- Email: [email protected]
MviN mediates the regulation of environmental osmotic pressure on esrB to control the virulence in the marine fish pathogen Edwardsiella piscicida
Microbiological Research 239 (2020) 126528
Contents lists available at ScienceDirect
Microbiological Research journal homepage: www.elsevier.com/locate/micres
MviN mediates the regulation of environmental osmotic pressure on esrB to control the virulence in the marine fish pathogen Edwardsiella piscicida
T
Kaiyu Yina, Jin Zhanga, Jiabao Maa, Peng Jina, Yue Maa,b,c, Yuanxing Zhanga,b,c, Xiaohong Liua,b,c,*, Qiyao Wanga,b,c,* a
State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai 200237, China c Shanghai Engineering Research Center of Maricultured Animal Vaccines, Shanghai 200237, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Edwardsiella piscicida EsrB Lipid II flippase Osmotic pressure In vivo colonization
Edwardsiella piscicida is a notorious pathogen infecting diverse kinds of fish and causes substantial economic losses in the global aquaculture industries. The EsrA-EsrB two-component system plays a critical role in the regulation of virulence genes expression, including type III and type VI secretion systems (T3/T6SSs). In this study, the putative regulators of esrB were screened by the transposon insertion sequencing (TIS) technology. As a result, MviN, a lipid II flippase, was identified as a modulator to upregulate esrB and downstream T3/T6SS gene expression in the earlier growth phases while downregulate esrB at the later stages. Complement or overexpression of the mviN restored the esrB as well as T3/T6SS expression in the ΔmviN mutant strain. Moreover, MviN also mediated the regulation of environmental osmotic pressure on the expression of esrB. MviN was also found to significantly influence the in vivo colonization of E. piscicida in turbot. Collectively, this study enhanced our understanding of pathogenesis and virulence regulatory network of E. piscicida.
1. Introduction
we previously reported, RpoS could sense the multiple environmental signals and repress the expression of EsrB and T3/T6SS (Yin et al., 2018). Therefore, it’s important to further investigate the regulatory mechanism of EsrB to improve our understanding of the pathogenesis of E. piscicida and facilitate the invention of effective control and prevention strategies against this bacterium. MviN (MurJ), which has multiple predicted transmembrane helices, is a kind of integral membrane protein (Mohamed and Valvano, 2014). MviN is highly conserved in bacteria, such as Salmonella species, Burkholderia cenocepacia and E. piscicida (Rubinelli et al., 2015; Mohamed and Valvano, 2014; Wang et al., 2009). In the previous works, MviN has been identified as a kind of lipid II flippase, which is critical for the peptidoglycan (PG) biosynthesis (Ruiz, 2008). Also, MviN was reported to participate in the regulation of tolerance to environmental osmotic stresses (Joseleau-Petit. et al., 2007; Ruiz, 2008). Although several reports have demonstrated that MviN participates in the regulation of virulence and in vivo colonization of Vibrio alginolyticus and Francisella tularensis (Cao et al., 2010; Ulland et al., 2010), its functions in bacterial pathogenesis remain unclear. In this study, MviN was identified as an inhibitor of esrB. We found that MviN sensed the environmental osmotic pressure to control the expression of EsrB and T3/T6SSs, and then affected the in vivo
Edwardsiella piscicida (formerly called E. tarda) is an important Gram-negative and facultative aerobic marine pathogen. It causes haemorrhagic septicaemia, and leads to enormous economic loss in the fish aquaculture industry (Griffin et al., 2017; Leung et al., 2019). E. piscicida expresses type III and type VI secretion systems (T3/T6SSs), the critical virulence factors of this pathogen, to translocate more than 20 kinds of effectors into host cells to interrupt the host immune systems (Chen et al., 2017; Liu et al., 2017; Xie et al., 2010, 2015). EsrAEsrB two-component system strictly controls the expression of T3/ T6SSs (Lv et al., 2012). Besides, the response regulator (RR) EsrB plays essential roles in the regulation of diverse kinds of metabolic pathways, such as carbon sources utilization, amino acid biosynthesis, stress resistance, and so on (Liu et al., 2017; Guan et al., 2018; Yin et al., 2017). Because of the critical roles EsrB in virulence regulation in E. piscicida, it’s also a potential target for live-attenuated vaccine development (Mo et al., 2007). E. piscicida is an intracellular bacterium and invades many kinds of cell types in fish (Leung et al., 2019). It has been determined that the edwardsiellosis outbreak is closely related to environmental changes (Esteve and Alcaide, 2018; Xu and Zhang, 2014; Wei et al., 2019a). As ⁎
Corresponding authors at: State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China. E-mail addresses: [email protected] (X. Liu), [email protected] (Q. Wang).
https://doi.org/10.1016/j.micres.2020.126528 Received 22 April 2020; Received in revised form 31 May 2020; Accepted 13 June 2020 Available online 27 June 2020 0944-5013/ © 2020 Elsevier GmbH. All rights reserved.
