- Email: [email protected]
Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides
ARTICLE IN PRESS Insect Biochemistry and Molecular Biology Insect Biochemistry and Molecular Biology 36 (2006) 396–402 www.elsevier.com/locate/ibmb
Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides Ju-Chun Hsua,b, David S. Haymerc, Wen-Jer Wub, Hai-Tung Fenga, a
Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Kuang Ming Road, Wufeng 413, Taichung Hsien, Taiwan b Department of Entomology, National Taiwan University, 27, Lane 113, Roosevelt Road, Sec. 4, Taipei 106, Taiwan c Department of Cell and Molecular Biology, University of Hawaii at Manoa, 1960 East-West Rd, Honolulu, HI 96822, USA Received 22 November 2005; received in revised form 8 February 2006; accepted 21 February 2006
Abstract Mutations in the gene encoding the enzyme acetylcholinesterase (AChE) of the oriental fruit fly, Bactrocera dorsalis, associated with resistance to an organophosphorus insecticide have been characterized. Three point mutations producing nonsynonymous changes in the predicted amino acid sequence of the product of the B. dorsalis ace gene in resistant vs. susceptible flies have been identified. One of these changes is unique to B. dorsalis while the other two occur at sites that are identical to mutations previously described for another Bactrocera species. Although the precise role of the third mutation is not clearly established, the independent origin of two identical alterations in these two species strongly supports the idea proposed previously that molecular changes associated with insecticide resistance in key genes and enzymes such as AChE are largely constrained to a limited number of sites. The results obtained here also suggest that the widespread use of organophosphorus insecticides will likely lead to a predictable acquisition of resistance in wild populations of B. dorsalis as well as other pest species. For surveys of B. dorsalis populations that may develop resistance, diagnostic tests using PCR-RFLP based methods for detecting the presence of all three mutations in individual flies are described. r 2006 Elsevier Ltd. All rights reserved. Keywords: Fenitrothion; Ace gene; Acetylcholinesterase; Insecticide resistance; Bactrocera dorsalis
1. Introduction The phenomenon of insecticide resistance is a potentially major impediment for effective control of a number of pest species of agricultural and medical importance. In many cases involving insecticide applications an initial failure to effectively control a pest has resulted in a huge resurgence of a population exhibiting resistance. For example, fenitrothion, an organothiophosphate-based insecticide, has been widely used for control of agricultural pests. The development of resistance, resulting in a reduction in effectiveness of fenitrothion and other organophosphatebased insecticides, has been observed in several insect species (Konno and Shishido, 1989; Kozaki et al., 2001; Vontas et al., 2001; Hsu and Feng, 2002). In part because Corresponding author. Tel.: +886 4 23302101; fax: +886 4 23314106.
E-mail address: [email protected] (H.-T. Feng). 0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.02.002
of this, the prospects for the future of the chemical control have often been called into question. A better understanding of the mechanisms by which resistance occurs may significantly delay the onset of problems and limitations associated with this control approach. The enzyme acetylcholinesterase (AChE, EC 3.1.1.7) is known to be the target of many organophosphorus and carbamate insecticides. In most cases, the acquisition of resistance corresponds to a measurable alteration of AChE activity. These alterations, in almost all cases, arise from point mutations in the gene (designated ace) encoding this enzyme that produce amino acid substitutions in regions corresponding to the active site of the AChE enzyme. Specific mutations in ace genes affecting enzyme activity in association with resistance phenomena have been described in the house fly Musca domestica (Kozaki et al., 2001), several mosquito species (Vaughan et al., 1997; Kozaki et al., 2001; Weill et al., 2004), the Colorado potato beetle
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
(Zhu and Clark, 1995), the olive fruit fly (Vontas et al., 2002), the cotton aphid Aphis gossypii (Andrews et al., 2004; Toda et al., 2004) along with other hemipteran species (Javed et al., 2003), and Drosophila melanogaster (Fournier et al., 1992; Mutero et al., 1994). Also as described by Weill et al. (2004), many mosquito species appear to have two distinct ace genes (designated ace1 and ace2) while other insects, including tephritids such as the Bactrocera species, appear to have only one ace gene. The single ace gene found in these species appears to be an ortholog of the ace2 gene of mosquitoes (Hawkes et al., 2005). In the case of the oriental fruit fly, Bactrocera dorsalis (Hendel), an agriculture pest species which causes serious financial losses to orchards globally, the development of even subtle resistance can have a significant impact on the effectiveness of organophosphorus insecticides such as fenitrothion (Hsu and Feng, 2000). In this study, laboratory colonies of this species exhibiting resistance and susceptibility to fenitrothion were identified and characterized in terms of activity of the AChE enzyme and molecular changes in the structure of the gene encoding this enzyme. The results obtained here show that some of the specific structural changes of the B. dorsalis ace gene associated with the development of resistance are identical to changes reported in other species exhibiting insecticide resistance. The independent origin of identical gene specific changes in different species strongly supports the idea put forward by ffrench-Constant et al. (1998) that at the molecular level, resistance phenomena result from a limited set of changes in key genes such as the ace genes. This also suggests that the acquisition of resistance to organophosphorus insecticides will occur in a predictable manner in wild populations of this species, as well as in a wide range of other agricultural and medical pest species, where these agents are used for control purposes.
397
Individual adult flies, both from fenitrothion-resistant and fenitrothion-susceptible colonies, were used in this part of the investigation. The heads were used for biochemical tests and the bodies were used to isolate total RNA as described in the next section. For AChE activity assays with acetylthiocholine iodide (ATChI, 0.50 mM) as a substrate, 100 mg of flies’ heads were homogenized for use. AChE activity is expressed in terms of nmoles ATChI/ min/mg protein. Solutions of fenitroxon, methyl-paraoxon, and paraoxon (ethyl) were used as inhibitors, and for each inhibitor, 6-10 concentrations were tested. Four replicates of each experiment were done and the values are displayed as mean7SD. The inhibition concentration (I50) for each inhibitor was determined based on log-concentration vs. log% inhibition regression analysis. The insensitivity factor is the ratio of I50 of the resistant type enzyme to that of the susceptible colony. The plot of the log of residual activity against time was linear for a given inhibitor concentration and was used to calculate the bimolecular rate constant (Ki). A resistance ratio (RR) was calculated as the value of the resistant LD50/the susceptible LD50 value for the insecticide treatment. For the inhibition assays, fly heads were homogenized in 0.1 mL of 100 mM sodium phosphate buffer (pH 7.0) containing 1% Triton X-100 by volume. The homogenate was centrifuged at 5000 g for 1 min and the supernatant was employed for an AChE activity enzyme assay. The supernatant was pre-incubated for 10 min with 230 nM fenitroxon or buffer only at 3771 1C before the sensitivity of AChE to fenitroxon was tested. The inhibition of the enzyme was expressed as the mean inhibition activity as a percentage of the original activity. Additional details regarding the establishment of the resistant lines and experimental procedures are given by Hsu et al. (2004). 2.3. Synthesis of cDNA
2. Materials and methods 2.1. Colonies A colony of the oriental fruit fly, B. dorsalis, was established in our laboratory from specimens collected from central Taiwan (1994) and maintained without any exposure to insecticides as the susceptible colony. 2.2. Selection and biochemical assays for resistance To establish the resistant colony, adult flies of 3–5 days old were taken from the susceptible colony. Stock solutions of insecticides were prepared in 10 mg/ml of acetone for topical application assay and 10 mM for the acetylcholinesterase-insensitivity study. Working dilutions were made from these stock solutions prior to use. The susceptibility of the flies to specific doses of different insecticides was assayed using topical application.
