- Email: [email protected]
MUTATIONAL ANALYSIS OF CHICKEN INTERLEUKIN 2
doi:10.1006/cyto.2001.0846, available online at http://www.idealibrary.com on
MUTATIONAL ANALYSIS OF CHICKEN INTERLEUKIN 2 Jill E. Kolodsick, Jolie A. Stepaniak, Wanping Hu, Roy S. Sundick Chicken interleukin 2 (chIL-2) has low, but significant, homology to both mammalian IL-2 and mammalian IL-15. In view of its unique phylogenetic position and potential use as a vaccine adjuvant, a detailed mutational analysis for critical functional sites was undertaken. It was found that Asp17 is a critical N terminal contact site for binding to the putative chIL-2 receptor, which is similar to results obtained for mammalian IL-2 and IL-15. Analysis of the C terminus did not reveal a single critical amino acid. However, deletion mutant studies demonstrated that removal of C terminal amino acids yielded proteins with decreased bioactivity and that this decrease was a function of the number and kind of amino acids removed. This study is the first nonmammalian IL-2 mutational analysis and proposes a model for the interaction between chIL-2 and its receptor. 2001 Academic Press
Interleukin 2 (IL-2) was originally described in 1976 as a factor produced by activated lymphocytes that induces proliferative responses in T cells and supports long term growth of bone marrow-derived cells.1 The gene for human IL-2 was cloned and sequenced in 1983.2 It encodes a 133 amino acid glycoprotein with a molecular weight of 15–18 kDa.3 In vivo and in vitro studies of recombinant IL-2 have determined roles for this cytokine in the growth and differentiation of T cells, B cells, monocytes and natural killer (NK) cells.1,4 The important immunoregulatory role of IL-2, as well as the therapeutic promise it holds for the treatment of certain cancers and infectious diseases, has made it the focus of numerous structure–function studies.4 Aims of these studies included obtaining structural derivatives of IL-2 that antagonize its action and identifying sequences not required for activity.5 IL-2 antagonists were sought to elucidate potential activities of the interleukin, whereas agonists were proposed to have pharmacologic benefits. The first mutational analysis of mouse IL-2 (mIL-2) identified the N terminal region between amino acids 14 and 37 From the Department of Immunology and Microbiology, Wayne State University, Detroit, Michigan, USA Correspondence to: Dr Roy Sundick, Wayne State University, Department of Immunology and Microbiology, 540 East Canfield, 117 Lande, Detroit, MI 48201, USA. E-mail: [email protected] Received 30 August 2000; received in revised form 18 November 2000; accepted for publication 28 January 2001 2001 Academic Press 1043–4666/01/060317+08 $35.00/0 KEY WORDS: IL-2/mutagenesis/structure–function/T cell CYTOKINE, Vol. 13, No. 6 (21 March), 2001: pp 317–324
as a region important for biological activity, as defined by induction of T cell proliferation.5 Functional domains of human IL-2 were then identified using oligonucleotide-directed mutagenesis.6 These results indicated that the N terminal 20 amino acids, the C terminal 13 amino acids, and two of the three cysteine residues must be retained for bioactivity. Analysis of the N terminus revealed that a conservative substitution at residue Leu17 (Leu
318 / Kolodsick et al.
amino acid substitutions (C125S, Q126E, I128K, S130D or L132E) in this study did not affect the activity of the rIL-2 protein. Furthermore, deletion of the terminal four amino acid residues (Ser130 through Thr133) did not reduce bioactivity.6 Since deletions of the terminal ten amino acids, but not substitutions within this area, affected activity, the authors concluded that the structural characteristics or spacing of amino acids in the C terminus must be maintained, rather than a specific primary amino acid sequence.6 Further studies on human and mouse IL-2 raised the question of whether a specific residue in the C terminus, Q126 in human IL-2 and Q141 in mouse, is a receptor contact residue or only allosterically influences binding.10,14,15 The role of residue Q126 in human IL-2 and the corresponding residue Q141 in murine IL-2 was revisited during mutational studies with human interleukin 15. Interleukin 2 and interleukin 15 share many biological activities, as well as the use of both the and subunits of the IL-2 receptor. A study of interleukin 15 mutants (IL-15 D8S and IL-15 Q108S) demonstrated that these mutations did not preserve the bioactivity of the cytokine.16 Since Asp8 in human IL-15 aligns with Asp20 in human IL-2, and residue Q108 in IL-15 aligns with Q126 in human IL-2, it became accepted that those residues (D and Q) were the critical amino acids for interaction with the and chains of the shared interleukin 2 receptor. All of the IL-2 mutational analyses described thus far have been performed on mammalian IL-2. In 1997, our laboratory cloned a gene for a chicken IL-2-like molecule using expression library screening.17 ClustalW alignments18 revealed that this chicken cytokine had 24–25% amino acid identity and 44–46% similarity to both bovine IL-2 and IL-15. In fact, the chicken protein was more closely related to both the mammalian cytokines than the latter were to each other. Chicken IL-2 (chIL-2) has characteristics similar to both mammalian IL-2 and mammalian IL-15. Like mammalian IL-2, chIL-2 is expressed by activated T cells, and has a 22 amino acid signal sequence, which is similar in size to mammalian IL-2 signal sequences. The mRNA of mammalian IL-2 has a short 5 region preceding the open reading frame of the gene, as does chIL-2. Chicken IL-2 is more similar to mammalian IL-15 in that it has four cysteine residues within the sequence of the mature protein that may allow for two intrachain disulfide bonds, while mammalian IL-2 has only three cysteine residues allowing for only one intrachain disulfide bond. Sequence analysis of the gene showed that the genomic structure was remarkably similar to mammalian IL-2 genes.19 The chIL-2 promoter is extremely homologous to the promoter of mammalian interleukin 2, and the majority of the transcription factor binding sites are conserved.19
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324)
Furthermore, a molecule that is clearly chicken IL-15, based on homology studies, has been cloned (GenBank accession number AF152927). Our laboratory has produced recombinant chicken IL-2 from Escherichia coli using the pET protein purification system (NOVAGEN, Madison, WI, USA).20 Recombinant chicken IL-2 has a powerful proliferative effect on cultures of activated chicken spleen cells, but it does not stimulate CTLL cells, a murine cell line responsive to mammalian IL-2 and IL-15.20 Polyclonal anti-chIL-2 antibodies do not inhibit CTLL activation by mammalian IL-2 or IL-15.20 Therefore, although recombinant chIL-2 performs functions within the chicken system which are analogous to the actions of mammalian IL-2 and IL-15, such as activation of spleen cells, it appears structurally different from mammalian IL-2 and IL-15. Mutational analysis of chicken IL-2 was undertaken for two reasons. First, it is an ideal molecule to study the phylogenetic relationship between mammalian IL-2 and IL-15, being similar to both and yet derived from a lower vertebrate. Emphasis was placed on the receptor-binding regions for comparison with their extensively studied mammalian counterparts. Second, chickens are a valuable food source and, under existing growing conditions, are highly susceptible to infectious agents. A major emphasis in the industry has been research on improving the health of chickens, including the use of immune stimulators and the development of improved vaccines. Detailed analysis of chicken IL-2 is expected to increase its utility as a vaccine adjuvant and enable its use as an in vitro growth promoter for avian T and NK cells. We focused our studies on those regions of chicken IL-2 that align with human IL-2 regions known to interact with the and chains of the receptor. We did not analyse regions of chicken IL-2 which correspond with mammalian chain contact residues, because these regions are less defined in mammals and none of the proposed critical amino acids (Lys35, Arg38, Phe42, or Lys43) align with homologous residues in the chicken.21 This report provides insight on the structure of chicken interleukin 2 and allows identification of specific amino acids whose integrity must be maintained for biological activity.
RESULTS Previous studies with human IL-2 have reported that mutation of Asp20 is detrimental to biological activity.7,8,12,13 Chicken IL-2 contains an aspartic acid at position 17 that aligns with residue 20 in human IL-2 (Fig. 1). We generated the chicken IL-2 analog D17A and assessed its biological activity in a proliferation assay using chicken T cell blasts. A dramatic
Mutational analysis of chIL-2 / 319
Figure 1.
ClustalW alignment of mature human IL-2, human IL-15, and chicken IL-2.
Stimulation index ± SE
Chicken residues 17, 113 and 121 are highlighted.