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Table 1 Strains and plasmids used in this study. Strains or plasmids Edwardsiella piscicida EIB202 WT WT ΔP ΔesrB ΔmviN WT-pUTat mviN+ mviNOE ΔmviN/pUTat WT::PesrB-luxAB ΔmviN::PesrB-luxAB mviN+::PesrB-luxAB WT::Plac-esrB ΔmviN::Plac-esrB Escherichia coli DH5α λpir SM10 λpir BL21(DE3) Plasmids pDMK pDMK-mviN pUTat pUTat-PrpsU pUTat-mviN
Description
References
Wild-type strain, CCTCC M208068, Colr, Strr EIB202, pEIB202 cured, Colr EIB202, in-frame deletion of esrB, Colr, Strr EIB202, in-frame deletion of mviN, Colr, Strr EIB202, containing pUTat-PrpsU, Colr, Strr, Carbr ΔmviN, containing pUTat-mviN, Colr, Strr, Carbr EIB202, containing pUTat-mviN, Colr, Strr, Carbr ΔmviN, containing pUTat, Colr, Strr, Carbr EIB202, insertion disrupt of PesrB-luxAB in a neutral position, Colr, Strr, WT::PesrB-luxAB, in-frame deletion of mviN, Colr, Strr ΔmviN::PesrB-luxAB, containing pUTat-mviN, Colr, Strr, Carbr WT, replacing PesrB with Plac from pAKgfp1, Colr, Strr, WT::Plac-esrB, in-frame deletion of mviN, Colr, Strr
Xiao et al., 2008 Liu et al., 2017 Lv et al., 2012 This study Yin et al., 2017 This study This study This study Yin et al., 2018 This study This study Yin et al., 2018 This study
Host for π requiring plasmids Host for π requiring plasmids, conjugal donor Host strain for protein expression
Yin et al., 2018 Yin et al., 2018 Liu et al., 2017
Suicide vector, pir dependent, R6K, SacBR, Kanr,Cmr pDMK with ETAE_1425 fragment deleted 4–1535 nucleotides Medium copy number cloning vector, pAT153 replicon, Carbr pUTat derivative containing the promoter of rpsU, Carbr pUTat-PrpsU derivative containing mviN orf, Carbr
Yin et al., 2018 This study Yin et al., 2018 Yin et al., 2018 This study
For the auto-aggregation assay, the WT, ΔesrB, ΔmviN and mviNOE cultured in glass tubes were photographed by a camera after 24 h of incubation. For ECPs analysis, 100 ml DMEM culture supernatants of indicated strains with protease addition went through a kind of 0.22 μm Millex filter (Millipore) and were then concentrated to 250 μl with a 10kDa-cutoff centrifugal filter device (Millipore). As we previously reported, the ECPs of indicated strains were detected with SDS-PAGE assays (Yin et al., 2018). For Western blot analysis, the cell pellets of indicated strains were resuspended in low-salt buffers to normalize the cell densities depend on OD600 (Yin et al., 2020). The migration of samples form SDS-PAGE to PVDF membranes (Millipore) was performed as described previously (Yin et al., 2020). Additionally, DnaK was used as a loading control in the western blot analysis.
colonization of E. piscicida. This study advanced our understanding of the pathogenesis and virulence regulatory mechanism of E. piscicida. 2. Materials and methods 2.1. Bacterial strains construction and culture conditions Table 1 is the list of the plasmids and strains used in this study. The mviN in-frame deletion mutant (ΔmviN), mviN complementary and over-expression strains (mviN+ and mviNOE) were constructed as described previously (Yin et al., 2020). The strains for minimal inhibitory concentration assays and fluorescence value detection (ΔmviN::PesrBkanr, ΔmviN::PesrB-luxAB and mviN+::PesrB-luxAB) were constructed based on the WT::PesrB-kanr or WT::PesrB-luxAB, which contained the reporter fusions (PesrB-kanr or PesrB-luxAB) at the end of glmS gene on the genome (Yin et al., 2018). The construction of ΔmviN::Plac-esrB was based on the WT::Plac-esrB, which replaced the original esrB promoter with lac promoter (Yin et al., 2018). All the primers were listed in Table 2. The Luria-Bertani (LB) broth (Becton Dickinson, Sparks, MD, USA), Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Grand Island, NY, USA) or LB agar were used to culture the strains. The cultural temperature was 28 °C (E. piscicida) or 37 °C (Escherichia coli). In this study, the final concentration of the antibiotics used as follow: colistin, 16.7 μg ml-1; chloramphenicol, 25 μg ml-1; and carbenicillin, 100 μg ml-1.