Using adults from the susceptible colony, total RNA was extracted from the heads of 15 flies using a microscale total RNA extraction kit (RNeasyR Mini kit, Qiagen Gmbh). The extract was treated with DNase (Qiagen Gmbh). One picogram to 5 mg of total RNA was used for the first strand synthesis of cDNA in 20 ml of total volume using the ThermoScriptTM reverse transcription reaction a cDNA synthesis system (Invitrogen, Inc.), according to the manufacturer’s instructions. Poly dT (20) was used as the reverse primer. 2.4. PCR amplifications, cloning and DNA sequence analysis A partial cDNA of the ace gene of B. dorsalis was amplified by PCR using degenerate primers designed from comparisons of conserved regions of published cDNA sequences of ace genes. The sequences used were from D. melanogaster (Accession no. X05893), Apis mellifera
ARTICLE IN PRESS 398
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
(Accession no. AF213012), and vertebrate sequences available in NCBI Wed (Accession nos. X05497, X56518, and X55040, respectively). These were compared using the pile up program of SEQWEB software (Accelrys Inc). The degenerate primers designed from this are Fd [50 TGGATCTAYGGVGGTGGBTTCWWSA] and Rd [50 TGSRGCACSCCCATCCA], where V denotes A or T, B denotes T, C or G, W denotes, A or T, S denotes C or G, and R denotes A or G. The amplification reaction consisted of 2 ml of the firststrand cDNA reaction mix as a template, 10 p mol of each primer (Fd and Rd), 0.2 mM dNTPs, 1.5 mM MgCl2, and 2.5 unit Platinum R taq DNA polymerases (Invitrogen) in a reaction of 50 ml volume. The cycling profile consisted of an initial denaturation at 94 1C for 2 min followed by 35 cycles consisting of 94 1C for 1 min, 45 1C for 1 min and 72 1C for 2 min in a DNA thermal cycler (Model 2400, Perkin Elmer Cetus). The amplified PCR products (about 1 kb length) were ligated with T4 DNA ligase for subcloning into the bluescript plasmid vector (Yeastern Biotech, Taiwan) and sequencing in both directions. The DNA sequences were analyzed by the BLAST program of the NCBI. Alignment to the sequences of other insect ace genes confirmed the identity of this sequence as a partial cDNA representing a B. dorsalis ace gene. Anti-sense primers specific to this partial ace gene sequence were designed and used in 50 and 30 RACE (rapid amplification of cDNA ends) using the GibcoBRL cDNA Amplification Kit (Life Tech. USA) to amplify the complete cDNA. A specific primer Rs [50 -TATTGCCTGTCTGTAGC TA] was also designed to be located 63 nucleotides from downstream of the stop codon of the ace gene was employed as the reversed primer to synthesize first-strand cDNA in the resistant lines. The PCR amplifications were carried out as described above except that each cycle used the parameters 94 1C for 30 s, 52 1C for 20 s, and 72 1C for 2.5 min.
2.5. PCR-RFLP diagnostic tests for detection of specific point mutations in the ace gene Primers for the diagnostic tests were designed directly from the B. dorsalis ace cDNA sequence (GenBank Accession no. AY155500) derived here. The first nonsynonymous mutation (designated I214 V) resulting from an A to G substitution creates a site for the restriction enzyme BssNAI (GTATAC) (Fig. 1A). In this case the forward primer ace214F (50 TCCGCAGAACACCACA AAT) and reverse primer ace214R (50 CTGATCCCACAA CCCCAC) are used to amplify a DNA fragment 231 bp in size that contains this site. Digestion of the amplified fragment with BssNAI detects whether the resistant allele containing this site is present either in a heterozygous or homozygous state or is completely absent (as in individuals homozygous for the susceptible sequence).
For the second nonsynonymous mutation (G488S), the sequence change does not directly alter a restriction enzyme recognition site. For detection of this mutation, an altered forward primer—ace488F (50 AGCAGCAAATCGGACG CCCAGT) is used together with the reverse primer— ace488R (50 GAGGTGCTAGTGCGGTGTGTAAAGT) to introduce a one base substitution (bold face, C substituted for A) into the product. This allows for the detection of the presence vs. absence of the resistant allele when the amplification product is digested with the restriction enzyme BglI. In the case of the susceptible allele, the presence of the base sequence TGGC in the cDNA immediately following the forward primer, together with the C base substitution introduced from the primer, creates a cutting site (GCCNNNNNGGC) for this restriction enzyme. In the resistance allele, the presence of the base sequence TAGC immediately following the primer does not allow for BglI cutting using the altered primer. For detection of third nonsynonymous mutation (Q643R), another altered forward primer—ace643F (50 CT TCCTCTCTGCAACAATCGC) is used together with the reverse primer—ace643R (50 GGAATGCCTAAGACCA GTGACAG) to introduce two base substitutions (bold face, TC for AA) into the product. The incorporation of the TC bases in place of the AA normally found at this location allows for the detection of the presence vs. absence of the resistant allele when this product is digested with the restriction enzyme NruI. In the resistant allele, the presence of the bases GA immediately following the primer, together with the TC base substitutions introduced from the primer, creates a cutting site (TCGCGA) for this restriction enzyme (NruI). In the susceptible allele, the use of this primer does not create an NruI site because in this allele the bases GG are found in the sequence immediately following the site where the primer is incorporated. The PCR amplification profiles for detection of each of the three point mutations described were as follows: an initial denaturation was done at 94 1C for 2 min (one time) followed by 25 cycles consisting of 94 1C for 30 s, 55 1C for 20 s and 72 1C for 10 s followed by a final extension of 72 1C 10 min. Five ml of the amplification products were incubated for 1 h in manufacturer’s reaction buffer (Promega, Inc. or Takara, Inc.) with 5 U of each enzyme (BssNAI for I214V, BglI for G488S, and NruI for Q643R). Digestion products were electrophoresed on 4% (w/v) agarose gels. 3. Results and discussion Using exposure to high concentrations of the organophosphorus insecticide fenitrothion, a colony of B. dorsalis exhibiting high levels of resistance to the action of this insecticide has been established (described by Hsu et al., 2004). In the fenitrothion-resistant colony, the level of AChE activity was significantly lower compared to that of the susceptible colony (Table 1). An assay for inhibition of acetylcholinesterase activity revealed that at least 11-fold
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
399
Fig. 1. PCR-RFLP analysis to detect the presence of the I214V, G488S and Q643R mutations in individual flies representing various susceptible and resistant genotypes (see text for details of methodology used). The lane on the extreme left (A, C) or right (B) contains a size marker (multiples of 20 bp fragments); (A) lanes contain the BssNAI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lane 1), homozygous for the I214V ‘‘resistance’’ allele (RR, lanes 2–3, and 5–10) or heterozygous (RS, lane 4). (B) Lanes contain the BglI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lane 6) homozygous for the ‘‘resistance’’ allele (RR, lanes 1–2) or heterozygous (RS, lanes 3–5 and 7–10). (C) Lanes contain the NruI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lanes 2–4), homozygous for the ‘‘resistance’’ allele (RR, lanes 6–8) or heterozygous (RS, lanes 1, 5, 9 and 10).