TABLE 1. Percentage of wild-type activity at 10 8 M and 10 9 M for all C terminal mutants containing a single amino acid substitution
6 5 4
Chicken IL-2 mutant
3 2 1 0
–7
–8
–9
–10
–11
log[concentration(M)] Figure 2. The bioactivity of purified recombinant chicken IL-2 and purified chIL-2 D17A on ConA-activated chicken splenocytes, expressed as stimulation indices. Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 D17A, – – – –.
reduction in the proliferative response to chIL-2 D17A was seen in comparison to chIL-2 (Fig. 2). Assuming that the substitution of the alanine residue for the aspartic acid residue does not grossly alter the structure of chicken IL-2, this observation suggests that the carboxylic acid in the side chain of the aspartic acid residue is critical for full biological activity of the protein. Unlike the N terminal residue that is critical for binding to the chain in the mammalian system, the importance of the critical region in the C terminus, which binds to the of the trimeric IL-2 receptor, is less well-defined. Mammalian studies propose Q126 as an amino acid that interacts with the chain of the IL-2 receptor.6,7,10,14,22 Chicken IL-2 has an arginine at the corresponding location (117). However, it does have an asparagine at position 114 and a glutamine at position 120 of the mature protein (Fig. 1). We under-
chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2
T113A N114A F115A V116A V116F R117A Y118A L119A Q120A K121A
Percentage of wild-type activity at 10 8 M
Percentage of wild-type activity at 10 9 M
89 87 76 94 88 78 94 90 83 74
104 96 77 111 78 95 112 98 102 78
took our analysis of the C terminus of chicken IL-2 by constructing a series of chicken IL-2 muteins that contain single amino acid substitutions with alanine in the region 113-121. These analogs: T113A, N114A, F115A, V116A, R117A, Y118A, L119A, Q120A and K121A were then tested in the splenocyte proliferation assay. Residue 116 is a valine, therefore we also constructed V116F, since V116A is a conservative substitution. None of the C terminal point mutations substantially compromised the proliferative activity of chicken IL-2 (Table 1). This suggested that instead of a single residue being necessary for proliferative function in the C terminus of chicken IL-2, multiple residues may be required. A series of chIL-2 C terminal deletion mutants were then prepared: 113–121, 116–121 and 119–121, lacking the terminal nine, six or three amino acids, respectively, of the C terminus. None of the deletion mutants (113–121, 116–121, 119–121)
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324)
6
Stimulation index ± SE
Stimulation index ± SE
320 / Kolodsick et al.
5 4 3 2 1 0
–7
–8
–9
–10
–11
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
–7
Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 113–121, — —; chIL-2 116–121, – – – –; chIL-2 119–121, — —.
preserved wild-type function (Fig. 3). Mutant 113– 121 was not active at any concentration range employed, while mutants 116–121 and 119–121 were active only at the highest concentration (110 7 M) used in our assay system. This suggests that deletion of the last three amino acids either deleted residues critical for interacting with the chIL-2 receptor, or deleted residues critical for the proper formation/folding of the protein. To identify whether the last three amino acids contain side chains required for interaction with the chicken IL-2 receptor, we constructed another set of alanine substitutions producing three double alaninesubstituted analogs and one triple alanine-substituted analog. These mutants, L119A/K121A, L119A/ Q120A, Q120A/K121A, L119A/Q120A/K121A, all maintained bioactivity indicating that the C terminus of chicken IL-2 is tolerant to numerous alterations (Fig. 4). Following this analysis, it was concluded that none of the side chains of the three C terminal amino acids were critical for bioactivity. However, deletion mutants, 113–121, 116–121 and 119–121 did not preserve wild-type function. Therefore, two additional deletion mutants were made, 120–121 and 121. When tested in the chicken proliferation assay it was evident that the main chain backbone of the C terminus must be maintained, because removal of one amino acid from the C terminus slightly decreased activity (Fig. 5), removal of two amino acids had a greater effect (Fig. 5), and removal of three, six or nine amino acids yielded successive declines in function (Fig. 3 and Table 2). In an attempt to perturb the secondary structure of the C terminus we constructed a chicken IL-2 analog that replaced Q120 with an aspartic acid. We hypothesized that substitution of a terminal amide group with a carboxyl group would alter the C terminal tertiary
–9
–10
–11
Figure 4. The bioactivity of purified recombinant chicken IL-2, purified double alanine-substituted analogs, and the triple alaninesubstituted analog measured on ConA-activated chicken splenocytes, expressed as stimulation indices. Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 L119A/K121A, — —; chIL-2 L119A/Q120A; — —; chIL-2 Q120A/K121A, – – – –; chIL-2 L119A/Q120A/K121A, — —.
Stimulation index ± SE
Figure 3. The bioactivity of purified recombinant chicken IL-2 and purified C terminal deletion analogs on ConA-activated chicken splenocytes, expressed as stimulation indices.
–8
log[concentration(M)]
log[concentration(M)]
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
–7
–8
–9
–10
–11
log[concentration(M)] Figure 5. The bioactivity of purified recombinant chicken IL-2 and purified C terminal deletion analogs measured on ConA-activated chicken splenocytes, expressed as stimulation indices. Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 121, – – – –; chIL-2 120–121, — —.
TABLE 2. Percentage of wild-type activity for all mutants with compromised activity Chicken IL-2 mutant chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2
D17A 121 120–121 119–121 116–121 113–121 113–121 substituted*
Percentage of wild-type activity at 10 8 M 4 68 35 33 15 2
*The final nine amino acids (TNFVRYLQK) were replaced with KFERQHMDS.
structure. A murine analog with this single amino acid substitution was reported to be a potent antagonist of some IL-2-dependent cell lines.10 In contrast, the chicken analog Q120D maintained full biological activity (data not shown). An additional mutant in which all the last nine amino acids were replaced
Stimulation index ± SE
Mutational analysis of chIL-2 / 321
8 7 6 5 4 3 2 1 0 –5.8
DISCUSSION ConA Supernatant alone ± SE
–6
–6.2
–6.4
–6.6
–6.8
–7
–7.2
log[concentration(M)] Figure 6. Inhibition of the bioactivity of native chIL-2 (5% ConA supernatant) by chIL-2 mutants. The solid line represents the level of proliferation induced by ConA supernatant alone, and hatched lines represent the standard error. The recombinant proteins added as inhibitors were Control Protein (– – – –), DEL 113–121 (— —), DEL 116–121 (— —), and DEL 119–121 (– – – –). Data points are averages (n=3) and error bars were determined by calculating standard error of the mean.
with nine random, non-conservative substitutions (KFERQHMDS) delineated whether such substitution would yield a functional lymphokine. This mutant, chIL-2 113–121 substituted, did not preserve wild-type function (Table 2). Therefore, the C terminus is not flexible enough to allow for nine non-conservative substitutions, however multiple double alanine substitutions, a triple alanine substitution, and a nonconservative substitution (Q120D) did not alter the proliferative activity of the molecule. To determine if alterations of chicken IL-2 produce an antagonist, the seven mutants that did not preserve wild-type function were tested for their ability to inhibit chIL-2-induced proliferation. For this purpose, chicken T cell blasts were cultured in the presence of a suboptimal concentration of wild-type chicken IL-2 and either increasing concentrations of chicken IL-2 analogs or control protein (the 15 kDa tag portion of proteins produced in the pET system). Only mutants 116–121 and 119–121 consistently inhibited recombinant chIL-2 when used at 500–1000-fold the concentration of wild-type (data not shown). This set of experiments was repeated to evaluate the ability of the mutants to inhibit native wild-type chIL-2. Supernatants from Concanavalin A (ConA)-activated splenocytes served as a source for native wild-type chicken IL-2. At a high concentration of recombinant protein used (110 6.1 M), the control protein slightly decreased the proliferative response to native wild-type IL-2. However, mutants 116–121 and 119–121 dramatically inhibited proliferation induced by wild-type native chIL-2 (Fig. 6). Interestingly, these mutants decreased the level of proliferation below background (i.e. a stimulation index less than 1.0), indicating that they not only inhibited the IL-2 that was added into the culture system, but they also inhibited IL-2 that was produced endogenously by the activated T cells employed in the assay.
This report is the first to describe mutational analysis of a non-mammalian IL-2 molecule. Previous work compared the amino acid sequence of chicken IL-2 with mammalian homologs, showing that the overall structure of chicken IL-2 is very similar to that of mouse and human IL-2.19 In our mutational analyses, we determined that residue D17 of chicken IL-2 is critical for function. Since this site aligns with D20 of human IL-2, which is a contact residue between IL-2 and the chain of the receptor in mammalian systems, we suggest that D17 is an N terminal contact residue between chIL-2 and the chIL-2 receptor. In the mammalian IL-2 system, the structure– function relationship of the C terminus is unclear. Some mutational analyses conclude that residue Q126 in human and residue Q141 in mouse interact directly with the chain of the IL-2 receptor.10,14 Other C terminal studies concluded that this region plays a structural role in the conformation of IL-2 rather than a direct role in binding.6,7,22 Finally, the most recent study of residue Q126 of human IL-2 concluded that it is likely that position 126 is a receptor contact position. However, this report did not exclude the possibility that alteration of this position allosterically influences receptor interaction.15 These studies were performed before the functions of the separate IL-2 receptor chains were known. The current understanding of the function of the IL-2R chain illustrates why these studies yielded conflicting results. The model postulates an initial interaction between IL-2 and the IL-2R and IL-2R chains, followed by recruitment of the chain into the complex.23 The association of the chain with the receptor complex switches the receptor from an inactive to the active state, required for intracellular signaling.23 Unlike the IL-2R and IL-2R chains, the IL-2R chain has no measurable affinity for interleukin 2.23 Therefore, since the chain is important for signaling and not for binding to interleukin 2, studies that evaluated the binding of C terminal mutants to the IL-2R may have given misleading conclusions. The present report suggests that there is no receptor contact site within the nine C terminal amino acids of chicken interleukin 2. Results from the alanine substitution studies determined that the substitution of an alanine residue at any of positions 113 through 121 is neutral with respect to protein activity. Therefore, within residues 113–121, no specific residue is necessary for activity. Furthermore, all of the chicken IL-2 deletion mutants demonstrated varying degrees of decreased bioactivity as compared to the wild-type. However, the analogs with double and triple alanine substitutions in regions 119–121 were fully active. Hence, the effects of the deletion mutants were likely
322 / Kolodsick et al.
