- Email: [email protected]
Mutation of a conserved tryptophan residue in the CBM3c of a GH9 endoglucanase inhibits activity
International Journal of Biological Macromolecules 92 (2016) 159–166
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Mutation of a conserved tryptophan residue in the CBM3c of a GH9 endoglucanase inhibits activity Su-Jung Kim a , So Hyeong Kim a , Sang Kyu Shin a , Jeong Eun Hyeon b , Sung Ok Han a,b,∗ a b
Department of Biotechnology, Korea University, Seoul 02841, Republic of Korea Institute of Life Science and Natural Resources, Korea University, Seoul 02841, Republic of Korea
a r t i c l e
i n f o
Article history: Received 2 May 2016 Received in revised form 29 June 2016 Accepted 29 June 2016 Available online 29 June 2016 Keywords: Cellulose binding module 3c Family 9 endoglucanase CD and CBM interaction Initial cellulolytic reaction Catalytic base Disulfide bond
a b s t r a c t The presence of the family of 3c cellulose binding module (CBM3c) is important for the catalytic activity of family 9 endoglucanases such as the EngZ from Clostridium cellulovorans. To determine the role of CBM3c in catalytic activity, we made a tryptophan to alanine substitution because tryptophan can bind strongly to both substrates and other amino acids. The conserved tryptophan substitution (W483A) did not influence substrate binding, but it reduced enzyme activity to 10–14% on both amorphous and crystalline cellulose. CBM3c is directly involved in the endoglucanase reaction independent of substrate binding. EngZ W483A was also inactivated independent of substrate concentrations. Specially, EngZ W483A restored its catalytic base activity (31.6 ± 1.2 U/nM) which is similar to the wild-type (29.4 ± 0.3 U/nM) on Avicel in the presence of 50 mM sodium azide which is instead of catalytic base reaction. These results suggest that CBM3c is deeply involved in the cellulolytic reaction, specifically at the catalytic base region. Moreover, EngZ W483A was also easily denatured by DTT, an outer disulfide bond breaker, compared to the wildtype. CBM3c could influence the surface stability. These features of CBM3c result from the hydrophobic interaction of tryptophan with the catalytic domain that is unrelated to substrate binding. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Cellulose is a major energy source for lignocellulosic biomass conversion, but its conversion is very difficult due to its -1,4 linkages [1]. Cellulases can cleavage the -1, 4 linkages. Cellulase is classified as an endoglucanase and an exoglucanase based on its cleavage site. Among them, endoglucanases degrade randomly soluble cellulose through binding of the active cleft to cellulose and then producing small polymers of various sizes [2]. Endoglucanase has several types of helper modules such as the cellulose binding module (CBM) and the immunoglobulin (Ig)-like domain. In general, the CBM is an important factor in the catalytic activity of cellulase through its strong binding with cellulose. Family 9 endoglucanases have different specific catalytic activities depending on the CBM type [3]. The classification of the CBMs is defined by their binding mechanism to appropriate substrate. For example, family 9 endoglucanases containing CBM3 that down-stream of the catalytic domain (CD), such as Cel9A and EngZ, have a pro-
∗ Corresponding author at: Department of Biotechnology, Korea University, Seoul 02841, Republic of Korea. E-mail addresses: [email protected], [email protected] (S.O. Han). http://dx.doi.org/10.1016/j.ijbiomac.2016.06.091 0141-8130/© 2016 Elsevier B.V. All rights reserved.
cessive activity [4,5]. Their CBM3 belongs to the type A group that binds to the flat surface of crystalline cellulose, which causes Cel9A and EngZ to have a processive reaction that hydrolyzes both amorphous and crystalline cellulose. Family 9 endoglucanases containing CBM3 perform their enzyme reactions in accordance with an inverting mechanism. An inverting mechanism [6] is defined by a cleavage by nucleus residues and acid/base donor residues that work together using the carboxylate group of the acid/base donor. Therefore, the function of the acid/base donor is important in the processive catalytic activity of family 9 endoglucanases. CBM3 is also divided into three types, and the a and b types are classified by their different binding affinity for their substrate [7]. However, CBM3c plays a role in the interaction with CD [8], and CBM3c is an essential domain for its catalytic activity [9]. In addition, CBM3c has been co-crystallized with its corresponding family 9 CD [10]. This means that CBM3c is an essential module for the CD in spontaneous activity. Although CBM3c is definitely involved in the initiation of catalytic activity and thermostability through its interaction with the CD [8,11], the mechanism underlying actions of CBM3c is not yet clear. Some aromatic residues play an important role in the interaction between the CBM and the substrate. In some cases, the tryptophan residues of the CBM played important roles in CBM
160
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
binding, thermostability and protein–protein interactions [12–14]. The tryptophan residues in the CBM, which are located on the surface or in central binding sites, have a higher affinity to sugar ring by van der Waals interaction than the other aromatic residues, forming a hydrogen bond between the CBM and the polysaccharide through an indole nitrogen group from the tryptophan, resulting in stabilization of the structure [15,16]. In addition, the tryptophan residues that are located on the active site also play a role in the initiation of substrate recognition in exoglucanase [17]. Tryptophan-tryptophan interactions can lead to protein–protein interactions or to the maintenance of the active form. Hence, we selected the tryptophan residues on CBM3c as the substitution target residues to determine the function of CBM3c in catalytic activity. In this study, we used site-directed mutagenesis by replacing tryptophan with alanine on CBM3c in the EngZ from Clostridium cellulovorans. Because the EngZ has two tryptophans on its CBM3c and processive activity, we can therefore compare between the tryptophan that is conserved with other family 9 endoglucanases and the other tryptophan using different substrates. To determine the influence of the reduced hydrophobic interaction of CBM3c on catalytic activity, we investigated both the binding affinity and the catalytic activity using various substrates. 2. Materials and methods 2.1. Strains and plasmids synthesis Clostridium cellulovorans ATCC 35296 was cultured under anaerobic conditions (N2 -CO2 ratio as 80:20) at 37 ◦ C according to sleet’s protocol with 1% (w/v) Avicel [18] to obtain genomic DNA. The Escherichia coli DH5␣ (DE3, Stratagene, USA) and BL21 (DE3, Stratagene, USA) were used as host cells for plasmid cloning and the expression of proteins. The EngZ (NCBI Reference sequence: WP 010076628.1) and the truncated CBM3c gene were synthesized by polymerase chain reaction (PCR) amplification from the genomic DNA of C. cellulovorans using the following primers: EngZ-f, 5 -CCGGAATTCAACTACGGGGAAGCA-3 (restriction site; EcoRI) and EngZ-r, 5 -ACGCTCGAGGGTTCACCTACCCAT-3 (restriction site, XhoI) for EngZ and two primers of EngZ-f and ZCDr, 5 -GCCCTCGAGGTATTTGTCGTACAT-3 (restriction site, XhoI) for EngZ CD, respectively. The PCR product was inserted into the pET22b (+) (Novagen, USA) vector and then transformed into DH5␣ cells for sequence confirmation and into BL21 cells for protein expression. The recombinant plasmids were used as a template for mutagenesis.
at −20 ◦ C for 1 h. The concentrated product was transformed into E. coli DH5␣ (DE3) cells. The plasmids were then isolated as individual colonies and were sequenced to confirm the altered site. The plasmid with the correct mutation was transformed into E. coli BL21 (DE3) cells for protein expression. After the site directed mutagenesis, the mutant plasmids were cut with the restriction enzyme BamHI at 30 ◦ C for 2 h and then ligated with the T4 ligase at 16 ◦ C for 2 h to obtain only CBM3c genes. All of the plasmid vectors were transformed into E. coli DH5␣ (DE3) cells. The plasmids were then isolated as individual colonies and were sequenced to confirm the proper identity of the construct. The plasmid with the correct mutation was transformed into E. coli BL21 (DE3) cells for protein expression. 2.3. Protein expression and purification E. coli BL21(DE3) cells harboring the plasmids containing the wild-type gene or its mutants was grown in LB-ampicillin medium (10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, and 50 mg of ampicillin in 1 L medium) to produce the fusion proteins. The wildtype and mutant strains were cultivated at 37 ◦ C until they reached an OD600 value over 1.4. Then, the induction was carried out by adding 0.5 mM Isopropylthio--d-galactoside (IPTG) at 20 ◦ C for 20 h. The harvested cells were suspended in lysis buffer (50 mM sodium phosphate buffer, pH 8 containing 10 mM imidazole and 400 mM NaCl) and then the mixture was homogenized by sonication on ice. The cell debris was removed by centrifugation for 20 min at 4000 rpm and the supernatant was loaded onto the QIA express Ni-NTA protein purification system (Qiagen, CA) according to the manufacturer’s protocols. The purified proteins were determined by SDS-PAGE and enzyme activity. The protein yields were measured using the Bradford reagent (Bio-Rad, USA). 2.4. Sequence analysis and homology modeling of the EngZ The EngZ structure was modeled based on the structure of the closely related Cel9A (NCBI Reference sequence: WP 011292599.1) [20] and Cel9 G (Accession number: P37700) [21]. Cel9A from Thermobifida fusca and Cel9 G from Clostridium cellulolyticum have 58% and 63% amino acids sequence identity, respectively. The Protein Data Bank Accession [PDB: 4TF4 for Cel9A, 1G87 for Cel9G] was used as a template for homology modeling and the three-dimensional model of EngZ was generated using SWISS-MODEL via the ExPASy sever. 2.5. Enzyme activity
2.2. Site-directed mutagenesis The mutagenesis assay was performed as described in Zhou’s paper [19]. Two oligonucleotide primers containing the target site (under-lined) for each mutation were designed as follows: W483A Forward; CGTAATCAAACTGGTGCACCAGCAAGAGGTAGT W483A Reverse; ACTACCTCTTGCTGGTGCACCAGTTTGATTACG W529A Forward; CTTTCTGGGCTTATACCTGCAGATGTTGATAAAAACATATAC W529A Reverse; GTATATGTTTTTATCAACATCTGCAGGTATAAGCCCAGAAAG The assays were carried out by PCR amplification under the following conditions. The PCR was initiated by the addition of Pfu polymerase (ELPIS, USA) and the cycling parameters were: one cycle at 95 ◦ C for 2 min; 18 cycles of 95 ◦ C for 60 s, 60 ◦ C for 50 s and 74 ◦ C for 8 min; and a final step at 74 ◦ C for 7 min. The sample (25 L) was then incubated with 10 units of DpnI (Takara, Japan) for 3 h at 37 ◦ C to remove the methylated parental template. The enzyme treated sample was concentrated by ethanol precipitation
All mutant endoglucanases and EngZ CD were incubated with 1% (w/v) substrates at 40 ◦ C for 30 min, in 50 mM sodium acetate buffer (pH 7). The cellulolytic substrates were carboxymethyl cellulose (CMC), -glucan and Avicel. The amount of reducing sugars released from the substrate was determined with the 3, 5dinitrosalicylic acid (DNS) reagent as described by Miller et al. [22]. One unit of activity was defined as the amount of enzyme releasing 1 mol of glucose equivalent per min. 2.6. Binding assay The wild-type EngZ and the tryptophan substituted EngZ were prepared by suspension in Tris·HCl buffer (pH 7), and then the samples (each 500 nmol) were directly loaded on NATIVE-PAGE (8% polyacrylamide gel, containing 0.3% (w/v) CMC) for an amorphous substrate binding assay. To determine the insoluble substrate binding affinity, the prepared enzyme samples (each 2 mol) were added into 5 g/100 mL Avicel in a total volume 0.25 mL and the
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
161
Fig. 1. The sequence alignment of CBM3c of EngZ with other family 9 endoglucanases. Comparison of the amino acids residues of Cel9I from Clostridium thermocellum, Cel9A from Thermobifida fusca, Cel9G from Clostridium cellulolyticum and EngZ from Clostridium cellulovorans was carried out in (A). * are the putative altered residues. The gray box represents the conserved residues. (B) Homology modeling of EngZ was formed by SWISSMODEL from the amino acids sequences. The modeling templates were Cel9A (PDB ID; 4TF4) and Cel9G (PDB ID; 1G87). The conserved tryptophan (W483) was indicated by the red color on each structure model.