Table 1 AChE activity and inhibition of AChE activity by various compounds in Bactrocera dorsalis Lines
S R Insensitivity factor
AChE activity
992769.2 498743.2*
Ki ( 106 M1 min17SD)
I50 (nM) Methyl-paraoxon
Paraoxon
Fenitroxon
Methyl-paraoxon
Paraoxon
Fenitroxon
10.771.24 140750.5* 12.9
0.45670.156 5.0271.35* 11.0
0.65170.044 8.4474.04* 13.0
0.7570.0205 0.029970.0019
67.677.3 2.3570.36
24.371.23 1.0370.06
The asterisk (*) indicates a significant difference between the susceptible and the resistant colonies at Po0:05 (t-test).
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
400
greater insensitivity to inhibitors was also detected in the resistant colony. These findings suggest that alteration of the acetylcholinesterase enzyme activity is a major contributor to the resistance of these B. dorsalis flies to fenitrothion. For the molecular analysis, a full-length sequence of the wild type B. dorsalis ace cDNA was obtained here using degenerate primers and the RACE technique and is available using GenBank accession no. AY155500. The B. dorsalis ace gene has an open reading frame of 2022 bp, encoding a putative protein of 673 amino acids. This putative B. dorsalis AChE protein is 80% identical to that of D. melanogaster, and 97% identical to the sequence of the wild type B. oleae AChE as reported by Vontas et al. (2002). A total of 17 amino acid residues from this putative B. dorsalis enzyme differ from those of B. oleae. Within B. dorsalis, a comparison of the ace gene cDNA sequences from fenitrothion-susceptible and -resistant flies showed 98% identity. The sequence results obtained for the susceptible colony were consistent in material examined from the heads of 15 individual B. dorsalis specimens. For the fenitrothion-resistant flies, results reported were consistent in head material from five randomly selected individuals from the colony (nos. 1–5) and five individuals (nos. 6–10) that were survivors following the application of a maximum diagnostic dose of fenitrothion (4350 ng/fly). In these comparisons, several silent nucleotide substitutions were observed in the cDNA sequence derived from the fenitrothion-resistant B. dorsalis (GenBank accession no. AY183672). In addition, nucleotide substitutions at bases 640, 1462, and 1928 resulted in changes in the codons found at these locations (ATA to GTA, GGC to AGC and CAA to CGA, respectively). These codon changes in turn represent amino acid substitutions in the predicted protein of I to V at residue 214 (designated I214 V), G to S at residue 488 (designated G488S), and Q to R at residue 643 (designated Q643R) in the predicted AChE protein of the resistant flies. The substantial effects on the resistance ratio and inhibition of AChE enzyme activity seen here in comparisons of the susceptible vs. resistant line tested (Tables 1 and 2) suggest that one or a combination of these nonsynonymous mutations may affect critical parts of the structure and activity of the AChE enzyme. All other nucleotide sequence substitutions observed in the resistant flies result in synonymous changes in the amino acid sequence of the AChE enzyme and are not likely to exert effects on the activity of this enzyme.
Table 2 Resistance ratio and a percentage remaining AChE activity Lines
Resistance ratio fold increase
Remaining AChE activity (%) (mean7SD)/no.
S R
1 406
12.972.95/5 85.073.35/5
The I214V substitution observed here in B. dorsalis is identical to one of the changes reported in the altered AChE enzyme described for a strain of B. oleae exhibiting high levels of organophosphate resistance (Vontas et al., 2002). This change is also equivalent to the I199V substitution in Drosophila (Mutero et al., 1994). The G488S substitution seen in B. dorsalis is also identical to a second change in the AChE enzyme structure in resistant B. oleae flies (Vontas et al., 2002). This substitution (G488) is also equivalent to the G396 in torpedo, or G474 in Drosophilia. The amino acid residue affected by the I214V mutation is found not in the active-site gorge, but in a second shell of AChE according to Vontas et al. (2002). This residue also appears to interact with the key ‘‘anionic’ site residue, W121 (138 in B. dorsalis) (Harel et al., 2000) and may result in decreased deacetylation activity (Shi et al., 2004). Though this mutation alone apparently confers weak organophosphorus resistance (Mutero et al. 1994), it could also affect the insensitivity of the enzyme to compounds such as malaoxon, dichlorvos, ethyl paroxon, propoxur, carbaryl and pirimicarb (Villatte et al., 2000). The G488S substitution, which occurs in all resistant ace gene sequences analyzed herein, is also identical to a mutation reported in B. oleae, may alter the configuration of the adjacent glutamate in the catalytic triad and promote the nucleophilic attack by water on the carbonyl group of the phosphorylated serine (Vontas et al., 2002). The independent occurrence of these two identical mutations, I214V and G488S, in both B. oleae and B. dorsalis is especially striking because different insecticides were used (dimethoate in B. oleae and fenitrothion in B. dorsalis) to establish resistant colonies. The I214 V change is also identical with one (I119 V) reported as being involved in the acquisition of organophosphate resistance in D. melanogaster in work described by Mutero et al. (1994). In addition to these species, similar phenomena have been reported for mosquito species (Weill et al., 2004) where identical alterations of the AChE enzyme appear to have arisen independently in strains of different species exhibiting resistance to organophosphate-based and carbamate-based insecticides. In the housefly M. domestica, Kozaki et al. (2001) also reported that mutations in an ace gene conferring resistance to organophosphorus insecticides were identical in some cases to those reported for resistant strains of D. melanogaster. Taken together, these results strongly support the idea put forward by ffrenchConstant et al. (1998) suggesting that only a few specific residues in key genes such as ace are target sites for changes conferring insecticide resistance. Another major implication of the similarities in the nature of the changes in genes such as ace corresponding to the acquisition of insecticide resistance in these species is that specific tests may be designed to monitor changes in the frequency of specific mutations or haplotypes in populations undergoing treatment with insecticides. Using the results obtained here,
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402 Table 3 Frequencies of resistance alleles in flies from susceptible vs. resistant colony by PCR-RFLP testing Lines
Resistance mutation allelic frequencies I214V
Susceptible Fenitrothion-r
G488S
Q643R
Freq.
n
Freq.
n
Freq.