2.4. Quantitative real-time PCR (qRT-PCR) The WT and mviNOE strains were cultured overnight, and then subinoculated into DMEM and cultured at 28 °C for 14 h, respectively. The RNA isolation kit (Tiangen, Beijing, China) was used to extract the RNA samples from each culture. Nanodrop was used to measure the concentrations of RNA samples, and the reverse transcription was conducted with PrimeScript II 1 st Strand cDNA Synthesis Kit (TaKaRa). The qRT-PCR assays were performed as we described previously (Yin et al., 2020). The quantification of the relative qualities for each transcript was performed following the comparative CT (2−ΔΔCT) method, and the internal control was the housekeeping gyrB gene.
2.2. Minimum inhibitory concentration assay 2.5. Relative fluorescence units (RFUs) measurement The MIC assay was performed as previously described (Yin et al., 2018). The WT::PesrB-kanr and ΔmviN::PesrB-kanr strains were statically cultured in DMEM, which contains a series of concentrations of kanamycin (Kan), at 28 °C for 24 h, respectively. The cell numbers were calculated by measuring the optical densities at 600 nm (OD600) (Biotek, Winooski, VT, USA).
The indicated strains were cultured in DMEM at 28 °C. 200 μl of each sample were taken out at indicated time points, and the measurement of the fluorescence units was performed as described previously (Yin et al., 2020). The calculation method of relative fluorescence units (RFUs) of each sample was as follows: RFU = (AFU-BFU)/ OD600, in which AFU means the actual fluorescence unit. At the same time, BFU represents the background fluorescence unit.
2.3. Auto-aggregation, extracellular proteins (ECPs) analysis and Western blot
2.6. Growth curve measurement Overnight cultured E. piscicida strains were sub-inoculated into DMEM at a 1:100 dilution and statically cultured at 28 °C, respectively.
107 CFU overnight cultures of WT, ΔmviN and mviN+ were sub2
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Table 2 Primers used in this study. Name
Sequence (5′ - 3′)
Mutants construction mviN-P1 CCCCCCCGAGCTCAGGTTACCCGGATCTATTTTTGCCGATGTGACTGAGG mviN-P2 CCCGACGTCGGTTCATCGTCAGGGTT mviN-P3 ATGAACCGACGTCGGGGCAGCGGCT mviN-P4 GAGTACGCGTCACTAGTGGGGCCCTTCTAGTGCGGATCTCTCCAAAAACC mviN-outF CTTCATAGCCGCACTTTCGG mviN-outR TGACGGCCCGTACGCTGA Complementary and overexpression strains construction mviN-OE-PF TGAGAGGCACGAGCTCGATTATGAATCTACTTAAATCACT mviN-OE-PR CTGCAGGTCGACGGATCCCCTTATAGCACCGCGCTGCGGG qRT-PCR esrB-F GGGCTTTGCTTCAGGACGTA esrB-R GCCCGATCTGGTCTTACTCG eseB-F CCCCTTTATCCAGCCCCTTG eseB-R GCCAAGTTCAAGAAAGCGGG evpA-F ATCTGTCATTCCGCACCGAG evpA-R TTTTCAGGTCAGAGAGGCGG ethA-F TTCTGGGACAATACGCCGAC ethA-R TCCCGGTTAAATAGACGCCG ethB-F CGATACGCAAAACGAGCAGG ethB-R TATCGCGGTTATTGGCCTCC mviN-F CTGGCTGCGGTCAGCTCAA mviN-R GTCGCGCAGGCGGAAT gyrB-F CCGATGATGGTACGGGTCTG gyrB-R GCTTTTCAGACAGGGCGTTC
such as Salmonella enterica, Escherichia coli, E. piscicida, and so on (Fig. 1c). As a kind of lipid II flippase, the primary function of MviN is responsible for the translocation of peptidoglycan precursors (lipid II) across the cytoplasmic membrane to periplasmic space (Fig. 1d). However, there were few reports on the regulatory function of MviN. Interestingly, the encoding gene of MviN (mviN or murJ) is locating nearby the flg cluster for flagellar biosynthesis either in E. coli or S. enterica, while the one in E. piscicida is closing to argS gene (ArgininetRNA ligase) (Fig. 1e). This result illustrates that MviN might have specific functions in E. piscicida.