tubes were shaken at 4 ◦ C for 2 h. The suspended samples were centrifuged at 13,000 rpm for 5 min and the liquid fraction (0.25 mL) was transferred into new E-tubes. The protein concentrations of the unbound fraction were calculated from the absorbance measurement at 595 nm by UV spectrophotometer with the Bradford
reagent (Bio-Rad, USA). The bound protein concentration (mol/g of substrate) was calculated from the concentration of total protein minus the free protein [14]. The relative equilibrium association constant Ka (L/mol) was calculated according to the method of Gilkes et al. [23].
162
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
Table 1 Enzyme activity of the truncated CBM3c of EngZ.
EngZ EngZ CD
Specific activity (U/nM) CMCase
-glucan hydrolase
Avicelase
34.1 ± 4.9 4.8 ± 3.8
75.7 ± 3.9 10.2 ± 6.5
23.7 ± 6.3 2.4 ± 3.4
2.7. Azide rescue activity assay To further confirm that EngZ W483A is influenced to the catalytic base or to an important residue in the catalytic site, we tested the rescue activity of the mutant in the presence of azide [24]. For this test, activity assays were carried out as described above except for the addition of the indicated amount of sodium azide. The sodium azide concentrations used were 50 mM and 150 mM. 2.8. Differential scanning fluorimetry analysis in the presence of DTT To confirm the surface stability, we tested the degree of denaturation at elevated temperatures by using a denaturant (dithio-threitol, DTT) that only break down the outer disulfide bond. The differential scanning fluorimetry (DSF) assay was carried out according to previous reports to determine the hydrophobic intensity at elevated temperatures by using a hydrophobic fluorescent indicator, SYPRO Orange [25]. The DSF experiments were performed using an RT (real time)-PCR strip (Bio-Rad, USA). EngZ wild-type and mutant enzymes were used at a final concentration of 0.1 mg/ml in 50 mM sodium acetate buffer, pH 7. The 5000 × SYPRO Orange dye (SIGMA, USA) was used at a final concentration of 2.5× in each well. The fluorescence units were measured in the absence and the presence of 20 mM DTT and 100 mM DTT. The total reaction mixture was 30 L. The fluorescence intensities were monitored using an Mx3005 RT-PCR instrument (Stratagene, USA) with the FAM (6-carboxyfluorescein; 492 nm) and ROX (carboxy-X-rhodamine; 610 nm) filters for excitation and emission, respectively. The samples were heated from 25 ◦ C to 95 ◦ C at a scan rate of 1 ◦ C per minute. The relative fluorescence emission intensities were plotted against temperature (◦ C). 3. Results 3.1. Reduced enzyme reaction by removal of CBM3c in EngZ The EngZ is a glycoside hydrolase 9 (GH 9) endoglucanase and was discovered by our lab [4]. The EngZ has an activity of approximately 7 U/mg on CMC and can hydrolyze crystalline cellulose, thus, it has a high affinity for crystalline cellulose compared to other endoglucanases. The EngZ has a CBM3c such as Cel9A and EngH. These GH9 endoglucanases containing CBM3c were lost their activity until 58% for Cel9A and non-detected reaction for EngH when removed CBM3c [9,26]. The EngZ dramatically reduced its activity when CBM3c was removed to 4.8, 10.2 and 2.4 U/nM on CMC, -glucan and Avicel, respectively (Table 1). The reduced activities were 14%, 13% and 10% relative activities on CMC, -glucan and Avicel compared to the wild-type. These results indicate that CBM3c is important to maintain the catalytic activities of the EngZ on both amorphous and crystalline cellulose. 3.2. Reduced enzyme activity of the conserved tryptophan substituted EngZ To determine the role of CBM3c in catalytic activity, we searched some amino acids, and we found that some aromatic
Specif ic activity (U/nM)
Enzyme
80
60
40
20
0
CMC
β-glucan
Avicel
Fig. 2. Screening of the tryptophan substituted recombinant EngZ for its enzyme reaction. The enzyme reaction was performed with 1% (w/v) substrate and the detection was carried out by measuring the absorbance at 540 nm after the addition of 1% (w/v) DNS solution and boiling. The enzyme activity of the wild type (black), W483A (white) and W529A (gray) were determined by comparison of the U/nM of the enzyme solution. All of the data were presented from three experiments.
residues were important in both the ligand binding and stability of CBM [14,27]. According to these previous reports, tryptophan was the most important for maintaining those features. Hence, we selected the tryptophan residues on CBM3c as the target residues for site-directed mutagenesis. We also aligned the sequence with other CBM3c of the GH9endoglucanases, including Cel9I from Clostridium thermocellum (NCBI accession number: WP 003520969.1), Cel9A from Thermobifida fusca (NCBI Reference sequence: WP 011292599.1) and Cel9G from Clostridium cellulolyticum (Accession number: P37700) (Fig. 1A). These sequences have amino acid sequence identities as high as 56% for Cel9I, 58% for Cel9A and 63% for Cel9G with EngZ. The ranges of CBM3c are 461–541 residues for EngZ, 442–528 residues for Cel9I, 459–538 residues for Cel9A and 455–532 residues for Cel9G, respectively. The EngZ has two tryptophan residues, W483 and W529 on CBM3c and W483 is a conserved residue with Cel9I (W505), Cel9A (W489) and Cel9G (W485) (Fig. 1A). In addition, W483 is located close to the CD surface (Fig. 1B) as determined by computational 3D structure alignment with Cel9A (protein data bank, PDB number: 4TF4) [20] and Cel9 G (PDB number: 1G87) [21]. These results indicate that the CD maybe influenced by W483. To determine the function of the tryptophan, we altered the residue from tryptophan to alanine. The catalytic activity of the recombinants of W483A and W529A were compared to the wildtype. The results showed that the W483A recombinant enzyme had its activity reduced to 2.7 ± 3.4, 10.3 ± 7.5 and 2.8 ± 4.4 U/nM on CMC, -glucan and Avicel, respectively (Fig. 2). The reducing ratios (8% to 16%) of the W483A recombinant enzyme were similar to the reduction ratios (10%–14%) of EngZ CD. The W483A recombinant enzyme showed similar reduction ratios against both of the soluble and insoluble substrates. These indicate that the W483A recombinant enzyme was influenced the enzyme reaction but, was not influenced the processivity. The W529A recombinant enzyme activity only showed a slight reduction on the amorphous cellulose (62%) compared to the W483A recombinant. These results confirmed that W483 is important for the catalytic activity of the CD and could influence the CD function or stability. It might be due to the location of W483, which is closer to the CD than W529. The W529 was located in the opposite region than the CD and that is not a conserved residue with other GH9 endoglucanases containing CBM3c. In the next experiment, we aimed to confirm the function
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
163
Table 2 Binding affinity of EngZ and W483A recombinant on Avicel. Enzyme
Total protein (mol)
Free enzyme (mol)
Ka a (L/mol)
EngZ W483A W529A
2.09 ± 0.19 2.29 ± 0.11 2.29 ± 0.12
1.28 ± 0.05 1.35 ± 0.01 1.37 ± 0.01
0.51 ± 0.07 0.51 ± 0.01 0.50 ± 0.04
[N] is calculated from follow equilibrium; [N] = [N0-B], [N0] is an initiate accessible ligand molecules per gram of cellulose. a Ka is a relative equilibrium association constant and calculated from follow equilibrium, Ka = [B]/[N][F], [B] is bound molecues of enzymes per gram of cellulose, [N] is accessible ligand molecules of enzymes per gram of cellulose and [F] is free enzyme molecules.
nificantly different compared to the wild-type. This means that the tryptophan residues on CBM3c do not affect the binding affinity, but influence the cellulolytic activity in other ways. 3.4. Little increase in activity with substrate concentration for the conserved tryptophan mutant enzyme
Fig. 3. The binding affinity and substrate recognition of the conserved tryptophan substituted EngZ. The binding affinity was performed by 8% (v/v) polyacrylamide gel electrophoresis (PAGE) without SDS containing 0.3% (w/v) CMC (A). The bound band remained on the upper portion of the PAGE gel and the unbound band was pulled down by flow through. The shift degrees appeared near the band indicated by the arrow (↑). The enzyme reaction was performed with several concentrations from 2.5 mg/ml–15 mg/ml of CMC (B). EngZ (closed diamond,) activity was increased as much as the substrate concentrations. However, the W483A recombinant (opened square,) activity was not increased as much as the substrate concentrations. All of the data were presented from three experiments.