n
0 100
10 10
0 100
10 10
0 100
10 10
similar tests to detect the occurrence of variants conferring resistance in B. dorsalis should be possible as well. The third substitution, Q643R, occurs near the end of the peptide and has not been reported before in resistant insects. As this mutation occurs only in combination with the other two substitutions described here, elucidation of any functional change in the activity of the enzyme occurring as a result of this single substitution will require additional studies. However, using the PCR-RFLP tests described here, it will now be possible to rapidly survey populations to determine if all three mutations occur together in natural populations of B. dorsalis that may have developed some degree of resistance. Using flies of known genotypes, Fig. 1 shows that PCR-RFLP testing can clearly establish the presence vs. absence of each of these allelic types in individual flies. In flies from the resistant vs. susceptible lines used here, the results shown in Table 3 shows that all of the flies tested from the original susceptible colony were homozygous for the wild type ace susceptible allele, while all of the resistant flies tested were homozygous for all three mutations found in the ace resistant allele. In the original susceptible colony some flies that were heterozygous must have been present for selection to act on, however the results obtained here suggest that they exist only at relatively low frequencies. For surveys of natural populations of B. dorsalis, PCRRFLP testing of individuals from different regions may reveal the extent to which each of these mutations may occur independently or in some type of linkage combination in relation to extent of exposure to organophosphate based insecticides. In conclusion, the structure of the wild type ace gene from insecticide sensitive B. dorsalis has been identified and characterized along with the structure of an altered ace gene found in insecticide resistant flies. The analysis of cDNAs from these genes identified three mutations which, either alone or in combination may alter the activity of the AChE enzyme in resistant flies. The wild type and mutant ace gene cDNA sequences from B. dorsalis have also been compared to ace genes from other species, including the relatively closely related species B. oleae. Consistent with nomenclature adopted for comparison of ace sequences, the B. dorsalis gene described here may be designated as an ace2 homolog (Hawkes et al., 2005). In these species, the evolution of insecticide resistance shows strikingly similar
401
effects on specific target genes. To further investigate this phenomenon in B. dorsalis, molecular diagnostic tests to detect resistance-associated mutations have also been developed. In field situations where insecticides are used, these tests may allow for monitoring of changes in the genetic structure of populations leading to the rise of insecticide resistance. This type of information may also allow for the development of optimal strategies for the management of pest species by alerting growers to potential control problems in advance of their occurrence. Acknowledgements The authors appreciate Drs. C.-H. Wang, S.-C. Wang, C.-C. Ho, and M.-H. Hsu for the correction of earlier versions of this manuscript, and we wish to thank C.-G. Huang for technical assistance and Y.-C. Chen, and G.-Y. Li for their assistance with the experiments. The authors also wish to acknowledge the significant improvements to this manuscript suggested by the editor and three anonymous reviewers. This research was supported by the Department of Agriculture and Forestry, Taiwan Provincial Government, and the Council of Agriculture, Executive Yuan, Taiwan. References Andrews, M.C., Callaghan, A., Field, L.M., Williamson, M.S., Moores, G.D., 2004. Identification of mutations conferring insecticide-insensitive AChE in the cotton-melon aphid, Aphis gossypii Glover. Insect Mol. Biol. 13, 555–561. ffrench-Constant, R.H., Pittendrigh, B., Vaughan, A., Anthony, N., 1998. Why are there so few resistance-associated mutations in insecticide target genes? Phil. Trans. Biol. Sci. 353, 1685–1693. Fournier, D., Bride, J.M., Hoffman, F., Karch, F., 1992. Acetylcholinesterase: Two types of modifications confer resistance to insecticides. J. Biol. Chem. 267, 14270–14274. Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T., Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Threedimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes with two potent inhibitors. Prot. Sci. 9, 1063–1072. Hawkes, N.J., Janes, R.W., Hemingway, J., Vontas, J., 2005. Detection of resistance-associated point mutations of organophosphate-insensitive acetylcholinesterase in the olive fruit fly, Bactrocera oleae (Gmelin). Pestic. Biochem. Physiol. 81, 154–163. Hsu, J.-C., Feng, H.-T., 2000. Insecticide susceptibility of the oriental fruit fly (Bactrocera dorsalis (Hendel))(Diptera: Tephritidae) in Taiwan. Chinese J. Entomol. 20, 109–118. Hsu, J-C., Feng, H-T., 2002. Susceptibility of melon fly (Bactrocera cucurbitae) and oriental fruit fly (B. dorsalis) to insecticides in Taiwan. Plant Prot. Bull. 44, 303–314 (in Chinese, with English abstract). Hsu, J.-C., Feng, H.-T., Wu, W.-J., 2004. Resistance and synergistic effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in Taiwan. J. Econ. Entomol. 97, 1682–1688. Javed, N., Viner, R., Williamson, M.S., Field, L.M., Devonshire, A.L., Moores, G.D., 2003. Characterization of acetylcholinesterases, and their genes, from the hemipteran species Myzus persicae (Sulzer), Aphis gossypii (Glover), Bemisia tabaci (Gennadius) and Trialeurodes vaporariorum (Westwood). Insect Mol. Biol. 12, 613–620. Konno, Y., Shishido, T., 1989. Binding-protein, a factor of fenitrooxon detoxication in OP-resistant rice stem borers. J. Pest. Sci. 14, 359–362.
ARTICLE IN PRESS 402
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31, 991–997. Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistanceassociated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. USA 91, 5922–5926. Shi, M.A., Lougarre, A., Alies, C., Fremaux, I., Tang, Z.H., Stojan, J., Fournier, D., 2004. Acetylcholinesterase alterations reveal the fitness cost of mutations conferring insecticide resistance. BMC Evol. Biol. 4, 5. Toda, S., Komazaki, S., Tomita, T., Kono, V., 2004. Two amino acid substitutions in acetylcholinesterase associated with pirimicarb and organophosphorous insecticide resistance in the cotton aphid, Aphis gossypii Glover (Homoptera: Aphididae). Insect Mol. Biol. 13, 549–553. Vaughan, A., Rocheleau, T., ffrench-Constant, R., 1997. Site-directed mutagenesis of an acetylcholinesterase gene from the yellow fever mosquito Aedes aegypti confers insecticide insensitivity. Exp. Parasitol. 87, 237–244.
Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D., 2000. A high number of mutations in insect acetylcholinesterase may provide insecticide resistance. Pestic. Biochem. Physiol. 67, 95–102. Vontas, J.G., Cosmidis, N., Loukas, M., Tsakas, S., Hejazi, M.J., Ayoutanti, A., Hemingway, J., 2001. Altered acetylcholinesterase confers organophosphate resistance in the olive fruit fly Bactrocera oleae. Pestic. Biochem. Physiol. 71, 124–132. Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M., Hemingway, J., 2002. Resistance-associated point mutations of organophosphate insensitive acetylcholinesterase, in the olive fruit fly Bactrocera oleae. Insect Mol. Biol. 11, 329–336. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marguine, M., Raymond, M., 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol. Biol. 13, 1–7. Zhu, K.Y., Clark, J.M., 1995. Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa decemlineata (Say). Insect Biochem. Mol. Biol. 25, 1129–1138.