due to a local instability of the putative helix in this region, rather than the removal of critical amino acid side groups that interact with the receptor. The lack of a contact residue in the C terminus of chicken IL-2 allows for great flexibility in manipulations of the molecule. Mammalian studies suggest that interleukin 2 offers enhanced protection when administered as part of a fusion protein.24 Previous work by this laboratory determined that addition of a short stretch of histidine residues at the C terminus does not alter bioactivity.20 The present report demonstrates that as many as three terminal amino acids can be substituted with alanine residues without affecting function. Therefore, production of a functional chIL-2 fusion protein should be feasible provided that the backbone of the C terminus is maintained. Although chIL-2 has low sequence homology to mammalian IL-2 and IL-15 and does not activate or bind the standard mammalian cell line for IL-2 and IL-15 bioassays,17,20 the present report suggests that structural homology exists between chicken interleukin 2 and mammalian IL-2 and IL-15. All of the human and mouse interleukin 2 reports describe residues D20 or D34, respectively, as contact residues between interleukin 2 and the interleukin 2 receptor.5,8–13 The human interleukin 15 mutational study determined that D8 of IL-15 was a receptor contact site.16 Chicken IL-2 D17 aligns with the receptor contact sites of both human and mouse IL-2 as well as human IL-15 and, as demonstrated in this report, is a receptor contact site between chIL-2 and the chicken IL-2 receptor. Therefore, although the complete sequence of chIL-2 has low homology to mammalian IL-2, an N terminal receptor contact site is identical. Also, the present analysis of chicken interleukin 2 revealed that the structural integrity of the C terminus must be conserved for bioactivity. This conclusion supports the earlier controversial mammalian interleukin 2 studies which determined that the structural integrity of the helix in this region is important for bioactivity, rather than one specific residue,6,7,22 and suggests that there are structural characteristics that have been phylogenetically conserved between mammalian IL-2 and chicken IL-2. The work described here advances our understanding of the structure–function relationship of chicken interleukin 2 and, by analogy, mammalian IL-2 and IL-15. This work also provides analogs of chicken interleukin 2 with reduced functional activity. These analogs will be used in chicken interleukin 2 signaling assays to determine the signal cascade upon activation with interleukin 2 and interleukin 2 analogs. Monoclonal antibody epitope mapping will be performed utilizing the analogs of chicken interleukin 2 that demonstrate compromised bioactivity, to confirm regions of chicken IL-2 described in this report as necessary for function. Continued studies with chicken
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324)
interleukin 2 and receptor-bearing lymphocytes will advance our understanding of chicken lymphocyte activation, the structure of chicken IL-2, the general immune response in chickens, and phylogenetic comparisons of mammalian and non-mammalian cytokines.
MATERIALS AND METHODS Production of biologically active chicken IL-2 The chicken IL-2 cDNA encoding the 121 amino acid mature interleukin 2 protein was obtained by PCR using the PCR 3.1 plasmid (InVitrogen, Carlsbad, CA, USA) containing the IL-2 gene as template cDNA and the following primers: forward primer, 5 GCTACCATGGGCGCATCTC TATCATCA3 , reverse primer, 5 CGGCGCTCAGCTTAT TTTTGCAGATA3 . The primers were constructed with NcoI and BPU1102 restriction sites. PCR was performed under the following conditions: 1 min 94C denaturation, 1 min 55C annealing, and 1 min 72C elongation, for 35 cycles. The PCR product was purified with the Geneclean kit (Bio 101, Carlsbad, CA, USA) and then used in a ligation reaction (T4 DNA ligase, Gibco, Gaithersburg, MA, USA) with pCR3.1-Uni vector (Eukaryotic TA Cloning Kit, InVitrogen). One Shot (TOP 10F ) cells (Eukaryotic TA Cloning Kit, InVitrogen) were transformed with this ligation mixture and the plasmid DNA was isolated using the Qiagen mini-plasmid preparation protocol. A restriction digest with endonuclease NcoI and NotI (Gibco), was performed for isolation of the PCR product from the PCR3.1-Uni vector. The isolated product was then ligated into the pET32a+ vector (NOVAGEN), and JM109 cells were transformed with this ligation mixture. Plasmid DNA was isolated (Qiagen, Valencia, CA, USA) from JM109 transformants and AD494(DE3) host cells (NOVAGEN) were transformed with the pET32a+ vector containing the chicken IL-2 insert. Production of recombinant protein was performed as described in Stepaniak et al.20 Briefly, transformed AD494(DE3) cells containing the chicken IL-2 gene were grown until OD600 =0.6 was attained. IPTG was added (1 mM), cells were incubated for 1 h at 30C, shaken on ice for 1 h, and then harvested by centrifugation at 5000g for 5 min, at 4C. Cell pellets were resuspended in 0.1% Triton X-100 and binding buffer (NOVAGEN). Resuspended pellets were sonicated on ice for 3 min and then centrifuged. The supernatant was filtered and loaded onto a nickel column (NOVAGEN). Column chromatography was performed according to the pET System manual, with the substitution of a 35 mM imidazole wash for a 60 mM imidazole wash. Protein products produced using the pET system are initially fusion proteins containing a 16 700 Da tag on the amino end. The tag consists of thioredoxin, an S tag, and a stretch of six histidines. The entire tag can be removed using enterokinase, or the thioredoxin portion of the tag can be removed using thrombin. All experiments discussed were performed with uncleaved fusion protein. However, we have demonstrated that a mixture of cleaved IL-2 and tag has the same biological activity in vitro as chIL-2 fused with the
Mutational analysis of chIL-2 / 323
TABLE 3.
Primers used for PCR mutagenesis
Analog
D17A T113A N114A F115A V116A V116F R117A Y118A L119A Q120A K121A 113–121 116–121 119–121 chIL-2 113–121 substituted* L119A/K121A L119A/Q120A L119A/Q120A/K121A 120–121 121 Q126D
Primer orientation
forward reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse
Primer sequence 5 GCGCGCCATGGGCGCATCTCTATCATCAGCAAAAAGGAAACCTCTTCAAACATTAATAAAGGCTTTAGAAATA3 5 ATGCCGCGGCCGCTTATTTTTGTGCATATCTCAC3 5 ATGCCGCGGCGGCTTATTTTTGCAGATATCTCACAAAGGCGGTCAGTTC3 5 ATACCGCGGCCGCTTATTTTTGCAGATATCTCACTGCGTTGGTCAG3 5 ATACCGCGGCCGCTTATTTTTGCAGATATCTTGCAAAGTTGGT3 5 GCGCCGCGGCCGCTTATTTTTGCAGATATCTAAAAAAGTTGGT3 5 ATGCCGCGGCCGCTTATTTTTGCAGATATGCCACAAAGTT3 5 ATGCCGCGGCCGCTTATTTTTGCAGTGCTCTCACAAA3 5 ATGCCGCGGCCGCTTATTTTTGTGCATATCTCAC3 5 ATGCCGCGGCCGCTTATTTTGCCAGATATCTCAC3 5 ATTACCGCGGCCGCTTATGCTTGCAGATA3 5 ATACCGCGGCCGCTTACAGTTCATGGAGAAAATC3 5 ATACCGCGGCCGCTTAAAAGTTGGTCAGTTC3 5 AGGCCGCGGCCGCTTAATATCTCACAAAGTT3 5 ATTTCGAATATCGAATTCTTAGCTGTCCATGTGCTGGCGTTCGAATTTCAGTTCATGAGAAAATC3 5 ATTACGCGGCTTATGCTTGCGCATATCTCACAAAGTTGGTCAGTTCATGGAG3 5 ATTACGCGGCCGCTTATTTCGCTGCATATCTCACAAACTTGGTCAGTTCATGGAG3 5 ATTACGCGGCCGCTTATGCCGCTGCATATCTCACAAAGTTGGTCAGTTCATGGAG3 5 AGGCCGCGGCCGCTTACAGATATCTCACAAAGTTGGTCAGTTCATG3 5 ATTACGCGGCCGCTTATTGCAGATATCTCACAAAGTTGGTCAG3 5 ATTACGCGGCCGCTTATTTATCCAGATATCTCACAAAGTTGGTCAG3
*The final nine amino acids (TNFVRYLQK) were replaced with KFERQHMDS.
tag. Also, we have produced the tag alone and determined that it was non-stimulatory in proliferation assays when used at a concentration of 110 7 M (data not shown). Recombinant chicken IL-2 induces maximal stimulation in the proliferation assay at concentrations of 110 7 M through 110 9 M.