of the W483A recombinant on the binding affinity and the catalytic reaction. 3.3. Non-influenced on the binding affinity The W483A recombinant may contribute to the catalytic activity by reducing the ligand binding or the surface stability of the CBM and the CD. The main function of the CBM is cellulose binding, thus we first tested the binding affinity. The binding function of the tryptophan substituted recombinant enzyme was detected by NATIVE-PAGE containing amorphous cellulose (CMC) and the bound protein yields were measured on crystalline cellulose (Avicel). The EngZ W483A did not change the shift (↑) degree on NATIVE-PAGE containing CMC (Fig. 3A). Moreover, the EngZ W483A had the same Ka constant (0.51 ± 0.01 L/mol) on Avicel compared to the 0.51 ± 0.07 L/mol Ka constant of the wild-type (Table 2). These results indicate that the W483A did not influence binding function. Hence, we measured the enzyme kinetics of the W483A to determine the role of CBM3c on activation. The EngZ W529A had a slightly reduced Ka constant, but, the binding affinity was not sig-
The tryptophan substitution of CBM3c did not affect the binding affinity, but, did significantly reduce the enzyme activity. Usually, enzyme reaction is become more frequent on the crowded substrate via the chance of enzyme-substrate interaction is increased. In this study, the enzyme reaction was measured in various concentrations of the CMC (2.5 mg/ml–15 mg/ml) to determine influence of the conserved tryptophan on CBM3c on the substrate recognition of the CD. The wild-type showed linear increased activity from 20.8 ± 2.3 U/nM on 2.5 mg/ml of CMC to 69.3 ± 3.7 U/nM on 15 mg/ml of CMC, whereas, the activity of the W483A recombinant was not linear increased from 4.8 ± 0.6 U/nM on 2.5 mg/ml of CMC to 7.0 ± 1.2 U/nM on 15 mg/ml, respectively (Fig. 3B). The catalytic activity of W483A on 15 mg/ml of CMC was also 3.0-fold lower than the wild type’s catalytic activity on 2.5 mg/ml of CMC. The W483A recombinant had a remarkably low initial enzyme reaction compared to the wild-type. Moreover, we cannot calculate the kinetic parameters of W483A due to the low variations of enzyme activities were overlapped on each concentration of CMC. These results indicate that W483A substitution is not smoothly accepted the crowded substrate then disturbed initiate enzyme reaction. 3.5. Influence of the conserved tryptophan on CBM3c on the catalytic base activity The W483A recombinant influenced matching with the substrate and initial activation of CD in amorphous cellulose. Moreover, the W483A recombinant also reduced activity on the crystalline cellulose. In this study, we tested the catalytic mechanism on crystalline cellulose using sodium azide instead of the catalytic base. In homology modeling, the W483 on CBM3c was located on the surface of CBM3c and close to the other tryptophan W29 on the CD that was located on the same loop as the putative catalytic base, D51 and D54 (Fig. 4A). Thus, we measured the enzyme activity under treatment with sodium azide in the crystalline cellulose to determine the catalytic base activity. The azide aqueous solution gives hydrazoic acids and activated water that attacks the anomeric carbon of the substrate during hydrolysis. The activated water can attack the crystalline cellulose instead of the catalytic base in the initial enzyme reaction [24]. The W483A recombinant enzyme successfully restored the activity from 12.1 ± 3.4 U/nM to 36.0 ± 0.7 U/nM, similar to one of the wild-type (33.9 ± 2.0 U/nM) in the presence of 150 mM sodium azide (Fig. 4B). These results indicate that the conserved tryptophan aids the catalytic base position to be in the proper active region. These experiments were carried out by DNS solution reacted detection and the azide and substrate
164
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
Fig. 4. Catalytic base rescue of the conserved tryptophan substituted EngZ. (A) The homology modeling analysis of EngZ. The putative interacting tryptophan residue (W29) is closest to W483. The putative active sites (D51 and D54) are located on the same line as W29. The putative residues that are related to W483 were labeled in red. (B) The enzyme reaction was performed with 1% (w/v) Avicel in the presence of 50 mM and 150 mM sodium azide. EngZ (closed diamond,) activity was not significantly increased with the increasing concentration of sodium azide, but, the W483A substitution enzyme (opened square,) activity was restored after treatment with 50 mM sodium azide. All of the experimental data and standard deviations were presented from three tests.
reaction without enzyme (8 M/min/ml in the presence of 50 mM azide and 8 M/min/ml in the presence of 150 mM azide) was not overhead the difference of the mutant enzyme reaction yields (27 M/min/ml in the presence of 50 mM azide and 35 M/min/ml in the presence of 150 mM azide) between without the sodium azide and with the sodium azide in the same reaction condition. These reactions were insignificantly influenced to the rescue mutant reaction by the activated azide. However, these reactions might not result from directly disturbed interaction between the conserved tryptophan and the inner active sites. Hence, we need to confirm the influence of CBM3c in the surface of the CD.
3.6. The conserved tryptophan on CBM3c protects the disulfide bond of the CD The surface of the CD plays a role in maintaining the folding structure under conditions of high temperature or low pH. In this study, we confirmed the surface stability by denaturant at elevated temperatures. The denaturant, DTT only cleaves disulfide bonds that are located on the surface. We measured the hydrophobic interacting fluorescence units at elevated temperatures in the absence of DTT or in the presence of various concentrations of DTT. The relative fluorescence unit (RFU) was calculated based on the highest variance of fluorescence intensity of each enzyme defined by 1.0 RFU. In the presence of 20 mM DTT, the W483A recombinant had a decreased RFU from 0.96 ± 0.01 RFU in the absence of DTT to 0.85 ± 0.03 RFU in the presence of 20 mM DTT at 64 ◦ C, whereas, the wild-type RFU was similar in both conditions (0.92 ± 0.03 RFU in the presence of 20 mM DTT and 0.95 ± 0.02 RFU in the absence of DTT at 64 ◦ C) (Fig. 5A and B). These results indicate that the W483 is involved in protecting the disulfide bond. The disulfide bond can be formed by cystein–cystein interaction. EngZ has eight cystein residues including C103, C174, C200, C258, C278, C330, C384 and C422 on the CD. Among them, C103, C174, C256, C330 and C422 residues are conserved with Cel9G. In the homology modeling, C422 is located near the putative active sites (D51 and D54) and C258 is located closer to C422 compared to other cysteines (Fig. 5C). These residues are also present in the Cel9G, including C422 and C257. The homology modeling indicates that the conserved tryptophan may interact with W29 on the CD and that their interaction plays a role in locating the catalytic base for suitable activation and for protecting the surface disulfide bond.
4. Discussion In endoglucanase reactions, the CBM usually brings the substrate into the active sites of the CD. If the distance between the CBM and the CD were short, it can significantly control the catalytic activation of the CD via interaction with the CBM. Cel9A and Cel9G which have high identities with EngZ show that CBM3c located on nearby CD is almost attached in the homology modeling (Fig. 1B). CBM3c may be significantly influencing the catalytic activity. In endoglucanases, the tryptophan on the CBM was a well-known player in the binding and the hydrolysis on soluble cellulose [28]. EngZ has two tryptophans on CBM3c and the primary residue (W483) is the conserved tryptophan compared to other GH9 endoglucanases containing CBM3c (Cel9I, Cel9A and Cel9G). We hypothesized that the conserved tryptophan (W483) plays an important role in the catalytic activity and investigated the substitution recombinant enzyme’s catalytic activity and binding affinity. The effect on reducing enzyme activity without changing the binding affinity of W483A recombinant induces the break-down of the initial activity [29]. The initial enzyme reaction required the substrate to enter into the substrate recognition pocket of the CD and the recognition pocket would maintain a suitable folding structure for the specific interaction between the cleavage site of substrate and the active site of the enzyme. Endoglucanase forms a cleft loop in the active site [30], hence, the reduced catalytic activities might be influenced by changing the location of the active cleft loop region. This is confirmed by the finding that the W483A recombinant did not increase on the growing concentration of amorphous cellulose. These measurements are only possible on the amorphous cellulose because the general kinetic measurement is not an exact linear growing rate in crystalline cellulose hydrolysis, thus, a processive hydrolysis mechanism cannot possibly be determined by the same experiment as amorphous cellulose hydrolysis [31]. However, we can inspect a part of the mechanism in crystalline cellulose by investigating the relationship of the active sites. Processive endoglucanase has an additional active site such as a catalytic base and this binds crystalline substrates and cleaves the substrate [21]. The EngZ has also additional active sites such as catalytic base (D51 and D54). The catalytic acid and catalytic base are performed together in crystalline cellulose hydrolysis as an inverting mechanism hence we can confirm the restored catalytic activity by using materials that instead lead to the catalytic activation. The dramatic recovery of catalytic base activity of the W483A recombinant in the presence of sodium azide might be influenced by changing the location of these active sites. The altered activation
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
165
Fig. 5. Weak surface disulfide bonds of the conserved tryptophan substituted EngZ were observed in the denatured form. The hydrophobic interacting fluorescent units were measured by the differential scanning fluorimetry (DSF) assay. At elevated temperatures, the initial unfolded states of the wild-type (A) and the W483A recombinant (B) were compared in the absence or the presence of DTT. Comparisons were made between those that were untreated (closed circle,), 20 mM DTT addition (opened circle,) and 100 mM DTT addition (opened triangle,). All of the data were presented from experiments in triplicate. (C) The partial 3D structure of EngZ was determined. The cystein residues that form disulfide bonds around the putative catalytic base were identified as C258 and C422. C422 is located close to the D54 residue and C258 is located on nearby C422, thus a disulfide bond can be formed with C422. The putative residues, which form a disulfide bond, were marked in red and the putative active sites were left unmarked.