Mutations in the acetylcholinesterase gene of Bactrocera dorsalis associated with resistance to organophosphorus insecticides Ju-Chun Hsua,b, David S. Haymerc, Wen-Jer Wub, Hai-Tung Fenga, a
Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Kuang Ming Road, Wufeng 413, Taichung Hsien, Taiwan b Department of Entomology, National Taiwan University, 27, Lane 113, Roosevelt Road, Sec. 4, Taipei 106, Taiwan c Department of Cell and Molecular Biology, University of Hawaii at Manoa, 1960 East-West Rd, Honolulu, HI 96822, USA Received 22 November 2005; received in revised form 8 February 2006; accepted 21 February 2006
Abstract Mutations in the gene encoding the enzyme acetylcholinesterase (AChE) of the oriental fruit fly, Bactrocera dorsalis, associated with resistance to an organophosphorus insecticide have been characterized. Three point mutations producing nonsynonymous changes in the predicted amino acid sequence of the product of the B. dorsalis ace gene in resistant vs. susceptible flies have been identified. One of these changes is unique to B. dorsalis while the other two occur at sites that are identical to mutations previously described for another Bactrocera species. Although the precise role of the third mutation is not clearly established, the independent origin of two identical alterations in these two species strongly supports the idea proposed previously that molecular changes associated with insecticide resistance in key genes and enzymes such as AChE are largely constrained to a limited number of sites. The results obtained here also suggest that the widespread use of organophosphorus insecticides will likely lead to a predictable acquisition of resistance in wild populations of B. dorsalis as well as other pest species. For surveys of B. dorsalis populations that may develop resistance, diagnostic tests using PCR-RFLP based methods for detecting the presence of all three mutations in individual flies are described. r 2006 Elsevier Ltd. All rights reserved. Keywords: Fenitrothion; Ace gene; Acetylcholinesterase; Insecticide resistance; Bactrocera dorsalis
1. Introduction The phenomenon of insecticide resistance is a potentially major impediment for effective control of a number of pest species of agricultural and medical importance. In many cases involving insecticide applications an initial failure to effectively control a pest has resulted in a huge resurgence of a population exhibiting resistance. For example, fenitrothion, an organothiophosphate-based insecticide, has been widely used for control of agricultural pests. The development of resistance, resulting in a reduction in effectiveness of fenitrothion and other organophosphatebased insecticides, has been observed in several insect species (Konno and Shishido, 1989; Kozaki et al., 2001; Vontas et al., 2001; Hsu and Feng, 2002). In part because Corresponding author. Tel.: +886 4 23302101; fax: +886 4 23314106.
E-mail address: [email protected] (H.-T. Feng). 0965-1748/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2006.02.002
of this, the prospects for the future of the chemical control have often been called into question. A better understanding of the mechanisms by which resistance occurs may significantly delay the onset of problems and limitations associated with this control approach. The enzyme acetylcholinesterase (AChE, EC 3.1.1.7) is known to be the target of many organophosphorus and carbamate insecticides. In most cases, the acquisition of resistance corresponds to a measurable alteration of AChE activity. These alterations, in almost all cases, arise from point mutations in the gene (designated ace) encoding this enzyme that produce amino acid substitutions in regions corresponding to the active site of the AChE enzyme. Specific mutations in ace genes affecting enzyme activity in association with resistance phenomena have been described in the house fly Musca domestica (Kozaki et al., 2001), several mosquito species (Vaughan et al., 1997; Kozaki et al., 2001; Weill et al., 2004), the Colorado potato beetle
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
(Zhu and Clark, 1995), the olive fruit fly (Vontas et al., 2002), the cotton aphid Aphis gossypii (Andrews et al., 2004; Toda et al., 2004) along with other hemipteran species (Javed et al., 2003), and Drosophila melanogaster (Fournier et al., 1992; Mutero et al., 1994). Also as described by Weill et al. (2004), many mosquito species appear to have two distinct ace genes (designated ace1 and ace2) while other insects, including tephritids such as the Bactrocera species, appear to have only one ace gene. The single ace gene found in these species appears to be an ortholog of the ace2 gene of mosquitoes (Hawkes et al., 2005). In the case of the oriental fruit fly, Bactrocera dorsalis (Hendel), an agriculture pest species which causes serious financial losses to orchards globally, the development of even subtle resistance can have a significant impact on the effectiveness of organophosphorus insecticides such as fenitrothion (Hsu and Feng, 2000). In this study, laboratory colonies of this species exhibiting resistance and susceptibility to fenitrothion were identified and characterized in terms of activity of the AChE enzyme and molecular changes in the structure of the gene encoding this enzyme. The results obtained here show that some of the specific structural changes of the B. dorsalis ace gene associated with the development of resistance are identical to changes reported in other species exhibiting insecticide resistance. The independent origin of identical gene specific changes in different species strongly supports the idea put forward by ffrench-Constant et al. (1998) that at the molecular level, resistance phenomena result from a limited set of changes in key genes such as the ace genes. This also suggests that the acquisition of resistance to organophosphorus insecticides will occur in a predictable manner in wild populations of this species, as well as in a wide range of other agricultural and medical pest species, where these agents are used for control purposes.
397
Individual adult flies, both from fenitrothion-resistant and fenitrothion-susceptible colonies, were used in this part of the investigation. The heads were used for biochemical tests and the bodies were used to isolate total RNA as described in the next section. For AChE activity assays with acetylthiocholine iodide (ATChI, 0.50 mM) as a substrate, 100 mg of flies’ heads were homogenized for use. AChE activity is expressed in terms of nmoles ATChI/ min/mg protein. Solutions of fenitroxon, methyl-paraoxon, and paraoxon (ethyl) were used as inhibitors, and for each inhibitor, 6-10 concentrations were tested. Four replicates of each experiment were done and the values are displayed as mean7SD. The inhibition concentration (I50) for each inhibitor was determined based on log-concentration vs. log% inhibition regression analysis. The insensitivity factor is the ratio of I50 of the resistant type enzyme to that of the susceptible colony. The plot of the log of residual activity against time was linear for a given inhibitor concentration and was used to calculate the bimolecular rate constant (Ki). A resistance ratio (RR) was calculated as the value of the resistant LD50/the susceptible LD50 value for the insecticide treatment. For the inhibition assays, fly heads were homogenized in 0.1 mL of 100 mM sodium phosphate buffer (pH 7.0) containing 1% Triton X-100 by volume. The homogenate was centrifuged at 5000 g for 1 min and the supernatant was employed for an AChE activity enzyme assay. The supernatant was pre-incubated for 10 min with 230 nM fenitroxon or buffer only at 3771 1C before the sensitivity of AChE to fenitroxon was tested. The inhibition of the enzyme was expressed as the mean inhibition activity as a percentage of the original activity. Additional details regarding the establishment of the resistant lines and experimental procedures are given by Hsu et al. (2004). 2.3. Synthesis of cDNA
2. Materials and methods 2.1. Colonies A colony of the oriental fruit fly, B. dorsalis, was established in our laboratory from specimens collected from central Taiwan (1994) and maintained without any exposure to insecticides as the susceptible colony. 2.2. Selection and biochemical assays for resistance To establish the resistant colony, adult flies of 3–5 days old were taken from the susceptible colony. Stock solutions of insecticides were prepared in 10 mg/ml of acetone for topical application assay and 10 mM for the acetylcholinesterase-insensitivity study. Working dilutions were made from these stock solutions prior to use. The susceptibility of the flies to specific doses of different insecticides was assayed using topical application.