Production of chIL-2 muteins Table 3 contains the primers used for subcloning the chIL-2 muteins. The forward primer contains an NcoI site, and each reverse primer contains an NotI sites. This represents a change from the chIL-2 reverse primer, which contained a BPU1102 restriction site. This change in the restriction site of the reverse primers allowed the PCR products to be subcloned directly into the pET32a+ vector. After identification and confirmation of these mutations by sequence analysis, the 21 mutants were individually cloned into the pET32a+ vector. Production of purified protein was performed as described above.
Chicken spleen cell proliferation assay The bioassay for chicken interleukin 2 and interleukin 2 analogs was performed as previously described.17,20 Briefly, a spleen was removed from a 6-week fryer (Capital Poultry, Detroit, MI, USA; Chase Poultry, Dearborn, MI, USA), passed through a stainless steel screen, washed three times in Iscoves, and then cultured in 75 cm2 flasks in Iscoves, bovine serum albumin (BSA; 2 mg/ml), and Concanavalin A (ConA; 10 g/ml) (Sigma Chemical Co., St. Louis, MO, USA) at 40C in 5% CO2. After 24 h, the culture was dispersed into single cells, diluted with Iscoves’ modified Dulbecco’s medium (1:1). Chicken serum (Sigma) was added to yield a final concentration of 2%. Then, -methyl manno-
pyrannoside (Sigma) was added to a final concentration of 0.05 M and cells were reincubated for 2–4 days at 40C in 5% CO2. For use in the proliferation assay 8 ml of the 3–5 day cell culture was layered onto 5 ml of Histopaque (Sigma) at room temperature and centrifuged at 400g for 20 min. The cells at the interface were removed, washed three times in Iscoves, and resuspended in Iscoves, BSA (2 mg/ml), pen/ strep and 2% chicken serum, at a concentration of 2.2105 cells/ml. Recombinant protein was then placed in 96-well round-bottom plates at various concentrations and the chicken blasts were added at 2104 cells per well. Plates were incubated overnight at 40C in 5% CO2, and pulsed for the last 6 h with 1.0 Ci of 3H-thymidine in the presence of 10 6 M fluorodeoxyuridine. Cells were harvested 6 h later on glass fiber filters using an automated harvester and counted in a liquid scintillation counter. The percentage of wild-type activities of the muteins shown in Tables 1 and 2 were calculated by the following formula, where a negative percentage represents proliferation below background: Percentage of Wild-type Activity= Mutant (CPM)Background (CPM) Wildtype (CPM)Background (CPM)
100%
Inhibition assay testing the ability of the chicken IL-2 muteins to inhibit chicken IL-2 induced proliferation Chicken spleen cells were isolated, cultured, and prepared for the assay as described above, except a specific chicken IL-2 mutant was added to each well, followed by wild-type chIL-2 (similar to mammalian inhibition assays12,16). The concentration of mutant chicken IL-2 used
324 / Kolodsick et al.
ranged from 1- to 1000-fold excess over wild-type chicken IL-2. The plates were returned to the 40C incubator for 30 min. At the end of this incubation period, cells were added as described above and the plates were returned to the incubator. The next morning, plates were pulsed with 1.0 Ci of 3H-thymidine in the presence of 10 6 M fluorodeoxyuridine, and reincubated at 40C for 6 h. Cells were harvested on glass fiber filters using an automated harvester and counted in a liquid scintillation counter.
Acknowledgments The authors would like to thank Dr Myron A. Leon for his insightful discussion during the course of this work and critical review of this manuscript, and Kevin J. Kolodsick for his advice and assistance with manuscript preparation. This work was funded by USDA grant 9702418.
REFERENCES 1. Rubin JT (1995) Interleukin-2: Its rationale and role in the treatment of patients with cancer. In: Kurzrock R (ed.) Cytokines: Interleukins and their Receptors. Kluwer Academic Publishers, pp 83–90. 2. Taniguchi T, Matsui H, Fujita T, Takaoka C, Kashima N, Yoshimoto R, Hamuro J (1983) Structure and expression of a cloned cDNA for human interleukin-2. Nature 302:305–310. 3. Fletcher M, Goldstein AL (1987) Recent advances in the understanding of the biochemistry and clinical pharmacology of interleukin-2. Lymphokine Res 6:45–57. 4. Farner N, Hank J, Sondel P (1997) Interleukin-2: molecular and clinical aspects. In: Remick DG, Friedland JS (eds) Cytokines in Health and Disease. M. Dekker, Inc., New York, pp 29– 40. 5. Zurawski SM, Mosmann TR, Benedik M, Zurawski G (1986) Alterations in the amino-terminal third of mouse interleukin-2: effects on biological activity and immunoreactivity. J Immunol 137:3354–3360. 6. Ju G, Collins L, Kaffka KL, Tsien WH, Chizzonite R, Crowl R, Bhatt R, Kilian PL (1987) Structure-function analysis of human interleukin-2. Identification of amino acid residues required for biological activity. J Biol Chem 262:5723–5731. 7. Collins L, Tsien WH, Seals C, Hakimi J, Weber D, Bailon P, Hoskings J, Greene WC, Toome V, Ju G (1988) Identification of specific residues of human interleukin-2 that affect binding to the 70-kDa subunit (p70) of the interleukin-2 receptor. Proc Natl Acad Sci USA 85:7709–7713. 8. Weigel U, Meyer M, Sebald W (1989) Mutant proteins of human interleukin-2. Renaturation yield, proliferative activity and receptor binding. Eur J Biochem 180:295–300. 9. Zurawski SM, Zurawski G (1989) Mouse interleukin-2 structure–function studies: substitutions in the first alpha-helix can
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324) specifically inactivate p70 receptor binding and mutations in the fifth alpha-helix can specifically inactivate p55 receptor binding. EMBO J 8:2583–2590. 10. Zurawski SM, Zurawski G (1992) Receptor antagonist and selective agonist derivatives of mouse interleukin-2. Embo J 11:3905–3910. 11. Berndt WG, Chang DZ, Smith KA, Ciardelli TL (1994) Mutagenic analysis of a receptor contact site on interleukin-2: preparation of an IL-2 analog with increased potency. Biochemistry 33:6571–6577. 12. Eckenberg R, Xu D, Moreau JL, Bossus M, Mazie JC, Tartar A, Liu XY, Alzari PM, Bertoglio J, Theze J (1997) Analysis of human IL-2/IL-2 receptor beta chain interactions: monoclonal antibody H2-8 and new IL-2 mutants define the critical role of alpha helix-A of IL-2. Cytokine 9:488–498. 13. Xu D, Eckenberg R, Moreau JL, Liu XY, Theze J, Bertoglio J (1995) Biological and receptor-binding activities of human interleukin-2 mutated at residues 20Asp, 125Cys or 127Ser. Eur Cytokine Netw 6:237–244. 14. Zurawski SM, Imler JL, Zurawski G (1990) Partial agonist/ antagonist mouse interleukin-2 proteins indicate that a third component of the receptor complex functions in signal transduction. Embo J 9:3899–3905. 15. Buchli P, Ciardelli T (1993) Structural and biologic properties of a human aspartic acid-126 interleukin-2 analog. Arch Biochem Biophys 307:411–415. 16. Pettit DK, Bonnert TP, Eisenman J, Srinivasan S, Paxton R, Beers C, Lynch D, Miller B, Yost J, Grabstein KH and others (1997) Structure-function studies of interleukin-15 using site-specific mutagenesis, polyethylene glycol conjugation, and homology modeling. J Biol Chem 272:2312–2318. 17. Sundick RS, Gill-Dixon C (1997) A cloned chicken lymphokine homologous to both mammalian IL-2 and IL-15. J Immunol 159:720–725. 18. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. 19. Kaiser P, Mariani P (1999) Promoter sequence, exon:intron structure, and synteny of genetic location show that a chicken cytokine with T-cell proliferative activity is IL-2 and not IL-15. Immunogenetics 49:26–35. 20. Stepaniak JA, Shuster JE, Hu W, Sundick RS (1999) Production and in vitro characterization of recombinant chicken interleukin-2. J Interferon Cytokine Res 19:515–526. 21. Sauve K, Nachman M, Spence C, Bailon P, Campbell E, Tsien WH, Kondas JA, Hakimi J, Ju G (1991) Localization in human interleukin-2 of the binding site to the alpha chain (p55) of the interleukin-2 receptor. Proc Natl Acad Sci USA 88:4636–4640. 22. Landgraf BE, Goldstein B, Williams DP, Murphy JR, Sana TR, Smith KA, Ciardelli TL (1992) Recombinant interleukin-2 analogs. Dynamic probes for receptor structure. J Biol Chem 267:18511–18519. 23. Nelson BH, Willerford DM (1998) Biology of the interleukin-2 receptor. Adv Immunol 70:1–81. 24. Hazama M, Mayumi-Aono A, Miyazaki T, Hinuma S, Fujisawa Y (1993) Intranasal immunization against herpes simplex virus infection by using a recombinant glycoprotein D fused with immunomodulating proteins, the B subunit of Escherichia coli heat-labile enterotoxin and interleukin-2. Immunology 78:643–649.