of sodium azide made it possible to increase crystalline cellulose hydrolysis due to the buried active sites. These results indicate that the conserved tryptophan has an important role in driving the position of the active sites to the right location for the initiation of the enzyme reaction. This is confirmed by homology modeling, specifically that the conserved tryptophan was located close to the active site loop, thus, the conserved tryptophan could influence to movement of the catalytic base loop region. The conserved tryptophan interaction with the CD is possible by other tryptophan (W29) on CD that is located on surface of CD. The W29 is located in the same loop with the catalytic base sites. The conserved tryptophan substitution on the CBM may influence its expression at the surface region due to the substitution disrupting a strong hydrophobic interaction with W29. The surface stability was confirmed by measurement of hydrophobic intensity at elevated temperatures in the presence or absence of DTT. DTT disturbs the formation of a disulfide bond of the outer thiol group, thus, we can determine the movement of the thiol group. The hydrophobic intensity pattern makes it possible for us to indirectly detect the degree of rigidity of the folding structure at high temperatures. The hydrophobic intensity of W483A recombinant in the presence of 20 mM DTT was significantly decreased after the highest intensity point compared to one of the W483A recombinants in the absence of DTT (Fig. 5B). These results indicate that W483A con-
tributes to weak disulfide bond by the far distance between each cystein or by changes in the location of residues which form disulfide bonds from buried cystein residues into the easily exposed location to outer denaturant. In the primary hypothesis, the free cystein, which does not form a disulfide bond by longer distances, leads to decreased stability even in the absence of a denaturant [32]. However, the movement of the cystein does not significantly affect to the stability in the absence of a denaturant. The disulfide bond located near the catalytic base loop probably moved into the active site loop region, easily exposing it to outer materials resulting from the W483A substitution. The putative cystein residues were confirmed by homology modeling show that C422 and C258 are located near the putative active sites (Fig. 5C). These residues are not completely responsible for the formation of the disulfide bond, but, these residues have a high potential for forming the disulfide bond. These cystein residues were probably influenced by the substitution of conserved tryptophan. The conserved tryptophan on CBM3c probably interacts with surface tryptophan and the location is influenced to the surface disulfide bond stability. In conclusion, the CBM3c is important for the initial enzyme reaction unrelated to cellulose binding. The strong hydrophobic interaction between the CBM3c and the CD can make possible the positioning of the catalytic base sites and the nearby disulfide bond in the appropriate location. In this study, we confirmed the influ-
166
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
ence of only one hydrophobic interaction, but, these experiments can make the study of the structural mechanism around residues of W483 possible in future studies. This study can also support the potential possibility of the multiple applications of the CBM. Acknowledgements This work was supported by the Industrial Strategic Technology Development Program (10051513) funded by the Ministry of Trade, Industry & Energy (MI, Korea). References [1] J.S. van Dyk, B.I. Pletschke, A review of lignocellulose bioconversion using enzymatic hydrolysis and synergistic cooperation between enzymes—factors affecting enzymes, conversion and synergy, Biotechnol. Adv. 30 (2012) 1458–1480. [2] R. Gupta, Y.Y. Lee, Mechanism of cellulase reaction on pure cellulosic substrates, Biotechnol. Bioeng. 102 (2009) 1570–1581. [3] A.B. Boraston, D.N. Bolam, H.J. Gilbert, G.J. Davies, Carbohydrate-binding modules: fine-tuning polysaccharide recognition, Biochem. J. 382 (2004) 769–781. [4] S.D. Jeon, K.O. Yu, S.W. Kim, S.O. Han, The processive endoglucanase EngZ is active in crystalline cellulose degradation as a cellulosomal subunit of Clostridium cellulovorans, New Biotechnol. 29 (2012) 365–371. [5] Y. Li, D.C. Irwin, D.B. Wilson, Processivity, substrate binding, and mechanism of cellulose hydrolysis by Thermobifida fusca Cel9A, Appl. Environ. Microbiol. 73 (2007) 3165–3172. [6] R. Yennamalli, A. Rader, J. Wolt, T. Sen, Thermostability in endoglucanases is fold-specific, BMC Struct. Biol. 11 (2011) 1–15. [7] P.-H. Ferdinand, R. Borne, V. Trotter, S. Pagès, C. Tardif, H.-P. Fierobe, S. Perret, Are cellulosome scaffolding protein CipC and CBM3-containing protein HycP, involved in adherence of Clostridium cellulolyticum to cellulose? PLoS One 8 (2013) e69360. [8] T. Burstein, M. Shulman, S. Jindou, S. Petkun, F. Frolow, Y. Shoham, E.A. Bayer, R. Lamed, Physical association of the catalytic and helper modules of a family-9 glycoside hydrolase is essential for activity, FEBS Lett. 583 (2009) 879–884. [9] T. Arai, A. Kosugi, H. Chan, R. Koukiekolo, H. Yukawa, M. Inui, R.H. Doi, Properties of cellulosomal family 9 cellulases from Clostridium cellulovorans, Appl. Microbiol. Biotechnol. 71 (2006) 654–660. [10] H. Hashimoto, Recent structural studies of carbohydrate-binding modules, Cell. Mol. Life Sci. 63 (2006) 2954–2967. [11] Y. Wang, H. Yuan, J. Wang, Z. Yu, Truncation of the cellulose binding domain improved thermal stability of endo--1,4-glucanase from Bacillus subtilis JA18, Bioresour. Technol. 100 (2009) 345–349. [12] Y. Zhu, M. Zhang, R. Amber Kelly, A. Cheng, The carbohydrate-binding domain of overexpressed STBD1 is important for its stability and protein–protein interactions, Biosci. Rep. 34 (2014) e00117. [13] T. Le Costaouëc, A. Pakarinen, A. Várnai, T. Puranen, L. Viikari, The role of carbohydrate binding module (CBM) at high substrate consistency: comparison of Trichoderma reesei and Thermoascus aurantiacus Cel7A (CBHI) and Cel5A (EGII), Bioresour. Technol. 143 (2013) 196–203. [14] Q. Yin, Y. Teng, M. Ding, F. Zhao, Site-directed mutagenesis of aromatic residues in the carbohydrate-binding module of Bacillus endoglucanase EGA decreases enzyme thermostability, Biotechnol. Lett. 33 (2011) 2209–2216.
[15] D. Guillén, S. Sánchez, R. Rodríguez-Sanoja, Carbohydrate-binding domains: multiplicity of biological roles, Appl. Microbiol. Biotechnol. 85 (2010) 1241–1249. [16] N. Din, I.J. Forsythe, L.D. Burtnick, N.R. Gilkes, R.C. Miller, R.A.J. Warren, D.G. Kilburn, The cellulose-binding domain of endoglucanase A (CenA) from Cellulomonas fimi: evidence for the involvement of tryptophan residues in binding, Mol. Microbiol. 11 (1994) 747–755. [17] A. Nakamura, T. Tsukada, S. Auer, T. Furuta, M. Wada, A. Koivula, K. Igarashi, M. Samejima, The tryptophan residue at the active site tunnel entrance of Trichoderma reesei cellobiohydrolase Cel7A is important for initiation of degradation of crystalline cellulose, J. Biol. Chem. 288 (2013) 13503–13510. [18] R. Sleat, R.A. Mah, R. Robinson, Isolation and characterization of an anaerobic, Cellulolytic bacterium, Clostridium cellulovorans sp. nov, Appl. Environ. Microbiol. 48 (1984) 88–93. [19] W. Zhou, D.C. Irwin, J. Escovar-Kousen, D.B. Wilson, Kinetic studies of Thermobifida fusca Cel9A active site mutant enzymes, Biochemistry 43 (2004) 9655–9663. [20] J. Sakon, D. Irwin, D.B. Wilson, P.A. Karplus, Structure and mechanism of endo/exocellulase E4 from Thermomonospora fusca, Nat. Struct. Mol. Biol. 4 (1997) 810–818. [21] D. Mandelman, A. Belaich, J.P. Belaich, N. Aghajari, H. Driguez, R. Haser, X-ray crystal structure of the multidomain endoglucanase Cel9G from Clostridium cellulolyticum complexed with natural and synthetic cello-oligosaccharides, J. Bacteriol. 185 (2003) 4127–4135. [22] G.L. Miller, Use of dinitrosalicylic acid reagent for determination of reducing sugar, Anal. Chem. 31 (1959) 426–428. [23] N.R. Gilkes, E. Jervis, B. Henrissat, B. Tekant, R.C. Miller, R.A. Warren, D.G. Kilburn, The adsorption of a bacterial cellulase and its two isolated domains to crystalline cellulose, J. Biol. Chem. 267 (1992) 6743–6749. [24] M. Kostylev, D.B. Wilson, Determination of the catalytic base in family 48 glycosyl hydrolases, Appl. Environ. Microbiol. 77 (2011) 6274–6276. [25] E. Ablinger, S. Leitgeb, A. Zimmer, Differential scanning fluorescence approach using a fluorescent molecular rotor to detect thermostability of proteins in surfactant-containing formulations, Int. J. Pharm. 441 (2013) 255–260. [26] Y. Li, D.C. Irwin, D.B. Wilson, Increased crystalline cellulose activity via combinations of amino acid changes in the family 9 catalytic domain and family 3c cellulose binding module of Thermobifida fusca Cel9A, Appl. Environ. Microbiol. 76 (2010) 2582–2588. [27] W.-Y. Chou, T.-W. Pai, T.-Y. Jiang, W.-I. Chou, C.-Y. Tang, M.D.-T. Chang, Hydrophilic aromatic residue and in silico structure for carbohydrate binding module, PLoS One 6 (2011) e24814. [28] R. Macarrón, B. Henrissat, M. Claeyssens, Family a cellulases: two essential tryptophan residues in endoglucanase III from Trichoderma reesei, Biochim. Biophys. Acta – Gen. Subjects 1245 (1995) 187–190. [29] Z. Shu, Y. Wang, L. An, L. Yao, The slowdown of the endoglucanase Trichoderma reesei Cel5A-catalyzed cellulose hydrolysis is related to its initial activity, Biochemistry 53 (2014) 7650–7658. [30] L. Poidevin, J. Feliu, A. Doan, J.-G. Berrin, M. Bey, P.M. Coutinho, B. Henrissat, E. Record, S. Heiss-Blanquet, Insights into exo- and endoglucanase activities of family 6 glycoside hydrolases from Podospora anserina, Appl. Environ. Microbiol. 79 (2013) 4220–4229. [31] J.M. Fox, S.E. Levine, D.S. Clark, H.W. Blanch, Initial- and processive-cut products reveal cellobiohydrolase rate limitations and the role of companion enzymes, Biochemistry 51 (2012) 442–452. [32] A. Hernández-Santoyo, L. Domínguez-Ramírez, C.A. Reyes-López, E. González-Mondragón, A. Hernández-Arana, A. Rodríguez-Romero, Effects of a buried cysteine-to-serine mutation on yeast triosephosphate isomerase structure and stability, Int. J. Mol. Sci. 13 (2012) 10010–10021.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: www.elsevier.com/locate/ijbiomac
Mutation of a conserved tryptophan residue in the CBM3c of a GH9 endoglucanase inhibits activity Su-Jung Kim a , So Hyeong Kim a , Sang Kyu Shin a , Jeong Eun Hyeon b , Sung Ok Han a,b,∗ a b
Department of Biotechnology, Korea University, Seoul 02841, Republic of Korea Institute of Life Science and Natural Resources, Korea University, Seoul 02841, Republic of Korea
a r t i c l e
i n f o
Article history: Received 2 May 2016 Received in revised form 29 June 2016 Accepted 29 June 2016 Available online 29 June 2016 Keywords: Cellulose binding module 3c Family 9 endoglucanase CD and CBM interaction Initial cellulolytic reaction Catalytic base Disulfide bond