Using adults from the susceptible colony, total RNA was extracted from the heads of 15 flies using a microscale total RNA extraction kit (RNeasyR Mini kit, Qiagen Gmbh). The extract was treated with DNase (Qiagen Gmbh). One picogram to 5 mg of total RNA was used for the first strand synthesis of cDNA in 20 ml of total volume using the ThermoScriptTM reverse transcription reaction a cDNA synthesis system (Invitrogen, Inc.), according to the manufacturer’s instructions. Poly dT (20) was used as the reverse primer. 2.4. PCR amplifications, cloning and DNA sequence analysis A partial cDNA of the ace gene of B. dorsalis was amplified by PCR using degenerate primers designed from comparisons of conserved regions of published cDNA sequences of ace genes. The sequences used were from D. melanogaster (Accession no. X05893), Apis mellifera
ARTICLE IN PRESS 398
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
(Accession no. AF213012), and vertebrate sequences available in NCBI Wed (Accession nos. X05497, X56518, and X55040, respectively). These were compared using the pile up program of SEQWEB software (Accelrys Inc). The degenerate primers designed from this are Fd [50 TGGATCTAYGGVGGTGGBTTCWWSA] and Rd [50 TGSRGCACSCCCATCCA], where V denotes A or T, B denotes T, C or G, W denotes, A or T, S denotes C or G, and R denotes A or G. The amplification reaction consisted of 2 ml of the firststrand cDNA reaction mix as a template, 10 p mol of each primer (Fd and Rd), 0.2 mM dNTPs, 1.5 mM MgCl2, and 2.5 unit Platinum R taq DNA polymerases (Invitrogen) in a reaction of 50 ml volume. The cycling profile consisted of an initial denaturation at 94 1C for 2 min followed by 35 cycles consisting of 94 1C for 1 min, 45 1C for 1 min and 72 1C for 2 min in a DNA thermal cycler (Model 2400, Perkin Elmer Cetus). The amplified PCR products (about 1 kb length) were ligated with T4 DNA ligase for subcloning into the bluescript plasmid vector (Yeastern Biotech, Taiwan) and sequencing in both directions. The DNA sequences were analyzed by the BLAST program of the NCBI. Alignment to the sequences of other insect ace genes confirmed the identity of this sequence as a partial cDNA representing a B. dorsalis ace gene. Anti-sense primers specific to this partial ace gene sequence were designed and used in 50 and 30 RACE (rapid amplification of cDNA ends) using the GibcoBRL cDNA Amplification Kit (Life Tech. USA) to amplify the complete cDNA. A specific primer Rs [50 -TATTGCCTGTCTGTAGC TA] was also designed to be located 63 nucleotides from downstream of the stop codon of the ace gene was employed as the reversed primer to synthesize first-strand cDNA in the resistant lines. The PCR amplifications were carried out as described above except that each cycle used the parameters 94 1C for 30 s, 52 1C for 20 s, and 72 1C for 2.5 min.
2.5. PCR-RFLP diagnostic tests for detection of specific point mutations in the ace gene Primers for the diagnostic tests were designed directly from the B. dorsalis ace cDNA sequence (GenBank Accession no. AY155500) derived here. The first nonsynonymous mutation (designated I214 V) resulting from an A to G substitution creates a site for the restriction enzyme BssNAI (GTATAC) (Fig. 1A). In this case the forward primer ace214F (50 TCCGCAGAACACCACA AAT) and reverse primer ace214R (50 CTGATCCCACAA CCCCAC) are used to amplify a DNA fragment 231 bp in size that contains this site. Digestion of the amplified fragment with BssNAI detects whether the resistant allele containing this site is present either in a heterozygous or homozygous state or is completely absent (as in individuals homozygous for the susceptible sequence).
For the second nonsynonymous mutation (G488S), the sequence change does not directly alter a restriction enzyme recognition site. For detection of this mutation, an altered forward primer—ace488F (50 AGCAGCAAATCGGACG CCCAGT) is used together with the reverse primer— ace488R (50 GAGGTGCTAGTGCGGTGTGTAAAGT) to introduce a one base substitution (bold face, C substituted for A) into the product. This allows for the detection of the presence vs. absence of the resistant allele when the amplification product is digested with the restriction enzyme BglI. In the case of the susceptible allele, the presence of the base sequence TGGC in the cDNA immediately following the forward primer, together with the C base substitution introduced from the primer, creates a cutting site (GCCNNNNNGGC) for this restriction enzyme. In the resistance allele, the presence of the base sequence TAGC immediately following the primer does not allow for BglI cutting using the altered primer. For detection of third nonsynonymous mutation (Q643R), another altered forward primer—ace643F (50 CT TCCTCTCTGCAACAATCGC) is used together with the reverse primer—ace643R (50 GGAATGCCTAAGACCA GTGACAG) to introduce two base substitutions (bold face, TC for AA) into the product. The incorporation of the TC bases in place of the AA normally found at this location allows for the detection of the presence vs. absence of the resistant allele when this product is digested with the restriction enzyme NruI. In the resistant allele, the presence of the bases GA immediately following the primer, together with the TC base substitutions introduced from the primer, creates a cutting site (TCGCGA) for this restriction enzyme (NruI). In the susceptible allele, the use of this primer does not create an NruI site because in this allele the bases GG are found in the sequence immediately following the site where the primer is incorporated. The PCR amplification profiles for detection of each of the three point mutations described were as follows: an initial denaturation was done at 94 1C for 2 min (one time) followed by 25 cycles consisting of 94 1C for 30 s, 55 1C for 20 s and 72 1C for 10 s followed by a final extension of 72 1C 10 min. Five ml of the amplification products were incubated for 1 h in manufacturer’s reaction buffer (Promega, Inc. or Takara, Inc.) with 5 U of each enzyme (BssNAI for I214V, BglI for G488S, and NruI for Q643R). Digestion products were electrophoresed on 4% (w/v) agarose gels. 3. Results and discussion Using exposure to high concentrations of the organophosphorus insecticide fenitrothion, a colony of B. dorsalis exhibiting high levels of resistance to the action of this insecticide has been established (described by Hsu et al., 2004). In the fenitrothion-resistant colony, the level of AChE activity was significantly lower compared to that of the susceptible colony (Table 1). An assay for inhibition of acetylcholinesterase activity revealed that at least 11-fold
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
399
Fig. 1. PCR-RFLP analysis to detect the presence of the I214V, G488S and Q643R mutations in individual flies representing various susceptible and resistant genotypes (see text for details of methodology used). The lane on the extreme left (A, C) or right (B) contains a size marker (multiples of 20 bp fragments); (A) lanes contain the BssNAI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lane 1), homozygous for the I214V ‘‘resistance’’ allele (RR, lanes 2–3, and 5–10) or heterozygous (RS, lane 4). (B) Lanes contain the BglI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lane 6) homozygous for the ‘‘resistance’’ allele (RR, lanes 1–2) or heterozygous (RS, lanes 3–5 and 7–10). (C) Lanes contain the NruI digest products from individuals either homozygous for the wild-type ‘‘susceptible’’ allele (SS, lanes 2–4), homozygous for the ‘‘resistance’’ allele (RR, lanes 6–8) or heterozygous (RS, lanes 1, 5, 9 and 10).