inoculated into indicated media. The cell densities were measured with Synergy 2 microplate reader at OD600. 2.7. Competition index (CI) assay Sub-cultured strains were diluted, and then mixed at equally CFU. The injection dose of each group was 105 CFU/tail. At indicated time points, the livers from turbot (Scophthalmus Maximus) in each group (3 tails/group) were taken out, ground and swapped on DHL agar plates containing or not containing Cm. Colonies numbers on each plate were counted, and ratios of the bacterial determined the CIs.
3.2. MviN mediates the regulation of osmotic pressure on esrB transcription 2.8. Statistical analysis According to the TIS analysis, MviN behaved as an activator of esrB. To validate this, the strains carrying the PesrB-luxAB reporter, which indicating the activities of esrB promoter, at the neutral site, i.e. WT::PesrB-luxAB, ΔmviN::PesrB-luxAB and mviN+::PesrB-luxAB (Table 1), were constructed and then statically cultured in DMEM at 28 °C, respectively. The normalized RFUs respective to cell densities (OD600) were measured every 3 h (Fig. 2a). At early exponential growth phase (∼ 3 h), RFUs of WT::PesrB-luxAB and mviN+::PesrB-luxAB were markedly higher than that of ΔmviN::PesrB-luxAB. However, the RFUs of ΔmviN::PesrB-luxAB were significantly higher than that of WT::PesrBluxAB and mviN+::PesrB-luxAB at late growth phase. These mean that MviN exerts different functions respective to the regulation on esrB expression at early and late growth phase. As an essential protein in the process of cell wall biosynthesis, MviN is critical for the osmotic pressure response (Ruiz, 2008). We thus suspect that the environmental osmotic pressure might mediate MviN regulation of esrB expression. To validate this, we first detected the growth of WT, ΔmviN and mviN+ grown in DMEM, a medium that enables T3/T6SS production. After cultured in DMEM media for 12 h, ΔmviN showed slightly but significant growth defect compared with that of WT and mviN+ (Fig. 2b). However, when we added a moderate amount of sucrose (Suc), which was used as a kind of osmotic stabilizer in the medium to prevent cell lysis (Joseleau-Petit. et al., 2007), into DMEM media, the growth defects of ΔmviN disappeared (Fig. 2c). We then measured the RFUs of WT::PesrB-luxAB, ΔmviN::PesrB-luxAB and mviN+::PesrB-luxAB under indicated conditions at 3 h. Notably, the
Data analysis was conducted with the help of GraphPad Prism (version 6; GraphPad Software, Inc., La Jolla, CA, USA). A two-tailed Student’s unpaired t-test was used to compare the differences between the indicated groups. P < 0.01 was considered significant difference. GeneDoc (version 2.7) was used to align the amino acid sequences. 3. Results 3.1. MviN regulates the transcription of esrB The transposon insertion sequencing (TIS) technology was employed to investigate the regulatory mechanism of esrB (Yin et al., 2018). Analysis of the TIS data indicated that a protein named MviN might be a novel activator of esrB, as the insertion frequency of its encoding gene (mviN, ETAE_1425) showed a significant decrease (Fold Change = 7.4, P < 0.05) in the output group (Fig. 1a). To validate the result, we constructed the deletion mutant of mviN (ΔmviN::PesrB-kanr) based on the WT::PesrB-kanr (the background strain of the transposon insertion library). These two strains were then cultured in DMEM media with gradient concentrations of kanamycin (Kan), and the bacteria densities were measured. As expected, the ΔmviN::PesrB-kanr showed significant growth defect at higher Kan concentration (> 300 μg/ml), respective to that of the WT::PesrB-kanr (Fig. 1b). These results suggested that MviN might activate the transcription of esrB. MviN is conserved and widely exists in Gram-negative bacteria, 3
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Fig. 1. MviN participates in the regulation of esrB according to the transposon insertion sequencing (TIS) screen. (a) Artemis plots of the transposon insertion frequencies in mviN in DMEM (red, input) vs DMEM plus Kanamycin (Kan) (green, output) medium. The height of each bar represents the insertion frequencies. (b) Relative growth of WT::PesrB-kan vs ΔmviN::PesrB-kan cultured in DMEM medium with gradient concentrations of Kan. Three repeated experiments of each assay were performed, and the representative figure is shown. (c) Amino acid sequence alignment of MviN (MurJ) in E. coli (Ec), S. enterica (Se), and E. piscicida (Ep). (d) Lipid II (peptidoglycan precursor) is translocated across IM by MviN. (e) Locations of MviN (MurJ) encoding genes on the genomes of E. coli, S. enterica, and E. piscicida.