MUTATIONAL ANALYSIS OF CHICKEN INTERLEUKIN 2 Jill E. Kolodsick, Jolie A. Stepaniak, Wanping Hu, Roy S. Sundick Chicken interleukin 2 (chIL-2) has low, but significant, homology to both mammalian IL-2 and mammalian IL-15. In view of its unique phylogenetic position and potential use as a vaccine adjuvant, a detailed mutational analysis for critical functional sites was undertaken. It was found that Asp17 is a critical N terminal contact site for binding to the putative chIL-2 receptor, which is similar to results obtained for mammalian IL-2 and IL-15. Analysis of the C terminus did not reveal a single critical amino acid. However, deletion mutant studies demonstrated that removal of C terminal amino acids yielded proteins with decreased bioactivity and that this decrease was a function of the number and kind of amino acids removed. This study is the first nonmammalian IL-2 mutational analysis and proposes a model for the interaction between chIL-2 and its receptor. 2001 Academic Press
Interleukin 2 (IL-2) was originally described in 1976 as a factor produced by activated lymphocytes that induces proliferative responses in T cells and supports long term growth of bone marrow-derived cells.1 The gene for human IL-2 was cloned and sequenced in 1983.2 It encodes a 133 amino acid glycoprotein with a molecular weight of 15–18 kDa.3 In vivo and in vitro studies of recombinant IL-2 have determined roles for this cytokine in the growth and differentiation of T cells, B cells, monocytes and natural killer (NK) cells.1,4 The important immunoregulatory role of IL-2, as well as the therapeutic promise it holds for the treatment of certain cancers and infectious diseases, has made it the focus of numerous structure–function studies.4 Aims of these studies included obtaining structural derivatives of IL-2 that antagonize its action and identifying sequences not required for activity.5 IL-2 antagonists were sought to elucidate potential activities of the interleukin, whereas agonists were proposed to have pharmacologic benefits. The first mutational analysis of mouse IL-2 (mIL-2) identified the N terminal region between amino acids 14 and 37 From the Department of Immunology and Microbiology, Wayne State University, Detroit, Michigan, USA Correspondence to: Dr Roy Sundick, Wayne State University, Department of Immunology and Microbiology, 540 East Canfield, 117 Lande, Detroit, MI 48201, USA. E-mail: [email protected] Received 30 August 2000; received in revised form 18 November 2000; accepted for publication 28 January 2001 2001 Academic Press 1043–4666/01/060317+08 $35.00/0 KEY WORDS: IL-2/mutagenesis/structure–function/T cell CYTOKINE, Vol. 13, No. 6 (21 March), 2001: pp 317–324
as a region important for biological activity, as defined by induction of T cell proliferation.5 Functional domains of human IL-2 were then identified using oligonucleotide-directed mutagenesis.6 These results indicated that the N terminal 20 amino acids, the C terminal 13 amino acids, and two of the three cysteine residues must be retained for bioactivity. Analysis of the N terminus revealed that a conservative substitution at residue Leu17 (Leu
318 / Kolodsick et al.
amino acid substitutions (C125S, Q126E, I128K, S130D or L132E) in this study did not affect the activity of the rIL-2 protein. Furthermore, deletion of the terminal four amino acid residues (Ser130 through Thr133) did not reduce bioactivity.6 Since deletions of the terminal ten amino acids, but not substitutions within this area, affected activity, the authors concluded that the structural characteristics or spacing of amino acids in the C terminus must be maintained, rather than a specific primary amino acid sequence.6 Further studies on human and mouse IL-2 raised the question of whether a specific residue in the C terminus, Q126 in human IL-2 and Q141 in mouse, is a receptor contact residue or only allosterically influences binding.10,14,15 The role of residue Q126 in human IL-2 and the corresponding residue Q141 in murine IL-2 was revisited during mutational studies with human interleukin 15. Interleukin 2 and interleukin 15 share many biological activities, as well as the use of both the and subunits of the IL-2 receptor. A study of interleukin 15 mutants (IL-15 D8S and IL-15 Q108S) demonstrated that these mutations did not preserve the bioactivity of the cytokine.16 Since Asp8 in human IL-15 aligns with Asp20 in human IL-2, and residue Q108 in IL-15 aligns with Q126 in human IL-2, it became accepted that those residues (D and Q) were the critical amino acids for interaction with the and chains of the shared interleukin 2 receptor. All of the IL-2 mutational analyses described thus far have been performed on mammalian IL-2. In 1997, our laboratory cloned a gene for a chicken IL-2-like molecule using expression library screening.17 ClustalW alignments18 revealed that this chicken cytokine had 24–25% amino acid identity and 44–46% similarity to both bovine IL-2 and IL-15. In fact, the chicken protein was more closely related to both the mammalian cytokines than the latter were to each other. Chicken IL-2 (chIL-2) has characteristics similar to both mammalian IL-2 and mammalian IL-15. Like mammalian IL-2, chIL-2 is expressed by activated T cells, and has a 22 amino acid signal sequence, which is similar in size to mammalian IL-2 signal sequences. The mRNA of mammalian IL-2 has a short 5 region preceding the open reading frame of the gene, as does chIL-2. Chicken IL-2 is more similar to mammalian IL-15 in that it has four cysteine residues within the sequence of the mature protein that may allow for two intrachain disulfide bonds, while mammalian IL-2 has only three cysteine residues allowing for only one intrachain disulfide bond. Sequence analysis of the gene showed that the genomic structure was remarkably similar to mammalian IL-2 genes.19 The chIL-2 promoter is extremely homologous to the promoter of mammalian interleukin 2, and the majority of the transcription factor binding sites are conserved.19
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324)
Furthermore, a molecule that is clearly chicken IL-15, based on homology studies, has been cloned (GenBank accession number AF152927). Our laboratory has produced recombinant chicken IL-2 from Escherichia coli using the pET protein purification system (NOVAGEN, Madison, WI, USA).20 Recombinant chicken IL-2 has a powerful proliferative effect on cultures of activated chicken spleen cells, but it does not stimulate CTLL cells, a murine cell line responsive to mammalian IL-2 and IL-15.20 Polyclonal anti-chIL-2 antibodies do not inhibit CTLL activation by mammalian IL-2 or IL-15.20 Therefore, although recombinant chIL-2 performs functions within the chicken system which are analogous to the actions of mammalian IL-2 and IL-15, such as activation of spleen cells, it appears structurally different from mammalian IL-2 and IL-15. Mutational analysis of chicken IL-2 was undertaken for two reasons. First, it is an ideal molecule to study the phylogenetic relationship between mammalian IL-2 and IL-15, being similar to both and yet derived from a lower vertebrate. Emphasis was placed on the receptor-binding regions for comparison with their extensively studied mammalian counterparts. Second, chickens are a valuable food source and, under existing growing conditions, are highly susceptible to infectious agents. A major emphasis in the industry has been research on improving the health of chickens, including the use of immune stimulators and the development of improved vaccines. Detailed analysis of chicken IL-2 is expected to increase its utility as a vaccine adjuvant and enable its use as an in vitro growth promoter for avian T and NK cells. We focused our studies on those regions of chicken IL-2 that align with human IL-2 regions known to interact with the and chains of the receptor. We did not analyse regions of chicken IL-2 which correspond with mammalian chain contact residues, because these regions are less defined in mammals and none of the proposed critical amino acids (Lys35, Arg38, Phe42, or Lys43) align with homologous residues in the chicken.21 This report provides insight on the structure of chicken interleukin 2 and allows identification of specific amino acids whose integrity must be maintained for biological activity.
RESULTS Previous studies with human IL-2 have reported that mutation of Asp20 is detrimental to biological activity.7,8,12,13 Chicken IL-2 contains an aspartic acid at position 17 that aligns with residue 20 in human IL-2 (Fig. 1). We generated the chicken IL-2 analog D17A and assessed its biological activity in a proliferation assay using chicken T cell blasts. A dramatic
Mutational analysis of chIL-2 / 319
Figure 1.
ClustalW alignment of mature human IL-2, human IL-15, and chicken IL-2.
Stimulation index ± SE
Chicken residues 17, 113 and 121 are highlighted.