a b s t r a c t The presence of the family of 3c cellulose binding module (CBM3c) is important for the catalytic activity of family 9 endoglucanases such as the EngZ from Clostridium cellulovorans. To determine the role of CBM3c in catalytic activity, we made a tryptophan to alanine substitution because tryptophan can bind strongly to both substrates and other amino acids. The conserved tryptophan substitution (W483A) did not influence substrate binding, but it reduced enzyme activity to 10–14% on both amorphous and crystalline cellulose. CBM3c is directly involved in the endoglucanase reaction independent of substrate binding. EngZ W483A was also inactivated independent of substrate concentrations. Specially, EngZ W483A restored its catalytic base activity (31.6 ± 1.2 U/nM) which is similar to the wild-type (29.4 ± 0.3 U/nM) on Avicel in the presence of 50 mM sodium azide which is instead of catalytic base reaction. These results suggest that CBM3c is deeply involved in the cellulolytic reaction, specifically at the catalytic base region. Moreover, EngZ W483A was also easily denatured by DTT, an outer disulfide bond breaker, compared to the wildtype. CBM3c could influence the surface stability. These features of CBM3c result from the hydrophobic interaction of tryptophan with the catalytic domain that is unrelated to substrate binding. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Cellulose is a major energy source for lignocellulosic biomass conversion, but its conversion is very difficult due to its -1,4 linkages [1]. Cellulases can cleavage the -1, 4 linkages. Cellulase is classified as an endoglucanase and an exoglucanase based on its cleavage site. Among them, endoglucanases degrade randomly soluble cellulose through binding of the active cleft to cellulose and then producing small polymers of various sizes [2]. Endoglucanase has several types of helper modules such as the cellulose binding module (CBM) and the immunoglobulin (Ig)-like domain. In general, the CBM is an important factor in the catalytic activity of cellulase through its strong binding with cellulose. Family 9 endoglucanases have different specific catalytic activities depending on the CBM type [3]. The classification of the CBMs is defined by their binding mechanism to appropriate substrate. For example, family 9 endoglucanases containing CBM3 that down-stream of the catalytic domain (CD), such as Cel9A and EngZ, have a pro-
∗ Corresponding author at: Department of Biotechnology, Korea University, Seoul 02841, Republic of Korea. E-mail addresses: [email protected], [email protected] (S.O. Han). http://dx.doi.org/10.1016/j.ijbiomac.2016.06.091 0141-8130/© 2016 Elsevier B.V. All rights reserved.
cessive activity [4,5]. Their CBM3 belongs to the type A group that binds to the flat surface of crystalline cellulose, which causes Cel9A and EngZ to have a processive reaction that hydrolyzes both amorphous and crystalline cellulose. Family 9 endoglucanases containing CBM3 perform their enzyme reactions in accordance with an inverting mechanism. An inverting mechanism [6] is defined by a cleavage by nucleus residues and acid/base donor residues that work together using the carboxylate group of the acid/base donor. Therefore, the function of the acid/base donor is important in the processive catalytic activity of family 9 endoglucanases. CBM3 is also divided into three types, and the a and b types are classified by their different binding affinity for their substrate [7]. However, CBM3c plays a role in the interaction with CD [8], and CBM3c is an essential domain for its catalytic activity [9]. In addition, CBM3c has been co-crystallized with its corresponding family 9 CD [10]. This means that CBM3c is an essential module for the CD in spontaneous activity. Although CBM3c is definitely involved in the initiation of catalytic activity and thermostability through its interaction with the CD [8,11], the mechanism underlying actions of CBM3c is not yet clear. Some aromatic residues play an important role in the interaction between the CBM and the substrate. In some cases, the tryptophan residues of the CBM played important roles in CBM
160
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
binding, thermostability and protein–protein interactions [12–14]. The tryptophan residues in the CBM, which are located on the surface or in central binding sites, have a higher affinity to sugar ring by van der Waals interaction than the other aromatic residues, forming a hydrogen bond between the CBM and the polysaccharide through an indole nitrogen group from the tryptophan, resulting in stabilization of the structure [15,16]. In addition, the tryptophan residues that are located on the active site also play a role in the initiation of substrate recognition in exoglucanase [17]. Tryptophan-tryptophan interactions can lead to protein–protein interactions or to the maintenance of the active form. Hence, we selected the tryptophan residues on CBM3c as the substitution target residues to determine the function of CBM3c in catalytic activity. In this study, we used site-directed mutagenesis by replacing tryptophan with alanine on CBM3c in the EngZ from Clostridium cellulovorans. Because the EngZ has two tryptophans on its CBM3c and processive activity, we can therefore compare between the tryptophan that is conserved with other family 9 endoglucanases and the other tryptophan using different substrates. To determine the influence of the reduced hydrophobic interaction of CBM3c on catalytic activity, we investigated both the binding affinity and the catalytic activity using various substrates. 2. Materials and methods 2.1. Strains and plasmids synthesis Clostridium cellulovorans ATCC 35296 was cultured under anaerobic conditions (N2 -CO2 ratio as 80:20) at 37 ◦ C according to sleet’s protocol with 1% (w/v) Avicel [18] to obtain genomic DNA. The Escherichia coli DH5␣ (DE3, Stratagene, USA) and BL21 (DE3, Stratagene, USA) were used as host cells for plasmid cloning and the expression of proteins. The EngZ (NCBI Reference sequence: WP 010076628.1) and the truncated CBM3c gene were synthesized by polymerase chain reaction (PCR) amplification from the genomic DNA of C. cellulovorans using the following primers: EngZ-f, 5 -CCGGAATTCAACTACGGGGAAGCA-3 (restriction site; EcoRI) and EngZ-r, 5 -ACGCTCGAGGGTTCACCTACCCAT-3 (restriction site, XhoI) for EngZ and two primers of EngZ-f and ZCDr, 5 -GCCCTCGAGGTATTTGTCGTACAT-3 (restriction site, XhoI) for EngZ CD, respectively. The PCR product was inserted into the pET22b (+) (Novagen, USA) vector and then transformed into DH5␣ cells for sequence confirmation and into BL21 cells for protein expression. The recombinant plasmids were used as a template for mutagenesis.
at −20 ◦ C for 1 h. The concentrated product was transformed into E. coli DH5␣ (DE3) cells. The plasmids were then isolated as individual colonies and were sequenced to confirm the altered site. The plasmid with the correct mutation was transformed into E. coli BL21 (DE3) cells for protein expression. After the site directed mutagenesis, the mutant plasmids were cut with the restriction enzyme BamHI at 30 ◦ C for 2 h and then ligated with the T4 ligase at 16 ◦ C for 2 h to obtain only CBM3c genes. All of the plasmid vectors were transformed into E. coli DH5␣ (DE3) cells. The plasmids were then isolated as individual colonies and were sequenced to confirm the proper identity of the construct. The plasmid with the correct mutation was transformed into E. coli BL21 (DE3) cells for protein expression. 2.3. Protein expression and purification E. coli BL21(DE3) cells harboring the plasmids containing the wild-type gene or its mutants was grown in LB-ampicillin medium (10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, and 50 mg of ampicillin in 1 L medium) to produce the fusion proteins. The wildtype and mutant strains were cultivated at 37 ◦ C until they reached an OD600 value over 1.4. Then, the induction was carried out by adding 0.5 mM Isopropylthio--d-galactoside (IPTG) at 20 ◦ C for 20 h. The harvested cells were suspended in lysis buffer (50 mM sodium phosphate buffer, pH 8 containing 10 mM imidazole and 400 mM NaCl) and then the mixture was homogenized by sonication on ice. The cell debris was removed by centrifugation for 20 min at 4000 rpm and the supernatant was loaded onto the QIA express Ni-NTA protein purification system (Qiagen, CA) according to the manufacturer’s protocols. The purified proteins were determined by SDS-PAGE and enzyme activity. The protein yields were measured using the Bradford reagent (Bio-Rad, USA). 2.4. Sequence analysis and homology modeling of the EngZ The EngZ structure was modeled based on the structure of the closely related Cel9A (NCBI Reference sequence: WP 011292599.1) [20] and Cel9 G (Accession number: P37700) [21]. Cel9A from Thermobifida fusca and Cel9 G from Clostridium cellulolyticum have 58% and 63% amino acids sequence identity, respectively. The Protein Data Bank Accession [PDB: 4TF4 for Cel9A, 1G87 for Cel9G] was used as a template for homology modeling and the three-dimensional model of EngZ was generated using SWISS-MODEL via the ExPASy sever. 2.5. Enzyme activity
2.2. Site-directed mutagenesis The mutagenesis assay was performed as described in Zhou’s paper [19]. Two oligonucleotide primers containing the target site (under-lined) for each mutation were designed as follows: W483A Forward; CGTAATCAAACTGGTGCACCAGCAAGAGGTAGT W483A Reverse; ACTACCTCTTGCTGGTGCACCAGTTTGATTACG W529A Forward; CTTTCTGGGCTTATACCTGCAGATGTTGATAAAAACATATAC W529A Reverse; GTATATGTTTTTATCAACATCTGCAGGTATAAGCCCAGAAAG The assays were carried out by PCR amplification under the following conditions. The PCR was initiated by the addition of Pfu polymerase (ELPIS, USA) and the cycling parameters were: one cycle at 95 ◦ C for 2 min; 18 cycles of 95 ◦ C for 60 s, 60 ◦ C for 50 s and 74 ◦ C for 8 min; and a final step at 74 ◦ C for 7 min. The sample (25 L) was then incubated with 10 units of DpnI (Takara, Japan) for 3 h at 37 ◦ C to remove the methylated parental template. The enzyme treated sample was concentrated by ethanol precipitation
All mutant endoglucanases and EngZ CD were incubated with 1% (w/v) substrates at 40 ◦ C for 30 min, in 50 mM sodium acetate buffer (pH 7). The cellulolytic substrates were carboxymethyl cellulose (CMC), -glucan and Avicel. The amount of reducing sugars released from the substrate was determined with the 3, 5dinitrosalicylic acid (DNS) reagent as described by Miller et al. [22]. One unit of activity was defined as the amount of enzyme releasing 1 mol of glucose equivalent per min. 2.6. Binding assay The wild-type EngZ and the tryptophan substituted EngZ were prepared by suspension in Tris·HCl buffer (pH 7), and then the samples (each 500 nmol) were directly loaded on NATIVE-PAGE (8% polyacrylamide gel, containing 0.3% (w/v) CMC) for an amorphous substrate binding assay. To determine the insoluble substrate binding affinity, the prepared enzyme samples (each 2 mol) were added into 5 g/100 mL Avicel in a total volume 0.25 mL and the
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
161
Fig. 1. The sequence alignment of CBM3c of EngZ with other family 9 endoglucanases. Comparison of the amino acids residues of Cel9I from Clostridium thermocellum, Cel9A from Thermobifida fusca, Cel9G from Clostridium cellulolyticum and EngZ from Clostridium cellulovorans was carried out in (A). * are the putative altered residues. The gray box represents the conserved residues. (B) Homology modeling of EngZ was formed by SWISSMODEL from the amino acids sequences. The modeling templates were Cel9A (PDB ID; 4TF4) and Cel9G (PDB ID; 1G87). The conserved tryptophan (W483) was indicated by the red color on each structure model.