phenocopying ΔesrB. Subsequently, the extracellular proteins (ECPs) profiles of each strain grown in DMEM for 12 h were detected by SDSPAGE (Fig. 3b). According to the results, the deletion of mviN slightly increased the productions of T3/T6SS (EseB/C/D), while the over-expression of mviN significantly decreased those proteins’ yield. Noticeably, the empty complementary plasmid did not affect the ECPs profile (Fig. 3b) (Yin et al., 2018). Finally, the qRT-PCR analysis was used to detect whether MviN influences the transcription of esrB and its regulon genes (Fig. 3c). When grown in DMEM, the mviNOE cells showed significantly decreased transcription of EsrB-activated genes (esrB, eseB and evpA), while up-regulation of the EsrB-repressed genes. These data collaborated the results of RFU analysis of the mviN mutant at late growth stages (Fig. 2a). These data also demonstrated that MviN played different roles in the regulation of T3/T6SS productions during the earlier and later growth stages (Fig. 2a).
reporters did not influence the growth of all the strains (data not shown). The results showed that the addition of sucrose in DMEM could significantly increase the esrB promoter activity in ΔmviN::PesrB-luxAB, while there was little effect to that of WT::PesrB-luxAB and mviN+::PesrBluxAB (Fig. 2d). These data illustrated that MviN was critical for the osmotic pressure resistance in E. piscicida, and further confirmed that MviN could be both activator and repressor of esrB expression. We speculate that MviN plays crucial roles in mediating the regulation of osmotic pressure on esrB transcription.
3.3. MviN represses the expression of T3/T6SS In E. piscicida, EsrB is essential for the expression and production of T3/T6SS proteins (Yin et al., 2018). We hypothesized that MviN could also regulate the expression of T3/T6SS. To validate this hypothesis, the auto-aggregation assay, which depended on the level of T3SS protein EseB (Gao et al., 2015), was first evaluate the effects of mviN deletion (ΔmviN) and over-expression (mviNOE) on the expression of T3SS in cells grown in DMEM for 24 h (Fig. 3a). Interestingly, ΔmviN sank to the bottom of the tube, while the mviNOE cells suspended in the medium,
3.4. MviN influences the in vivo colonization of E. piscicida As an intracellular pathogen, E. piscicida uses EsrB and T3/T6SS to infect the host and survive in vivo (Liu et al., 2017; Zhang et al., 2018). 4
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Fig. 2. MviN is involved in osmotic pressure tolerance in E. piscicida. (a) Relative fluorescence units (RFUs) of the WT, ΔmviN and mviN+ strains statically cultured in DMEM medium were determined at the indicated time points. (b-c) Growth curves of the WT, ΔmviN and mviN+ strains statically in DMEM (b), and DMEM with addition of sucrose (DMEM + Suc) (c). (d) RFUs of WT, ΔmviN and mviN+ strains statically cultured in indicated media were determined at 3 h. The results are shown as the mean ± SEM (n = 3). ***, P < 0.0001; **, P < 0.001; NS, no significance, P > 0.05.
level than that of WT (Fig. 4). However, ΔmviN also showed slight colonization defect compared with WT (Fig. 4). Then, a ΔmviN::Plac-esrB strain, which could constitutively express esrB, was constructed, and the CI assay showed slight colonization defect in this strain compared with that of WT (Fig. 4). These data suggested that MviN might modulate the in vivo colonization of E. piscicida not only through the regulation of EsrB, but also other unknown mechanisms.