Table 1 AChE activity and inhibition of AChE activity by various compounds in Bactrocera dorsalis Lines
S R Insensitivity factor
AChE activity
992769.2 498743.2*
Ki ( 106 M1 min17SD)
I50 (nM) Methyl-paraoxon
Paraoxon
Fenitroxon
Methyl-paraoxon
Paraoxon
Fenitroxon
10.771.24 140750.5* 12.9
0.45670.156 5.0271.35* 11.0
0.65170.044 8.4474.04* 13.0
0.7570.0205 0.029970.0019
67.677.3 2.3570.36
24.371.23 1.0370.06
The asterisk (*) indicates a significant difference between the susceptible and the resistant colonies at Po0:05 (t-test).
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
400
greater insensitivity to inhibitors was also detected in the resistant colony. These findings suggest that alteration of the acetylcholinesterase enzyme activity is a major contributor to the resistance of these B. dorsalis flies to fenitrothion. For the molecular analysis, a full-length sequence of the wild type B. dorsalis ace cDNA was obtained here using degenerate primers and the RACE technique and is available using GenBank accession no. AY155500. The B. dorsalis ace gene has an open reading frame of 2022 bp, encoding a putative protein of 673 amino acids. This putative B. dorsalis AChE protein is 80% identical to that of D. melanogaster, and 97% identical to the sequence of the wild type B. oleae AChE as reported by Vontas et al. (2002). A total of 17 amino acid residues from this putative B. dorsalis enzyme differ from those of B. oleae. Within B. dorsalis, a comparison of the ace gene cDNA sequences from fenitrothion-susceptible and -resistant flies showed 98% identity. The sequence results obtained for the susceptible colony were consistent in material examined from the heads of 15 individual B. dorsalis specimens. For the fenitrothion-resistant flies, results reported were consistent in head material from five randomly selected individuals from the colony (nos. 1–5) and five individuals (nos. 6–10) that were survivors following the application of a maximum diagnostic dose of fenitrothion (4350 ng/fly). In these comparisons, several silent nucleotide substitutions were observed in the cDNA sequence derived from the fenitrothion-resistant B. dorsalis (GenBank accession no. AY183672). In addition, nucleotide substitutions at bases 640, 1462, and 1928 resulted in changes in the codons found at these locations (ATA to GTA, GGC to AGC and CAA to CGA, respectively). These codon changes in turn represent amino acid substitutions in the predicted protein of I to V at residue 214 (designated I214 V), G to S at residue 488 (designated G488S), and Q to R at residue 643 (designated Q643R) in the predicted AChE protein of the resistant flies. The substantial effects on the resistance ratio and inhibition of AChE enzyme activity seen here in comparisons of the susceptible vs. resistant line tested (Tables 1 and 2) suggest that one or a combination of these nonsynonymous mutations may affect critical parts of the structure and activity of the AChE enzyme. All other nucleotide sequence substitutions observed in the resistant flies result in synonymous changes in the amino acid sequence of the AChE enzyme and are not likely to exert effects on the activity of this enzyme.
Table 2 Resistance ratio and a percentage remaining AChE activity Lines
Resistance ratio fold increase
Remaining AChE activity (%) (mean7SD)/no.
S R
1 406
12.972.95/5 85.073.35/5
The I214V substitution observed here in B. dorsalis is identical to one of the changes reported in the altered AChE enzyme described for a strain of B. oleae exhibiting high levels of organophosphate resistance (Vontas et al., 2002). This change is also equivalent to the I199V substitution in Drosophila (Mutero et al., 1994). The G488S substitution seen in B. dorsalis is also identical to a second change in the AChE enzyme structure in resistant B. oleae flies (Vontas et al., 2002). This substitution (G488) is also equivalent to the G396 in torpedo, or G474 in Drosophilia. The amino acid residue affected by the I214V mutation is found not in the active-site gorge, but in a second shell of AChE according to Vontas et al. (2002). This residue also appears to interact with the key ‘‘anionic’ site residue, W121 (138 in B. dorsalis) (Harel et al., 2000) and may result in decreased deacetylation activity (Shi et al., 2004). Though this mutation alone apparently confers weak organophosphorus resistance (Mutero et al. 1994), it could also affect the insensitivity of the enzyme to compounds such as malaoxon, dichlorvos, ethyl paroxon, propoxur, carbaryl and pirimicarb (Villatte et al., 2000). The G488S substitution, which occurs in all resistant ace gene sequences analyzed herein, is also identical to a mutation reported in B. oleae, may alter the configuration of the adjacent glutamate in the catalytic triad and promote the nucleophilic attack by water on the carbonyl group of the phosphorylated serine (Vontas et al., 2002). The independent occurrence of these two identical mutations, I214V and G488S, in both B. oleae and B. dorsalis is especially striking because different insecticides were used (dimethoate in B. oleae and fenitrothion in B. dorsalis) to establish resistant colonies. The I214 V change is also identical with one (I119 V) reported as being involved in the acquisition of organophosphate resistance in D. melanogaster in work described by Mutero et al. (1994). In addition to these species, similar phenomena have been reported for mosquito species (Weill et al., 2004) where identical alterations of the AChE enzyme appear to have arisen independently in strains of different species exhibiting resistance to organophosphate-based and carbamate-based insecticides. In the housefly M. domestica, Kozaki et al. (2001) also reported that mutations in an ace gene conferring resistance to organophosphorus insecticides were identical in some cases to those reported for resistant strains of D. melanogaster. Taken together, these results strongly support the idea put forward by ffrenchConstant et al. (1998) suggesting that only a few specific residues in key genes such as ace are target sites for changes conferring insecticide resistance. Another major implication of the similarities in the nature of the changes in genes such as ace corresponding to the acquisition of insecticide resistance in these species is that specific tests may be designed to monitor changes in the frequency of specific mutations or haplotypes in populations undergoing treatment with insecticides. Using the results obtained here,
ARTICLE IN PRESS J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402 Table 3 Frequencies of resistance alleles in flies from susceptible vs. resistant colony by PCR-RFLP testing Lines
Resistance mutation allelic frequencies I214V
Susceptible Fenitrothion-r
G488S
Q643R
Freq.
n
Freq.
n
Freq.