TABLE 1. Percentage of wild-type activity at 10 8 M and 10 9 M for all C terminal mutants containing a single amino acid substitution
6 5 4
Chicken IL-2 mutant
3 2 1 0
–7
–8
–9
–10
–11
log[concentration(M)] Figure 2. The bioactivity of purified recombinant chicken IL-2 and purified chIL-2 D17A on ConA-activated chicken splenocytes, expressed as stimulation indices. Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 D17A, – – – –.
reduction in the proliferative response to chIL-2 D17A was seen in comparison to chIL-2 (Fig. 2). Assuming that the substitution of the alanine residue for the aspartic acid residue does not grossly alter the structure of chicken IL-2, this observation suggests that the carboxylic acid in the side chain of the aspartic acid residue is critical for full biological activity of the protein. Unlike the N terminal residue that is critical for binding to the chain in the mammalian system, the importance of the critical region in the C terminus, which binds to the of the trimeric IL-2 receptor, is less well-defined. Mammalian studies propose Q126 as an amino acid that interacts with the chain of the IL-2 receptor.6,7,10,14,22 Chicken IL-2 has an arginine at the corresponding location (117). However, it does have an asparagine at position 114 and a glutamine at position 120 of the mature protein (Fig. 1). We under-
chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2
T113A N114A F115A V116A V116F R117A Y118A L119A Q120A K121A
Percentage of wild-type activity at 10 8 M
Percentage of wild-type activity at 10 9 M
89 87 76 94 88 78 94 90 83 74
104 96 77 111 78 95 112 98 102 78
took our analysis of the C terminus of chicken IL-2 by constructing a series of chicken IL-2 muteins that contain single amino acid substitutions with alanine in the region 113-121. These analogs: T113A, N114A, F115A, V116A, R117A, Y118A, L119A, Q120A and K121A were then tested in the splenocyte proliferation assay. Residue 116 is a valine, therefore we also constructed V116F, since V116A is a conservative substitution. None of the C terminal point mutations substantially compromised the proliferative activity of chicken IL-2 (Table 1). This suggested that instead of a single residue being necessary for proliferative function in the C terminus of chicken IL-2, multiple residues may be required. A series of chIL-2 C terminal deletion mutants were then prepared: 113–121, 116–121 and 119–121, lacking the terminal nine, six or three amino acids, respectively, of the C terminus. None of the deletion mutants (113–121, 116–121, 119–121)
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324)
6
Stimulation index ± SE
Stimulation index ± SE
320 / Kolodsick et al.
5 4 3 2 1 0
–7
–8
–9
–10
–11
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
–7
Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 113–121, — —; chIL-2 116–121, – – – –; chIL-2 119–121, — —.
preserved wild-type function (Fig. 3). Mutant 113– 121 was not active at any concentration range employed, while mutants 116–121 and 119–121 were active only at the highest concentration (110 7 M) used in our assay system. This suggests that deletion of the last three amino acids either deleted residues critical for interacting with the chIL-2 receptor, or deleted residues critical for the proper formation/folding of the protein. To identify whether the last three amino acids contain side chains required for interaction with the chicken IL-2 receptor, we constructed another set of alanine substitutions producing three double alaninesubstituted analogs and one triple alanine-substituted analog. These mutants, L119A/K121A, L119A/ Q120A, Q120A/K121A, L119A/Q120A/K121A, all maintained bioactivity indicating that the C terminus of chicken IL-2 is tolerant to numerous alterations (Fig. 4). Following this analysis, it was concluded that none of the side chains of the three C terminal amino acids were critical for bioactivity. However, deletion mutants, 113–121, 116–121 and 119–121 did not preserve wild-type function. Therefore, two additional deletion mutants were made, 120–121 and 121. When tested in the chicken proliferation assay it was evident that the main chain backbone of the C terminus must be maintained, because removal of one amino acid from the C terminus slightly decreased activity (Fig. 5), removal of two amino acids had a greater effect (Fig. 5), and removal of three, six or nine amino acids yielded successive declines in function (Fig. 3 and Table 2). In an attempt to perturb the secondary structure of the C terminus we constructed a chicken IL-2 analog that replaced Q120 with an aspartic acid. We hypothesized that substitution of a terminal amide group with a carboxyl group would alter the C terminal tertiary
–9
–10
–11
Figure 4. The bioactivity of purified recombinant chicken IL-2, purified double alanine-substituted analogs, and the triple alaninesubstituted analog measured on ConA-activated chicken splenocytes, expressed as stimulation indices. Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 L119A/K121A, — —; chIL-2 L119A/Q120A; — —; chIL-2 Q120A/K121A, – – – –; chIL-2 L119A/Q120A/K121A, — —.
Stimulation index ± SE
Figure 3. The bioactivity of purified recombinant chicken IL-2 and purified C terminal deletion analogs on ConA-activated chicken splenocytes, expressed as stimulation indices.
–8
log[concentration(M)]
log[concentration(M)]
4.5 4 3.5 3 2.5 2 1.5 1 0.5 0
–7
–8
–9
–10
–11
log[concentration(M)] Figure 5. The bioactivity of purified recombinant chicken IL-2 and purified C terminal deletion analogs measured on ConA-activated chicken splenocytes, expressed as stimulation indices. Data points are averages (n=3) and error bars were determined by calculating standard error of the mean. chIL-2, — —; chIL-2 121, – – – –; chIL-2 120–121, — —.
TABLE 2. Percentage of wild-type activity for all mutants with compromised activity Chicken IL-2 mutant chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2 chIL-2
D17A 121 120–121 119–121 116–121 113–121 113–121 substituted*
Percentage of wild-type activity at 10 8 M 4 68 35 33 15 2
*The final nine amino acids (TNFVRYLQK) were replaced with KFERQHMDS.
structure. A murine analog with this single amino acid substitution was reported to be a potent antagonist of some IL-2-dependent cell lines.10 In contrast, the chicken analog Q120D maintained full biological activity (data not shown). An additional mutant in which all the last nine amino acids were replaced
Stimulation index ± SE
Mutational analysis of chIL-2 / 321
8 7 6 5 4 3 2 1 0 –5.8
DISCUSSION ConA Supernatant alone ± SE
–6
–6.2
–6.4
–6.6
–6.8
–7
–7.2
log[concentration(M)] Figure 6. Inhibition of the bioactivity of native chIL-2 (5% ConA supernatant) by chIL-2 mutants. The solid line represents the level of proliferation induced by ConA supernatant alone, and hatched lines represent the standard error. The recombinant proteins added as inhibitors were Control Protein (– – – –), DEL 113–121 (— —), DEL 116–121 (— —), and DEL 119–121 (– – – –). Data points are averages (n=3) and error bars were determined by calculating standard error of the mean.
with nine random, non-conservative substitutions (KFERQHMDS) delineated whether such substitution would yield a functional lymphokine. This mutant, chIL-2 113–121 substituted, did not preserve wild-type function (Table 2). Therefore, the C terminus is not flexible enough to allow for nine non-conservative substitutions, however multiple double alanine substitutions, a triple alanine substitution, and a nonconservative substitution (Q120D) did not alter the proliferative activity of the molecule. To determine if alterations of chicken IL-2 produce an antagonist, the seven mutants that did not preserve wild-type function were tested for their ability to inhibit chIL-2-induced proliferation. For this purpose, chicken T cell blasts were cultured in the presence of a suboptimal concentration of wild-type chicken IL-2 and either increasing concentrations of chicken IL-2 analogs or control protein (the 15 kDa tag portion of proteins produced in the pET system). Only mutants 116–121 and 119–121 consistently inhibited recombinant chIL-2 when used at 500–1000-fold the concentration of wild-type (data not shown). This set of experiments was repeated to evaluate the ability of the mutants to inhibit native wild-type chIL-2. Supernatants from Concanavalin A (ConA)-activated splenocytes served as a source for native wild-type chicken IL-2. At a high concentration of recombinant protein used (110 6.1 M), the control protein slightly decreased the proliferative response to native wild-type IL-2. However, mutants 116–121 and 119–121 dramatically inhibited proliferation induced by wild-type native chIL-2 (Fig. 6). Interestingly, these mutants decreased the level of proliferation below background (i.e. a stimulation index less than 1.0), indicating that they not only inhibited the IL-2 that was added into the culture system, but they also inhibited IL-2 that was produced endogenously by the activated T cells employed in the assay.
This report is the first to describe mutational analysis of a non-mammalian IL-2 molecule. Previous work compared the amino acid sequence of chicken IL-2 with mammalian homologs, showing that the overall structure of chicken IL-2 is very similar to that of mouse and human IL-2.19 In our mutational analyses, we determined that residue D17 of chicken IL-2 is critical for function. Since this site aligns with D20 of human IL-2, which is a contact residue between IL-2 and the chain of the receptor in mammalian systems, we suggest that D17 is an N terminal contact residue between chIL-2 and the chIL-2 receptor. In the mammalian IL-2 system, the structure– function relationship of the C terminus is unclear. Some mutational analyses conclude that residue Q126 in human and residue Q141 in mouse interact directly with the chain of the IL-2 receptor.10,14 Other C terminal studies concluded that this region plays a structural role in the conformation of IL-2 rather than a direct role in binding.6,7,22 Finally, the most recent study of residue Q126 of human IL-2 concluded that it is likely that position 126 is a receptor contact position. However, this report did not exclude the possibility that alteration of this position allosterically influences receptor interaction.15 These studies were performed before the functions of the separate IL-2 receptor chains were known. The current understanding of the function of the IL-2R chain illustrates why these studies yielded conflicting results. The model postulates an initial interaction between IL-2 and the IL-2R and IL-2R chains, followed by recruitment of the chain into the complex.23 The association of the chain with the receptor complex switches the receptor from an inactive to the active state, required for intracellular signaling.23 Unlike the IL-2R and IL-2R chains, the IL-2R chain has no measurable affinity for interleukin 2.23 Therefore, since the chain is important for signaling and not for binding to interleukin 2, studies that evaluated the binding of C terminal mutants to the IL-2R may have given misleading conclusions. The present report suggests that there is no receptor contact site within the nine C terminal amino acids of chicken interleukin 2. Results from the alanine substitution studies determined that the substitution of an alanine residue at any of positions 113 through 121 is neutral with respect to protein activity. Therefore, within residues 113–121, no specific residue is necessary for activity. Furthermore, all of the chicken IL-2 deletion mutants demonstrated varying degrees of decreased bioactivity as compared to the wild-type. However, the analogs with double and triple alanine substitutions in regions 119–121 were fully active. Hence, the effects of the deletion mutants were likely
322 / Kolodsick et al.