tubes were shaken at 4 ◦ C for 2 h. The suspended samples were centrifuged at 13,000 rpm for 5 min and the liquid fraction (0.25 mL) was transferred into new E-tubes. The protein concentrations of the unbound fraction were calculated from the absorbance measurement at 595 nm by UV spectrophotometer with the Bradford
reagent (Bio-Rad, USA). The bound protein concentration (mol/g of substrate) was calculated from the concentration of total protein minus the free protein [14]. The relative equilibrium association constant Ka (L/mol) was calculated according to the method of Gilkes et al. [23].
162
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
Table 1 Enzyme activity of the truncated CBM3c of EngZ.
EngZ EngZ CD
Specific activity (U/nM) CMCase
-glucan hydrolase
Avicelase
34.1 ± 4.9 4.8 ± 3.8
75.7 ± 3.9 10.2 ± 6.5
23.7 ± 6.3 2.4 ± 3.4
2.7. Azide rescue activity assay To further confirm that EngZ W483A is influenced to the catalytic base or to an important residue in the catalytic site, we tested the rescue activity of the mutant in the presence of azide [24]. For this test, activity assays were carried out as described above except for the addition of the indicated amount of sodium azide. The sodium azide concentrations used were 50 mM and 150 mM. 2.8. Differential scanning fluorimetry analysis in the presence of DTT To confirm the surface stability, we tested the degree of denaturation at elevated temperatures by using a denaturant (dithio-threitol, DTT) that only break down the outer disulfide bond. The differential scanning fluorimetry (DSF) assay was carried out according to previous reports to determine the hydrophobic intensity at elevated temperatures by using a hydrophobic fluorescent indicator, SYPRO Orange [25]. The DSF experiments were performed using an RT (real time)-PCR strip (Bio-Rad, USA). EngZ wild-type and mutant enzymes were used at a final concentration of 0.1 mg/ml in 50 mM sodium acetate buffer, pH 7. The 5000 × SYPRO Orange dye (SIGMA, USA) was used at a final concentration of 2.5× in each well. The fluorescence units were measured in the absence and the presence of 20 mM DTT and 100 mM DTT. The total reaction mixture was 30 L. The fluorescence intensities were monitored using an Mx3005 RT-PCR instrument (Stratagene, USA) with the FAM (6-carboxyfluorescein; 492 nm) and ROX (carboxy-X-rhodamine; 610 nm) filters for excitation and emission, respectively. The samples were heated from 25 ◦ C to 95 ◦ C at a scan rate of 1 ◦ C per minute. The relative fluorescence emission intensities were plotted against temperature (◦ C). 3. Results 3.1. Reduced enzyme reaction by removal of CBM3c in EngZ The EngZ is a glycoside hydrolase 9 (GH 9) endoglucanase and was discovered by our lab [4]. The EngZ has an activity of approximately 7 U/mg on CMC and can hydrolyze crystalline cellulose, thus, it has a high affinity for crystalline cellulose compared to other endoglucanases. The EngZ has a CBM3c such as Cel9A and EngH. These GH9 endoglucanases containing CBM3c were lost their activity until 58% for Cel9A and non-detected reaction for EngH when removed CBM3c [9,26]. The EngZ dramatically reduced its activity when CBM3c was removed to 4.8, 10.2 and 2.4 U/nM on CMC, -glucan and Avicel, respectively (Table 1). The reduced activities were 14%, 13% and 10% relative activities on CMC, -glucan and Avicel compared to the wild-type. These results indicate that CBM3c is important to maintain the catalytic activities of the EngZ on both amorphous and crystalline cellulose. 3.2. Reduced enzyme activity of the conserved tryptophan substituted EngZ To determine the role of CBM3c in catalytic activity, we searched some amino acids, and we found that some aromatic
Specif ic activity (U/nM)
Enzyme
80
60
40
20
0
CMC
β-glucan
Avicel
Fig. 2. Screening of the tryptophan substituted recombinant EngZ for its enzyme reaction. The enzyme reaction was performed with 1% (w/v) substrate and the detection was carried out by measuring the absorbance at 540 nm after the addition of 1% (w/v) DNS solution and boiling. The enzyme activity of the wild type (black), W483A (white) and W529A (gray) were determined by comparison of the U/nM of the enzyme solution. All of the data were presented from three experiments.
residues were important in both the ligand binding and stability of CBM [14,27]. According to these previous reports, tryptophan was the most important for maintaining those features. Hence, we selected the tryptophan residues on CBM3c as the target residues for site-directed mutagenesis. We also aligned the sequence with other CBM3c of the GH9endoglucanases, including Cel9I from Clostridium thermocellum (NCBI accession number: WP 003520969.1), Cel9A from Thermobifida fusca (NCBI Reference sequence: WP 011292599.1) and Cel9G from Clostridium cellulolyticum (Accession number: P37700) (Fig. 1A). These sequences have amino acid sequence identities as high as 56% for Cel9I, 58% for Cel9A and 63% for Cel9G with EngZ. The ranges of CBM3c are 461–541 residues for EngZ, 442–528 residues for Cel9I, 459–538 residues for Cel9A and 455–532 residues for Cel9G, respectively. The EngZ has two tryptophan residues, W483 and W529 on CBM3c and W483 is a conserved residue with Cel9I (W505), Cel9A (W489) and Cel9G (W485) (Fig. 1A). In addition, W483 is located close to the CD surface (Fig. 1B) as determined by computational 3D structure alignment with Cel9A (protein data bank, PDB number: 4TF4) [20] and Cel9 G (PDB number: 1G87) [21]. These results indicate that the CD maybe influenced by W483. To determine the function of the tryptophan, we altered the residue from tryptophan to alanine. The catalytic activity of the recombinants of W483A and W529A were compared to the wildtype. The results showed that the W483A recombinant enzyme had its activity reduced to 2.7 ± 3.4, 10.3 ± 7.5 and 2.8 ± 4.4 U/nM on CMC, -glucan and Avicel, respectively (Fig. 2). The reducing ratios (8% to 16%) of the W483A recombinant enzyme were similar to the reduction ratios (10%–14%) of EngZ CD. The W483A recombinant enzyme showed similar reduction ratios against both of the soluble and insoluble substrates. These indicate that the W483A recombinant enzyme was influenced the enzyme reaction but, was not influenced the processivity. The W529A recombinant enzyme activity only showed a slight reduction on the amorphous cellulose (62%) compared to the W483A recombinant. These results confirmed that W483 is important for the catalytic activity of the CD and could influence the CD function or stability. It might be due to the location of W483, which is closer to the CD than W529. The W529 was located in the opposite region than the CD and that is not a conserved residue with other GH9 endoglucanases containing CBM3c. In the next experiment, we aimed to confirm the function
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
163
Table 2 Binding affinity of EngZ and W483A recombinant on Avicel. Enzyme
Total protein (mol)
Free enzyme (mol)
Ka a (L/mol)
EngZ W483A W529A
2.09 ± 0.19 2.29 ± 0.11 2.29 ± 0.12
1.28 ± 0.05 1.35 ± 0.01 1.37 ± 0.01
0.51 ± 0.07 0.51 ± 0.01 0.50 ± 0.04
[N] is calculated from follow equilibrium; [N] = [N0-B], [N0] is an initiate accessible ligand molecules per gram of cellulose. a Ka is a relative equilibrium association constant and calculated from follow equilibrium, Ka = [B]/[N][F], [B] is bound molecues of enzymes per gram of cellulose, [N] is accessible ligand molecules of enzymes per gram of cellulose and [F] is free enzyme molecules.
nificantly different compared to the wild-type. This means that the tryptophan residues on CBM3c do not affect the binding affinity, but influence the cellulolytic activity in other ways. 3.4. Little increase in activity with substrate concentration for the conserved tryptophan mutant enzyme
Fig. 3. The binding affinity and substrate recognition of the conserved tryptophan substituted EngZ. The binding affinity was performed by 8% (v/v) polyacrylamide gel electrophoresis (PAGE) without SDS containing 0.3% (w/v) CMC (A). The bound band remained on the upper portion of the PAGE gel and the unbound band was pulled down by flow through. The shift degrees appeared near the band indicated by the arrow (↑). The enzyme reaction was performed with several concentrations from 2.5 mg/ml–15 mg/ml of CMC (B). EngZ (closed diamond,) activity was increased as much as the substrate concentrations. However, the W483A recombinant (opened square,) activity was not increased as much as the substrate concentrations. All of the data were presented from three experiments.