n
0 100
10 10
0 100
10 10
0 100
10 10
similar tests to detect the occurrence of variants conferring resistance in B. dorsalis should be possible as well. The third substitution, Q643R, occurs near the end of the peptide and has not been reported before in resistant insects. As this mutation occurs only in combination with the other two substitutions described here, elucidation of any functional change in the activity of the enzyme occurring as a result of this single substitution will require additional studies. However, using the PCR-RFLP tests described here, it will now be possible to rapidly survey populations to determine if all three mutations occur together in natural populations of B. dorsalis that may have developed some degree of resistance. Using flies of known genotypes, Fig. 1 shows that PCR-RFLP testing can clearly establish the presence vs. absence of each of these allelic types in individual flies. In flies from the resistant vs. susceptible lines used here, the results shown in Table 3 shows that all of the flies tested from the original susceptible colony were homozygous for the wild type ace susceptible allele, while all of the resistant flies tested were homozygous for all three mutations found in the ace resistant allele. In the original susceptible colony some flies that were heterozygous must have been present for selection to act on, however the results obtained here suggest that they exist only at relatively low frequencies. For surveys of natural populations of B. dorsalis, PCRRFLP testing of individuals from different regions may reveal the extent to which each of these mutations may occur independently or in some type of linkage combination in relation to extent of exposure to organophosphate based insecticides. In conclusion, the structure of the wild type ace gene from insecticide sensitive B. dorsalis has been identified and characterized along with the structure of an altered ace gene found in insecticide resistant flies. The analysis of cDNAs from these genes identified three mutations which, either alone or in combination may alter the activity of the AChE enzyme in resistant flies. The wild type and mutant ace gene cDNA sequences from B. dorsalis have also been compared to ace genes from other species, including the relatively closely related species B. oleae. Consistent with nomenclature adopted for comparison of ace sequences, the B. dorsalis gene described here may be designated as an ace2 homolog (Hawkes et al., 2005). In these species, the evolution of insecticide resistance shows strikingly similar
401
effects on specific target genes. To further investigate this phenomenon in B. dorsalis, molecular diagnostic tests to detect resistance-associated mutations have also been developed. In field situations where insecticides are used, these tests may allow for monitoring of changes in the genetic structure of populations leading to the rise of insecticide resistance. This type of information may also allow for the development of optimal strategies for the management of pest species by alerting growers to potential control problems in advance of their occurrence. Acknowledgements The authors appreciate Drs. C.-H. Wang, S.-C. Wang, C.-C. Ho, and M.-H. Hsu for the correction of earlier versions of this manuscript, and we wish to thank C.-G. Huang for technical assistance and Y.-C. Chen, and G.-Y. Li for their assistance with the experiments. The authors also wish to acknowledge the significant improvements to this manuscript suggested by the editor and three anonymous reviewers. This research was supported by the Department of Agriculture and Forestry, Taiwan Provincial Government, and the Council of Agriculture, Executive Yuan, Taiwan. References Andrews, M.C., Callaghan, A., Field, L.M., Williamson, M.S., Moores, G.D., 2004. Identification of mutations conferring insecticide-insensitive AChE in the cotton-melon aphid, Aphis gossypii Glover. Insect Mol. Biol. 13, 555–561. ffrench-Constant, R.H., Pittendrigh, B., Vaughan, A., Anthony, N., 1998. Why are there so few resistance-associated mutations in insecticide target genes? Phil. Trans. Biol. Sci. 353, 1685–1693. Fournier, D., Bride, J.M., Hoffman, F., Karch, F., 1992. Acetylcholinesterase: Two types of modifications confer resistance to insecticides. J. Biol. Chem. 267, 14270–14274. Harel, M., Kryger, G., Rosenberry, T.L., Mallender, W.D., Lewis, T., Fletcher, R.J., Guss, J.M., Silman, I., Sussman, J.L., 2000. Threedimensional structures of Drosophila melanogaster acetylcholinesterase and of its complexes with two potent inhibitors. Prot. Sci. 9, 1063–1072. Hawkes, N.J., Janes, R.W., Hemingway, J., Vontas, J., 2005. Detection of resistance-associated point mutations of organophosphate-insensitive acetylcholinesterase in the olive fruit fly, Bactrocera oleae (Gmelin). Pestic. Biochem. Physiol. 81, 154–163. Hsu, J.-C., Feng, H.-T., 2000. Insecticide susceptibility of the oriental fruit fly (Bactrocera dorsalis (Hendel))(Diptera: Tephritidae) in Taiwan. Chinese J. Entomol. 20, 109–118. Hsu, J-C., Feng, H-T., 2002. Susceptibility of melon fly (Bactrocera cucurbitae) and oriental fruit fly (B. dorsalis) to insecticides in Taiwan. Plant Prot. Bull. 44, 303–314 (in Chinese, with English abstract). Hsu, J.-C., Feng, H.-T., Wu, W.-J., 2004. Resistance and synergistic effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in Taiwan. J. Econ. Entomol. 97, 1682–1688. Javed, N., Viner, R., Williamson, M.S., Field, L.M., Devonshire, A.L., Moores, G.D., 2003. Characterization of acetylcholinesterases, and their genes, from the hemipteran species Myzus persicae (Sulzer), Aphis gossypii (Glover), Bemisia tabaci (Gennadius) and Trialeurodes vaporariorum (Westwood). Insect Mol. Biol. 12, 613–620. Konno, Y., Shishido, T., 1989. Binding-protein, a factor of fenitrooxon detoxication in OP-resistant rice stem borers. J. Pest. Sci. 14, 359–362.
ARTICLE IN PRESS 402
J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 36 (2006) 396–402
Kozaki, T., Shono, T., Tomita, T., Kono, Y., 2001. Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica associated with point mutations. Insect Biochem. Mol. Biol. 31, 991–997. Mutero, A., Pralavorio, M., Bride, J.M., Fournier, D., 1994. Resistanceassociated point mutations in insecticide-insensitive acetylcholinesterase. Proc. Natl. Acad. Sci. USA 91, 5922–5926. Shi, M.A., Lougarre, A., Alies, C., Fremaux, I., Tang, Z.H., Stojan, J., Fournier, D., 2004. Acetylcholinesterase alterations reveal the fitness cost of mutations conferring insecticide resistance. BMC Evol. Biol. 4, 5. Toda, S., Komazaki, S., Tomita, T., Kono, V., 2004. Two amino acid substitutions in acetylcholinesterase associated with pirimicarb and organophosphorous insecticide resistance in the cotton aphid, Aphis gossypii Glover (Homoptera: Aphididae). Insect Mol. Biol. 13, 549–553. Vaughan, A., Rocheleau, T., ffrench-Constant, R., 1997. Site-directed mutagenesis of an acetylcholinesterase gene from the yellow fever mosquito Aedes aegypti confers insecticide insensitivity. Exp. Parasitol. 87, 237–244.
Villatte, F., Ziliani, P., Marcel, V., Menozzi, P., Fournier, D., 2000. A high number of mutations in insect acetylcholinesterase may provide insecticide resistance. Pestic. Biochem. Physiol. 67, 95–102. Vontas, J.G., Cosmidis, N., Loukas, M., Tsakas, S., Hejazi, M.J., Ayoutanti, A., Hemingway, J., 2001. Altered acetylcholinesterase confers organophosphate resistance in the olive fruit fly Bactrocera oleae. Pestic. Biochem. Physiol. 71, 124–132. Vontas, J.G., Hejazi, M.J., Hawkes, N.J., Cosmidis, N., Loukas, M., Hemingway, J., 2002. Resistance-associated point mutations of organophosphate insensitive acetylcholinesterase, in the olive fruit fly Bactrocera oleae. Insect Mol. Biol. 11, 329–336. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marguine, M., Raymond, M., 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol. Biol. 13, 1–7. Zhu, K.Y., Clark, J.M., 1995. Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa decemlineata (Say). Insect Biochem. Mol. Biol. 25, 1129–1138.