due to a local instability of the putative helix in this region, rather than the removal of critical amino acid side groups that interact with the receptor. The lack of a contact residue in the C terminus of chicken IL-2 allows for great flexibility in manipulations of the molecule. Mammalian studies suggest that interleukin 2 offers enhanced protection when administered as part of a fusion protein.24 Previous work by this laboratory determined that addition of a short stretch of histidine residues at the C terminus does not alter bioactivity.20 The present report demonstrates that as many as three terminal amino acids can be substituted with alanine residues without affecting function. Therefore, production of a functional chIL-2 fusion protein should be feasible provided that the backbone of the C terminus is maintained. Although chIL-2 has low sequence homology to mammalian IL-2 and IL-15 and does not activate or bind the standard mammalian cell line for IL-2 and IL-15 bioassays,17,20 the present report suggests that structural homology exists between chicken interleukin 2 and mammalian IL-2 and IL-15. All of the human and mouse interleukin 2 reports describe residues D20 or D34, respectively, as contact residues between interleukin 2 and the interleukin 2 receptor.5,8–13 The human interleukin 15 mutational study determined that D8 of IL-15 was a receptor contact site.16 Chicken IL-2 D17 aligns with the receptor contact sites of both human and mouse IL-2 as well as human IL-15 and, as demonstrated in this report, is a receptor contact site between chIL-2 and the chicken IL-2 receptor. Therefore, although the complete sequence of chIL-2 has low homology to mammalian IL-2, an N terminal receptor contact site is identical. Also, the present analysis of chicken interleukin 2 revealed that the structural integrity of the C terminus must be conserved for bioactivity. This conclusion supports the earlier controversial mammalian interleukin 2 studies which determined that the structural integrity of the helix in this region is important for bioactivity, rather than one specific residue,6,7,22 and suggests that there are structural characteristics that have been phylogenetically conserved between mammalian IL-2 and chicken IL-2. The work described here advances our understanding of the structure–function relationship of chicken interleukin 2 and, by analogy, mammalian IL-2 and IL-15. This work also provides analogs of chicken interleukin 2 with reduced functional activity. These analogs will be used in chicken interleukin 2 signaling assays to determine the signal cascade upon activation with interleukin 2 and interleukin 2 analogs. Monoclonal antibody epitope mapping will be performed utilizing the analogs of chicken interleukin 2 that demonstrate compromised bioactivity, to confirm regions of chicken IL-2 described in this report as necessary for function. Continued studies with chicken
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324)
interleukin 2 and receptor-bearing lymphocytes will advance our understanding of chicken lymphocyte activation, the structure of chicken IL-2, the general immune response in chickens, and phylogenetic comparisons of mammalian and non-mammalian cytokines.
MATERIALS AND METHODS Production of biologically active chicken IL-2 The chicken IL-2 cDNA encoding the 121 amino acid mature interleukin 2 protein was obtained by PCR using the PCR 3.1 plasmid (InVitrogen, Carlsbad, CA, USA) containing the IL-2 gene as template cDNA and the following primers: forward primer, 5 GCTACCATGGGCGCATCTC TATCATCA3 , reverse primer, 5 CGGCGCTCAGCTTAT TTTTGCAGATA3 . The primers were constructed with NcoI and BPU1102 restriction sites. PCR was performed under the following conditions: 1 min 94C denaturation, 1 min 55C annealing, and 1 min 72C elongation, for 35 cycles. The PCR product was purified with the Geneclean kit (Bio 101, Carlsbad, CA, USA) and then used in a ligation reaction (T4 DNA ligase, Gibco, Gaithersburg, MA, USA) with pCR3.1-Uni vector (Eukaryotic TA Cloning Kit, InVitrogen). One Shot (TOP 10F ) cells (Eukaryotic TA Cloning Kit, InVitrogen) were transformed with this ligation mixture and the plasmid DNA was isolated using the Qiagen mini-plasmid preparation protocol. A restriction digest with endonuclease NcoI and NotI (Gibco), was performed for isolation of the PCR product from the PCR3.1-Uni vector. The isolated product was then ligated into the pET32a+ vector (NOVAGEN), and JM109 cells were transformed with this ligation mixture. Plasmid DNA was isolated (Qiagen, Valencia, CA, USA) from JM109 transformants and AD494(DE3) host cells (NOVAGEN) were transformed with the pET32a+ vector containing the chicken IL-2 insert. Production of recombinant protein was performed as described in Stepaniak et al.20 Briefly, transformed AD494(DE3) cells containing the chicken IL-2 gene were grown until OD600 =0.6 was attained. IPTG was added (1 mM), cells were incubated for 1 h at 30C, shaken on ice for 1 h, and then harvested by centrifugation at 5000g for 5 min, at 4C. Cell pellets were resuspended in 0.1% Triton X-100 and binding buffer (NOVAGEN). Resuspended pellets were sonicated on ice for 3 min and then centrifuged. The supernatant was filtered and loaded onto a nickel column (NOVAGEN). Column chromatography was performed according to the pET System manual, with the substitution of a 35 mM imidazole wash for a 60 mM imidazole wash. Protein products produced using the pET system are initially fusion proteins containing a 16 700 Da tag on the amino end. The tag consists of thioredoxin, an S tag, and a stretch of six histidines. The entire tag can be removed using enterokinase, or the thioredoxin portion of the tag can be removed using thrombin. All experiments discussed were performed with uncleaved fusion protein. However, we have demonstrated that a mixture of cleaved IL-2 and tag has the same biological activity in vitro as chIL-2 fused with the
Mutational analysis of chIL-2 / 323
TABLE 3.
Primers used for PCR mutagenesis
Analog
D17A T113A N114A F115A V116A V116F R117A Y118A L119A Q120A K121A 113–121 116–121 119–121 chIL-2 113–121 substituted* L119A/K121A L119A/Q120A L119A/Q120A/K121A 120–121 121 Q126D
Primer orientation
forward reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse reverse
Primer sequence 5 GCGCGCCATGGGCGCATCTCTATCATCAGCAAAAAGGAAACCTCTTCAAACATTAATAAAGGCTTTAGAAATA3 5 ATGCCGCGGCCGCTTATTTTTGTGCATATCTCAC3 5 ATGCCGCGGCGGCTTATTTTTGCAGATATCTCACAAAGGCGGTCAGTTC3 5 ATACCGCGGCCGCTTATTTTTGCAGATATCTCACTGCGTTGGTCAG3 5 ATACCGCGGCCGCTTATTTTTGCAGATATCTTGCAAAGTTGGT3 5 GCGCCGCGGCCGCTTATTTTTGCAGATATCTAAAAAAGTTGGT3 5 ATGCCGCGGCCGCTTATTTTTGCAGATATGCCACAAAGTT3 5 ATGCCGCGGCCGCTTATTTTTGCAGTGCTCTCACAAA3 5 ATGCCGCGGCCGCTTATTTTTGTGCATATCTCAC3 5 ATGCCGCGGCCGCTTATTTTGCCAGATATCTCAC3 5 ATTACCGCGGCCGCTTATGCTTGCAGATA3 5 ATACCGCGGCCGCTTACAGTTCATGGAGAAAATC3 5 ATACCGCGGCCGCTTAAAAGTTGGTCAGTTC3 5 AGGCCGCGGCCGCTTAATATCTCACAAAGTT3 5 ATTTCGAATATCGAATTCTTAGCTGTCCATGTGCTGGCGTTCGAATTTCAGTTCATGAGAAAATC3 5 ATTACGCGGCTTATGCTTGCGCATATCTCACAAAGTTGGTCAGTTCATGGAG3 5 ATTACGCGGCCGCTTATTTCGCTGCATATCTCACAAACTTGGTCAGTTCATGGAG3 5 ATTACGCGGCCGCTTATGCCGCTGCATATCTCACAAAGTTGGTCAGTTCATGGAG3 5 AGGCCGCGGCCGCTTACAGATATCTCACAAAGTTGGTCAGTTCATG3 5 ATTACGCGGCCGCTTATTGCAGATATCTCACAAAGTTGGTCAG3 5 ATTACGCGGCCGCTTATTTATCCAGATATCTCACAAAGTTGGTCAG3
*The final nine amino acids (TNFVRYLQK) were replaced with KFERQHMDS.
tag. Also, we have produced the tag alone and determined that it was non-stimulatory in proliferation assays when used at a concentration of 110 7 M (data not shown). Recombinant chicken IL-2 induces maximal stimulation in the proliferation assay at concentrations of 110 7 M through 110 9 M.