of the W483A recombinant on the binding affinity and the catalytic reaction. 3.3. Non-influenced on the binding affinity The W483A recombinant may contribute to the catalytic activity by reducing the ligand binding or the surface stability of the CBM and the CD. The main function of the CBM is cellulose binding, thus we first tested the binding affinity. The binding function of the tryptophan substituted recombinant enzyme was detected by NATIVE-PAGE containing amorphous cellulose (CMC) and the bound protein yields were measured on crystalline cellulose (Avicel). The EngZ W483A did not change the shift (↑) degree on NATIVE-PAGE containing CMC (Fig. 3A). Moreover, the EngZ W483A had the same Ka constant (0.51 ± 0.01 L/mol) on Avicel compared to the 0.51 ± 0.07 L/mol Ka constant of the wild-type (Table 2). These results indicate that the W483A did not influence binding function. Hence, we measured the enzyme kinetics of the W483A to determine the role of CBM3c on activation. The EngZ W529A had a slightly reduced Ka constant, but, the binding affinity was not sig-
The tryptophan substitution of CBM3c did not affect the binding affinity, but, did significantly reduce the enzyme activity. Usually, enzyme reaction is become more frequent on the crowded substrate via the chance of enzyme-substrate interaction is increased. In this study, the enzyme reaction was measured in various concentrations of the CMC (2.5 mg/ml–15 mg/ml) to determine influence of the conserved tryptophan on CBM3c on the substrate recognition of the CD. The wild-type showed linear increased activity from 20.8 ± 2.3 U/nM on 2.5 mg/ml of CMC to 69.3 ± 3.7 U/nM on 15 mg/ml of CMC, whereas, the activity of the W483A recombinant was not linear increased from 4.8 ± 0.6 U/nM on 2.5 mg/ml of CMC to 7.0 ± 1.2 U/nM on 15 mg/ml, respectively (Fig. 3B). The catalytic activity of W483A on 15 mg/ml of CMC was also 3.0-fold lower than the wild type’s catalytic activity on 2.5 mg/ml of CMC. The W483A recombinant had a remarkably low initial enzyme reaction compared to the wild-type. Moreover, we cannot calculate the kinetic parameters of W483A due to the low variations of enzyme activities were overlapped on each concentration of CMC. These results indicate that W483A substitution is not smoothly accepted the crowded substrate then disturbed initiate enzyme reaction. 3.5. Influence of the conserved tryptophan on CBM3c on the catalytic base activity The W483A recombinant influenced matching with the substrate and initial activation of CD in amorphous cellulose. Moreover, the W483A recombinant also reduced activity on the crystalline cellulose. In this study, we tested the catalytic mechanism on crystalline cellulose using sodium azide instead of the catalytic base. In homology modeling, the W483 on CBM3c was located on the surface of CBM3c and close to the other tryptophan W29 on the CD that was located on the same loop as the putative catalytic base, D51 and D54 (Fig. 4A). Thus, we measured the enzyme activity under treatment with sodium azide in the crystalline cellulose to determine the catalytic base activity. The azide aqueous solution gives hydrazoic acids and activated water that attacks the anomeric carbon of the substrate during hydrolysis. The activated water can attack the crystalline cellulose instead of the catalytic base in the initial enzyme reaction [24]. The W483A recombinant enzyme successfully restored the activity from 12.1 ± 3.4 U/nM to 36.0 ± 0.7 U/nM, similar to one of the wild-type (33.9 ± 2.0 U/nM) in the presence of 150 mM sodium azide (Fig. 4B). These results indicate that the conserved tryptophan aids the catalytic base position to be in the proper active region. These experiments were carried out by DNS solution reacted detection and the azide and substrate
164
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
Fig. 4. Catalytic base rescue of the conserved tryptophan substituted EngZ. (A) The homology modeling analysis of EngZ. The putative interacting tryptophan residue (W29) is closest to W483. The putative active sites (D51 and D54) are located on the same line as W29. The putative residues that are related to W483 were labeled in red. (B) The enzyme reaction was performed with 1% (w/v) Avicel in the presence of 50 mM and 150 mM sodium azide. EngZ (closed diamond,) activity was not significantly increased with the increasing concentration of sodium azide, but, the W483A substitution enzyme (opened square,) activity was restored after treatment with 50 mM sodium azide. All of the experimental data and standard deviations were presented from three tests.
reaction without enzyme (8 M/min/ml in the presence of 50 mM azide and 8 M/min/ml in the presence of 150 mM azide) was not overhead the difference of the mutant enzyme reaction yields (27 M/min/ml in the presence of 50 mM azide and 35 M/min/ml in the presence of 150 mM azide) between without the sodium azide and with the sodium azide in the same reaction condition. These reactions were insignificantly influenced to the rescue mutant reaction by the activated azide. However, these reactions might not result from directly disturbed interaction between the conserved tryptophan and the inner active sites. Hence, we need to confirm the influence of CBM3c in the surface of the CD.
3.6. The conserved tryptophan on CBM3c protects the disulfide bond of the CD The surface of the CD plays a role in maintaining the folding structure under conditions of high temperature or low pH. In this study, we confirmed the surface stability by denaturant at elevated temperatures. The denaturant, DTT only cleaves disulfide bonds that are located on the surface. We measured the hydrophobic interacting fluorescence units at elevated temperatures in the absence of DTT or in the presence of various concentrations of DTT. The relative fluorescence unit (RFU) was calculated based on the highest variance of fluorescence intensity of each enzyme defined by 1.0 RFU. In the presence of 20 mM DTT, the W483A recombinant had a decreased RFU from 0.96 ± 0.01 RFU in the absence of DTT to 0.85 ± 0.03 RFU in the presence of 20 mM DTT at 64 ◦ C, whereas, the wild-type RFU was similar in both conditions (0.92 ± 0.03 RFU in the presence of 20 mM DTT and 0.95 ± 0.02 RFU in the absence of DTT at 64 ◦ C) (Fig. 5A and B). These results indicate that the W483 is involved in protecting the disulfide bond. The disulfide bond can be formed by cystein–cystein interaction. EngZ has eight cystein residues including C103, C174, C200, C258, C278, C330, C384 and C422 on the CD. Among them, C103, C174, C256, C330 and C422 residues are conserved with Cel9G. In the homology modeling, C422 is located near the putative active sites (D51 and D54) and C258 is located closer to C422 compared to other cysteines (Fig. 5C). These residues are also present in the Cel9G, including C422 and C257. The homology modeling indicates that the conserved tryptophan may interact with W29 on the CD and that their interaction plays a role in locating the catalytic base for suitable activation and for protecting the surface disulfide bond.
4. Discussion In endoglucanase reactions, the CBM usually brings the substrate into the active sites of the CD. If the distance between the CBM and the CD were short, it can significantly control the catalytic activation of the CD via interaction with the CBM. Cel9A and Cel9G which have high identities with EngZ show that CBM3c located on nearby CD is almost attached in the homology modeling (Fig. 1B). CBM3c may be significantly influencing the catalytic activity. In endoglucanases, the tryptophan on the CBM was a well-known player in the binding and the hydrolysis on soluble cellulose [28]. EngZ has two tryptophans on CBM3c and the primary residue (W483) is the conserved tryptophan compared to other GH9 endoglucanases containing CBM3c (Cel9I, Cel9A and Cel9G). We hypothesized that the conserved tryptophan (W483) plays an important role in the catalytic activity and investigated the substitution recombinant enzyme’s catalytic activity and binding affinity. The effect on reducing enzyme activity without changing the binding affinity of W483A recombinant induces the break-down of the initial activity [29]. The initial enzyme reaction required the substrate to enter into the substrate recognition pocket of the CD and the recognition pocket would maintain a suitable folding structure for the specific interaction between the cleavage site of substrate and the active site of the enzyme. Endoglucanase forms a cleft loop in the active site [30], hence, the reduced catalytic activities might be influenced by changing the location of the active cleft loop region. This is confirmed by the finding that the W483A recombinant did not increase on the growing concentration of amorphous cellulose. These measurements are only possible on the amorphous cellulose because the general kinetic measurement is not an exact linear growing rate in crystalline cellulose hydrolysis, thus, a processive hydrolysis mechanism cannot possibly be determined by the same experiment as amorphous cellulose hydrolysis [31]. However, we can inspect a part of the mechanism in crystalline cellulose by investigating the relationship of the active sites. Processive endoglucanase has an additional active site such as a catalytic base and this binds crystalline substrates and cleaves the substrate [21]. The EngZ has also additional active sites such as catalytic base (D51 and D54). The catalytic acid and catalytic base are performed together in crystalline cellulose hydrolysis as an inverting mechanism hence we can confirm the restored catalytic activity by using materials that instead lead to the catalytic activation. The dramatic recovery of catalytic base activity of the W483A recombinant in the presence of sodium azide might be influenced by changing the location of these active sites. The altered activation
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
165
Fig. 5. Weak surface disulfide bonds of the conserved tryptophan substituted EngZ were observed in the denatured form. The hydrophobic interacting fluorescent units were measured by the differential scanning fluorimetry (DSF) assay. At elevated temperatures, the initial unfolded states of the wild-type (A) and the W483A recombinant (B) were compared in the absence or the presence of DTT. Comparisons were made between those that were untreated (closed circle,), 20 mM DTT addition (opened circle,) and 100 mM DTT addition (opened triangle,). All of the data were presented from experiments in triplicate. (C) The partial 3D structure of EngZ was determined. The cystein residues that form disulfide bonds around the putative catalytic base were identified as C258 and C422. C422 is located close to the D54 residue and C258 is located on nearby C422, thus a disulfide bond can be formed with C422. The putative residues, which form a disulfide bond, were marked in red and the putative active sites were left unmarked.
