemia, Ann. Hematol. 92 (2013) 315–323. [11] J. Luo, Z.L. Deng, X. Luo, N. Tang, W.X. Song, J. Chen, K.A. Sharff, H.H. Luu, R.C. Haydon, K.W. Kinzler, B. Vogelstein, T.C. He, A protocol for rapid generation of recombinant adenoviruses using the AdEasy system, Nat. Protoc. 2 (2007) 1236–1247. [12] A.M. MacNicol, A. Wilczynska, M.C. MacNicol, Function and regulation of the mammalian Musashi mRNA translational regulator, Biochem. Soc. Trans. 36 (2008) 528–530. [13] A. Nakano, Y. Kanemura, K. Mori, E. Kodama, A. Yamamoto, H. Sakamoto, Y. Nakamura, H. Okano, M. Yamasaki, N. Arita, Expression of the Neural RNA-binding protein Musashi1 in pediatric brain tumors, Pediatr. Neurosurg. 43 (2007) 279–284. [14] S.M. Sureban, R. May, R.J. George, B.K. Dieckgraefe, H.L. McLeod, S. Ramalingam, K.S. Bishnupuri, G. Natarajan, S. Anant, C.W. Houchen, Knockdown of RNA binding protein musashi-1 leads to tumor regression in vivo, Gastroenterology 134 (2008) 1448–1458. [15] A.L. Moreira, M. Gonen, N. Rekhtman, R.J. Downey, Progenitor stem cell marker expression by pulmonary carcinomas, Mod. Pathol. 23 (2010) 889–895. [16] L. de Andres-Aguayo, F. Varas, T. Graf, Musashi 2 in hematopoiesis, Curr. Opin. Hematol. 19 (2012) 268–272. [17] L. de Andres-Aguayo, F. Varas, E.M. Kallin, J.F. Infante, W. Wurst, T. Floss, T. Graf, Musashi 2 is a regulator of the HSC compartment identified by a retroviral insertion screen and knockout mice, Blood 118 (2011) 554–564. [18] K.J. Hope, S. Cellot, S.B. Ting, T. MacRae, N. Mayotte, N.N. Iscove, G. Sauvageau, An RNAi screen identifies Msi2 and Prox1 as having opposite roles in the regulation of hematopoietic stem cell activity, Cell Stem Cell 7 (2010) 101–113. [19] J.A. McCubrey, L.S. Steelman, W.H. Chappell, S.L. Abrams, E.W. Wong, F. Chang, B. Lehmann, D.M. Terrian, M. Milella, A. Tafuri, F. Stivala, M. Libra, J. Basecke, C. Evangelisti,
E XP ER I ME NTAL C E LL RE S E ARCH
A.M. Martelli, R.A. Franklin, Roles of the Raf/MEK/ERK pathway in cell growth, malignant transformation and drug resistance, Biochim. Biophys. Acta 1773 (2007) 1263–1284. [20] F. Marampon, C. Ciccarelli, B.M. Zani, Down-regulation of c-Myc following MEK/ERK inhibition halts the expression of malignant phenotype in rhabdomyosarcoma and in non muscle-derived human tumors, Mol. Cancer (2006) 31.
3 2 0 ( 2 0 14 ) 119 – 1 2 7
127
[21] A.M. Martelli, C. Evangelisti, F. Chiarini, J.A. McCubrey, The phosphatidylinositol 3-kinase/Akt/mTOR signaling network as a therapeutic target in acute myelogenous leukemia patients, Oncotarget 1 (2010) 89–103. [22] M.G. Kharas, R. Okabe, J.J. Ganis, M. Gozo, T. Khandan, M. Paktinat, D.G. Gilliland, K. Gritsman, Constitutively active AKT depletes hematopoietic stem cells and induces leukemia in mice, Blood 115 (2010) 1406–1415.