Production of chIL-2 muteins Table 3 contains the primers used for subcloning the chIL-2 muteins. The forward primer contains an NcoI site, and each reverse primer contains an NotI sites. This represents a change from the chIL-2 reverse primer, which contained a BPU1102 restriction site. This change in the restriction site of the reverse primers allowed the PCR products to be subcloned directly into the pET32a+ vector. After identification and confirmation of these mutations by sequence analysis, the 21 mutants were individually cloned into the pET32a+ vector. Production of purified protein was performed as described above.
Chicken spleen cell proliferation assay The bioassay for chicken interleukin 2 and interleukin 2 analogs was performed as previously described.17,20 Briefly, a spleen was removed from a 6-week fryer (Capital Poultry, Detroit, MI, USA; Chase Poultry, Dearborn, MI, USA), passed through a stainless steel screen, washed three times in Iscoves, and then cultured in 75 cm2 flasks in Iscoves, bovine serum albumin (BSA; 2 mg/ml), and Concanavalin A (ConA; 10 g/ml) (Sigma Chemical Co., St. Louis, MO, USA) at 40C in 5% CO2. After 24 h, the culture was dispersed into single cells, diluted with Iscoves’ modified Dulbecco’s medium (1:1). Chicken serum (Sigma) was added to yield a final concentration of 2%. Then, -methyl manno-
pyrannoside (Sigma) was added to a final concentration of 0.05 M and cells were reincubated for 2–4 days at 40C in 5% CO2. For use in the proliferation assay 8 ml of the 3–5 day cell culture was layered onto 5 ml of Histopaque (Sigma) at room temperature and centrifuged at 400g for 20 min. The cells at the interface were removed, washed three times in Iscoves, and resuspended in Iscoves, BSA (2 mg/ml), pen/ strep and 2% chicken serum, at a concentration of 2.2105 cells/ml. Recombinant protein was then placed in 96-well round-bottom plates at various concentrations and the chicken blasts were added at 2104 cells per well. Plates were incubated overnight at 40C in 5% CO2, and pulsed for the last 6 h with 1.0 Ci of 3H-thymidine in the presence of 10 6 M fluorodeoxyuridine. Cells were harvested 6 h later on glass fiber filters using an automated harvester and counted in a liquid scintillation counter. The percentage of wild-type activities of the muteins shown in Tables 1 and 2 were calculated by the following formula, where a negative percentage represents proliferation below background: Percentage of Wild-type Activity= Mutant (CPM)Background (CPM) Wildtype (CPM)Background (CPM)
100%
Inhibition assay testing the ability of the chicken IL-2 muteins to inhibit chicken IL-2 induced proliferation Chicken spleen cells were isolated, cultured, and prepared for the assay as described above, except a specific chicken IL-2 mutant was added to each well, followed by wild-type chIL-2 (similar to mammalian inhibition assays12,16). The concentration of mutant chicken IL-2 used
324 / Kolodsick et al.
ranged from 1- to 1000-fold excess over wild-type chicken IL-2. The plates were returned to the 40C incubator for 30 min. At the end of this incubation period, cells were added as described above and the plates were returned to the incubator. The next morning, plates were pulsed with 1.0 Ci of 3H-thymidine in the presence of 10 6 M fluorodeoxyuridine, and reincubated at 40C for 6 h. Cells were harvested on glass fiber filters using an automated harvester and counted in a liquid scintillation counter.
Acknowledgments The authors would like to thank Dr Myron A. Leon for his insightful discussion during the course of this work and critical review of this manuscript, and Kevin J. Kolodsick for his advice and assistance with manuscript preparation. This work was funded by USDA grant 9702418.
REFERENCES 1. Rubin JT (1995) Interleukin-2: Its rationale and role in the treatment of patients with cancer. In: Kurzrock R (ed.) Cytokines: Interleukins and their Receptors. Kluwer Academic Publishers, pp 83–90. 2. Taniguchi T, Matsui H, Fujita T, Takaoka C, Kashima N, Yoshimoto R, Hamuro J (1983) Structure and expression of a cloned cDNA for human interleukin-2. Nature 302:305–310. 3. Fletcher M, Goldstein AL (1987) Recent advances in the understanding of the biochemistry and clinical pharmacology of interleukin-2. Lymphokine Res 6:45–57. 4. Farner N, Hank J, Sondel P (1997) Interleukin-2: molecular and clinical aspects. In: Remick DG, Friedland JS (eds) Cytokines in Health and Disease. M. Dekker, Inc., New York, pp 29– 40. 5. Zurawski SM, Mosmann TR, Benedik M, Zurawski G (1986) Alterations in the amino-terminal third of mouse interleukin-2: effects on biological activity and immunoreactivity. J Immunol 137:3354–3360. 6. Ju G, Collins L, Kaffka KL, Tsien WH, Chizzonite R, Crowl R, Bhatt R, Kilian PL (1987) Structure-function analysis of human interleukin-2. Identification of amino acid residues required for biological activity. J Biol Chem 262:5723–5731. 7. Collins L, Tsien WH, Seals C, Hakimi J, Weber D, Bailon P, Hoskings J, Greene WC, Toome V, Ju G (1988) Identification of specific residues of human interleukin-2 that affect binding to the 70-kDa subunit (p70) of the interleukin-2 receptor. Proc Natl Acad Sci USA 85:7709–7713. 8. Weigel U, Meyer M, Sebald W (1989) Mutant proteins of human interleukin-2. Renaturation yield, proliferative activity and receptor binding. Eur J Biochem 180:295–300. 9. Zurawski SM, Zurawski G (1989) Mouse interleukin-2 structure–function studies: substitutions in the first alpha-helix can
CYTOKINE, Vol. 13, No. 6 (21 March, 2001: 317–324) specifically inactivate p70 receptor binding and mutations in the fifth alpha-helix can specifically inactivate p55 receptor binding. EMBO J 8:2583–2590. 10. Zurawski SM, Zurawski G (1992) Receptor antagonist and selective agonist derivatives of mouse interleukin-2. Embo J 11:3905–3910. 11. Berndt WG, Chang DZ, Smith KA, Ciardelli TL (1994) Mutagenic analysis of a receptor contact site on interleukin-2: preparation of an IL-2 analog with increased potency. Biochemistry 33:6571–6577. 12. Eckenberg R, Xu D, Moreau JL, Bossus M, Mazie JC, Tartar A, Liu XY, Alzari PM, Bertoglio J, Theze J (1997) Analysis of human IL-2/IL-2 receptor beta chain interactions: monoclonal antibody H2-8 and new IL-2 mutants define the critical role of alpha helix-A of IL-2. Cytokine 9:488–498. 13. Xu D, Eckenberg R, Moreau JL, Liu XY, Theze J, Bertoglio J (1995) Biological and receptor-binding activities of human interleukin-2 mutated at residues 20Asp, 125Cys or 127Ser. Eur Cytokine Netw 6:237–244. 14. Zurawski SM, Imler JL, Zurawski G (1990) Partial agonist/ antagonist mouse interleukin-2 proteins indicate that a third component of the receptor complex functions in signal transduction. Embo J 9:3899–3905. 15. Buchli P, Ciardelli T (1993) Structural and biologic properties of a human aspartic acid-126 interleukin-2 analog. Arch Biochem Biophys 307:411–415. 16. Pettit DK, Bonnert TP, Eisenman J, Srinivasan S, Paxton R, Beers C, Lynch D, Miller B, Yost J, Grabstein KH and others (1997) Structure-function studies of interleukin-15 using site-specific mutagenesis, polyethylene glycol conjugation, and homology modeling. J Biol Chem 272:2312–2318. 17. Sundick RS, Gill-Dixon C (1997) A cloned chicken lymphokine homologous to both mammalian IL-2 and IL-15. J Immunol 159:720–725. 18. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. 19. Kaiser P, Mariani P (1999) Promoter sequence, exon:intron structure, and synteny of genetic location show that a chicken cytokine with T-cell proliferative activity is IL-2 and not IL-15. Immunogenetics 49:26–35. 20. Stepaniak JA, Shuster JE, Hu W, Sundick RS (1999) Production and in vitro characterization of recombinant chicken interleukin-2. J Interferon Cytokine Res 19:515–526. 21. Sauve K, Nachman M, Spence C, Bailon P, Campbell E, Tsien WH, Kondas JA, Hakimi J, Ju G (1991) Localization in human interleukin-2 of the binding site to the alpha chain (p55) of the interleukin-2 receptor. Proc Natl Acad Sci USA 88:4636–4640. 22. Landgraf BE, Goldstein B, Williams DP, Murphy JR, Sana TR, Smith KA, Ciardelli TL (1992) Recombinant interleukin-2 analogs. Dynamic probes for receptor structure. J Biol Chem 267:18511–18519. 23. Nelson BH, Willerford DM (1998) Biology of the interleukin-2 receptor. Adv Immunol 70:1–81. 24. Hazama M, Mayumi-Aono A, Miyazaki T, Hinuma S, Fujisawa Y (1993) Intranasal immunization against herpes simplex virus infection by using a recombinant glycoprotein D fused with immunomodulating proteins, the B subunit of Escherichia coli heat-labile enterotoxin and interleukin-2. Immunology 78:643–649.