of sodium azide made it possible to increase crystalline cellulose hydrolysis due to the buried active sites. These results indicate that the conserved tryptophan has an important role in driving the position of the active sites to the right location for the initiation of the enzyme reaction. This is confirmed by homology modeling, specifically that the conserved tryptophan was located close to the active site loop, thus, the conserved tryptophan could influence to movement of the catalytic base loop region. The conserved tryptophan interaction with the CD is possible by other tryptophan (W29) on CD that is located on surface of CD. The W29 is located in the same loop with the catalytic base sites. The conserved tryptophan substitution on the CBM may influence its expression at the surface region due to the substitution disrupting a strong hydrophobic interaction with W29. The surface stability was confirmed by measurement of hydrophobic intensity at elevated temperatures in the presence or absence of DTT. DTT disturbs the formation of a disulfide bond of the outer thiol group, thus, we can determine the movement of the thiol group. The hydrophobic intensity pattern makes it possible for us to indirectly detect the degree of rigidity of the folding structure at high temperatures. The hydrophobic intensity of W483A recombinant in the presence of 20 mM DTT was significantly decreased after the highest intensity point compared to one of the W483A recombinants in the absence of DTT (Fig. 5B). These results indicate that W483A con-
tributes to weak disulfide bond by the far distance between each cystein or by changes in the location of residues which form disulfide bonds from buried cystein residues into the easily exposed location to outer denaturant. In the primary hypothesis, the free cystein, which does not form a disulfide bond by longer distances, leads to decreased stability even in the absence of a denaturant [32]. However, the movement of the cystein does not significantly affect to the stability in the absence of a denaturant. The disulfide bond located near the catalytic base loop probably moved into the active site loop region, easily exposing it to outer materials resulting from the W483A substitution. The putative cystein residues were confirmed by homology modeling show that C422 and C258 are located near the putative active sites (Fig. 5C). These residues are not completely responsible for the formation of the disulfide bond, but, these residues have a high potential for forming the disulfide bond. These cystein residues were probably influenced by the substitution of conserved tryptophan. The conserved tryptophan on CBM3c probably interacts with surface tryptophan and the location is influenced to the surface disulfide bond stability. In conclusion, the CBM3c is important for the initial enzyme reaction unrelated to cellulose binding. The strong hydrophobic interaction between the CBM3c and the CD can make possible the positioning of the catalytic base sites and the nearby disulfide bond in the appropriate location. In this study, we confirmed the influ-
166
S.-J. Kim et al. / International Journal of Biological Macromolecules 92 (2016) 159–166
ence of only one hydrophobic interaction, but, these experiments can make the study of the structural mechanism around residues of W483 possible in future studies. This study can also support the potential possibility of the multiple applications of the CBM. Acknowledgements This work was supported by the Industrial Strategic Technology Development Program (10051513) funded by the Ministry of Trade, Industry & Energy (MI, Korea). References [1] J.S. van Dyk, B.I. Pletschke, A review of lignocellulose bioconversion using enzymatic hydrolysis and synergistic cooperation between enzymes—factors affecting enzymes, conversion and synergy, Biotechnol. Adv. 30 (2012) 1458–1480. [2] R. Gupta, Y.Y. Lee, Mechanism of cellulase reaction on pure cellulosic substrates, Biotechnol. Bioeng. 102 (2009) 1570–1581. [3] A.B. Boraston, D.N. Bolam, H.J. Gilbert, G.J. Davies, Carbohydrate-binding modules: fine-tuning polysaccharide recognition, Biochem. J. 382 (2004) 769–781. [4] S.D. Jeon, K.O. Yu, S.W. Kim, S.O. Han, The processive endoglucanase EngZ is active in crystalline cellulose degradation as a cellulosomal subunit of Clostridium cellulovorans, New Biotechnol. 29 (2012) 365–371. [5] Y. Li, D.C. Irwin, D.B. Wilson, Processivity, substrate binding, and mechanism of cellulose hydrolysis by Thermobifida fusca Cel9A, Appl. Environ. Microbiol. 73 (2007) 3165–3172. [6] R. Yennamalli, A. Rader, J. Wolt, T. Sen, Thermostability in endoglucanases is fold-specific, BMC Struct. Biol. 11 (2011) 1–15. [7] P.-H. Ferdinand, R. Borne, V. Trotter, S. Pagès, C. Tardif, H.-P. Fierobe, S. Perret, Are cellulosome scaffolding protein CipC and CBM3-containing protein HycP, involved in adherence of Clostridium cellulolyticum to cellulose? PLoS One 8 (2013) e69360. [8] T. Burstein, M. Shulman, S. Jindou, S. Petkun, F. Frolow, Y. Shoham, E.A. Bayer, R. Lamed, Physical association of the catalytic and helper modules of a family-9 glycoside hydrolase is essential for activity, FEBS Lett. 583 (2009) 879–884. [9] T. Arai, A. Kosugi, H. Chan, R. Koukiekolo, H. Yukawa, M. Inui, R.H. Doi, Properties of cellulosomal family 9 cellulases from Clostridium cellulovorans, Appl. Microbiol. Biotechnol. 71 (2006) 654–660. [10] H. Hashimoto, Recent structural studies of carbohydrate-binding modules, Cell. Mol. Life Sci. 63 (2006) 2954–2967. [11] Y. Wang, H. Yuan, J. Wang, Z. Yu, Truncation of the cellulose binding domain improved thermal stability of endo--1,4-glucanase from Bacillus subtilis JA18, Bioresour. Technol. 100 (2009) 345–349. [12] Y. Zhu, M. Zhang, R. Amber Kelly, A. Cheng, The carbohydrate-binding domain of overexpressed STBD1 is important for its stability and protein–protein interactions, Biosci. Rep. 34 (2014) e00117. [13] T. Le Costaouëc, A. Pakarinen, A. Várnai, T. Puranen, L. Viikari, The role of carbohydrate binding module (CBM) at high substrate consistency: comparison of Trichoderma reesei and Thermoascus aurantiacus Cel7A (CBHI) and Cel5A (EGII), Bioresour. Technol. 143 (2013) 196–203. [14] Q. Yin, Y. Teng, M. Ding, F. Zhao, Site-directed mutagenesis of aromatic residues in the carbohydrate-binding module of Bacillus endoglucanase EGA decreases enzyme thermostability, Biotechnol. Lett. 33 (2011) 2209–2216.
[15] D. Guillén, S. Sánchez, R. Rodríguez-Sanoja, Carbohydrate-binding domains: multiplicity of biological roles, Appl. Microbiol. Biotechnol. 85 (2010) 1241–1249. [16] N. Din, I.J. Forsythe, L.D. Burtnick, N.R. Gilkes, R.C. Miller, R.A.J. Warren, D.G. Kilburn, The cellulose-binding domain of endoglucanase A (CenA) from Cellulomonas fimi: evidence for the involvement of tryptophan residues in binding, Mol. Microbiol. 11 (1994) 747–755. [17] A. Nakamura, T. Tsukada, S. Auer, T. Furuta, M. Wada, A. Koivula, K. Igarashi, M. Samejima, The tryptophan residue at the active site tunnel entrance of Trichoderma reesei cellobiohydrolase Cel7A is important for initiation of degradation of crystalline cellulose, J. Biol. Chem. 288 (2013) 13503–13510. [18] R. Sleat, R.A. Mah, R. Robinson, Isolation and characterization of an anaerobic, Cellulolytic bacterium, Clostridium cellulovorans sp. nov, Appl. Environ. Microbiol. 48 (1984) 88–93. [19] W. Zhou, D.C. Irwin, J. Escovar-Kousen, D.B. Wilson, Kinetic studies of Thermobifida fusca Cel9A active site mutant enzymes, Biochemistry 43 (2004) 9655–9663. [20] J. Sakon, D. Irwin, D.B. Wilson, P.A. Karplus, Structure and mechanism of endo/exocellulase E4 from Thermomonospora fusca, Nat. Struct. Mol. Biol. 4 (1997) 810–818. [21] D. Mandelman, A. Belaich, J.P. Belaich, N. Aghajari, H. Driguez, R. Haser, X-ray crystal structure of the multidomain endoglucanase Cel9G from Clostridium cellulolyticum complexed with natural and synthetic cello-oligosaccharides, J. Bacteriol. 185 (2003) 4127–4135. [22] G.L. Miller, Use of dinitrosalicylic acid reagent for determination of reducing sugar, Anal. Chem. 31 (1959) 426–428. [23] N.R. Gilkes, E. Jervis, B. Henrissat, B. Tekant, R.C. Miller, R.A. Warren, D.G. Kilburn, The adsorption of a bacterial cellulase and its two isolated domains to crystalline cellulose, J. Biol. Chem. 267 (1992) 6743–6749. [24] M. Kostylev, D.B. Wilson, Determination of the catalytic base in family 48 glycosyl hydrolases, Appl. Environ. Microbiol. 77 (2011) 6274–6276. [25] E. Ablinger, S. Leitgeb, A. Zimmer, Differential scanning fluorescence approach using a fluorescent molecular rotor to detect thermostability of proteins in surfactant-containing formulations, Int. J. Pharm. 441 (2013) 255–260. [26] Y. Li, D.C. Irwin, D.B. Wilson, Increased crystalline cellulose activity via combinations of amino acid changes in the family 9 catalytic domain and family 3c cellulose binding module of Thermobifida fusca Cel9A, Appl. Environ. Microbiol. 76 (2010) 2582–2588. [27] W.-Y. Chou, T.-W. Pai, T.-Y. Jiang, W.-I. Chou, C.-Y. Tang, M.D.-T. Chang, Hydrophilic aromatic residue and in silico structure for carbohydrate binding module, PLoS One 6 (2011) e24814. [28] R. Macarrón, B. Henrissat, M. Claeyssens, Family a cellulases: two essential tryptophan residues in endoglucanase III from Trichoderma reesei, Biochim. Biophys. Acta – Gen. Subjects 1245 (1995) 187–190. [29] Z. Shu, Y. Wang, L. An, L. Yao, The slowdown of the endoglucanase Trichoderma reesei Cel5A-catalyzed cellulose hydrolysis is related to its initial activity, Biochemistry 53 (2014) 7650–7658. [30] L. Poidevin, J. Feliu, A. Doan, J.-G. Berrin, M. Bey, P.M. Coutinho, B. Henrissat, E. Record, S. Heiss-Blanquet, Insights into exo- and endoglucanase activities of family 6 glycoside hydrolases from Podospora anserina, Appl. Environ. Microbiol. 79 (2013) 4220–4229. [31] J.M. Fox, S.E. Levine, D.S. Clark, H.W. Blanch, Initial- and processive-cut products reveal cellobiohydrolase rate limitations and the role of companion enzymes, Biochemistry 51 (2012) 442–452. [32] A. Hernández-Santoyo, L. Domínguez-Ramírez, C.A. Reyes-López, E. González-Mondragón, A. Hernández-Arana, A. Rodríguez-Romero, Effects of a buried cysteine-to-serine mutation on yeast triosephosphate isomerase structure and stability, Int. J. Mol. Sci. 13 (2012) 10010–10021.