We next hypothesized that MviN could influence the in vivo colonization of E. piscicida. The competition index (CI) assay was employed to evaluate the effects of MviN to E. piscicida in vivo colonization. At 8 dpi, the infection stage when E. piscicida mainly existed in turbot livers (Yin et al., 2018), the liver samples were collected in each group and then were enumerated to determine the colonized bacterial numbers. As expected, ΔesrB showed significant growth defect in fish (Fig. 4) (Yin et al., 2018), and the number of mviNOE also showed significant lower
Fig. 3. MviN represses the expression of EsrB and T3/T6SS. (a) Autoaggregation of WT, ΔesrB, ΔmviN, mviNOE (mviN over-expression), ΔmviN/pUTat(ΔmviN with pUTat empty plasmid), and mviN+ statically cultured in DMEM, at 28 °C for 24 h. (b) SDS-PAGE gels were used to separate the extracellular protein profiles of indicated strains (b, up), and the bands corresponding to T3/T6SS proteins (Lv et al., 2012) are marked. The loading control of each strain was the housekeeping DnaK in the whole cellular proteins (WCP) (b, bottom). (c) qRT-PCR analysis of the indicated genes in WT vs. mviNOE. The results were presented as the mean ± SEM (n = 3). The internal control was the gyrB gene. Three repeated experiments of each assay were performed, and the representative figure is shown.
5
Microbiological Research 239 (2020) 126528
K. Yin, et al.
membrane and protecting the bacterium from the osmotic pressure. The reason why the mviN could be deleted in E. piscicida might be that the cell wall of this bacterium was much thicker than that of E. coli (data not shown), which compensated the influence of mviN absence in E. piscicida. MviN was also reported as a virulence factor in many pathogens, i.e. Salmonella species, Arcobacter species and so on (Rubinelli et al., 2015; Sekhar et al., 2017). The low level of mviN significantly attenuated Salmonella Typhimurium, and the mviN knock-down strain was developed as a novel attenuated vaccine of this bacterium (Rubinelli et al., 2015). However, the regulatory mechanism of MviN on virulence was yet unclear. In this study, the MviN was identified as a repressor of esrB and T3/T6SS (Figs. 2a, d and 3), which also behaved as an activator at early growth stage (Fig. 1a and 2a). We also found that MviN might mediate the regulation of environmental osmotic pressure on the expression of esrB (Fig. 2d). Additionally, MviN was critical to the in vivo colonization of E. piscicida, especially at the early and middle infection stages (Fig. 4) (Yang et al., 2017). We hypothesized that when encountering severe environments, such as high osmotic pressure or cell wall biosynthesis defect, the bacteria might turn off the expression of virulence genes and express the resistance-related genes to meet the requirements of nutrients. In this process, MviN might act as a harmonizer to maintain the balance between virulence and survive. Moreover, we hypothesized that MviN dysfunction or disruption might affect the membrane homeostasis to indirectly modulate the EsrA-EsrB phosphorylation signally cascades in E. piscicida. Further investigations shall be warranted to illuminate the mechanisms underlying MviN modulating osmotic pressure on the virulence expression in E. piscicida. In conclusion, MviN was identified as a regulator of EsrB and T3/ T6SS expression and modulate the in vivo colonization in E. piscicida. This study contributes to the finding of new functional aspects of MviN in virulence regulation, which will expend the understanding of the pathogenesis of bacterial pathogens.
Fig. 4. MviN influences in vivo colonization of E. piscicida in turbot. In vivo competition assays for the ΔesrB, ΔmviN, mviNOE and ΔesrB::Plac-esrB strains vs. WT or WT ΔP (WT with pEIB202 cured), which are resistant or sensitive to Cm, respectively. The indicated strains were mixed at 1:1 ratio, and then the mixtures were i.p. injected into turbots, respectively. At 8 day-post infection (dpi), the turbot livers of each group were taken, and the CFUs of indicated strains were enumerated. The comparisons of the CI values for the corresponding WT/ WT ΔP or WT/WT-pUTat samples were based on ANOVA followed by Bonferroni’s multiple-comparison post-test, and *, P < 0.01; **, P < 0.001; ***, P < 0.0001.
4. Discussion EsrB is a horizontally acquired important global regulator and regulates diverse pathways, such as the T3/T6SS, hemolysins, environmental stresses resistance, iron uptake, amino acid biosynthesis and so on in fish pathogen E. piscicida (Chakraborty et al., 2011; Guan et al., 2018; Liu et al., 2017; Lv et al., 2012; Yin et al., 2017). However, few proteins except PhoP, EvrA, RpoS, and PepA were identified as the regulators of esrB (Lv et al., 2012; Wei et al., 2019b; Yin et al., 2018, 2020). Therefore, further investigation on the regulatory network of esrB is necessary to understand the pathogenesis of this bacterium in respective to the sensing of signals and cues from the host and environments. In the previous TIS analysis, 39 putative esrB regulators, including RpoS, were identified (Yin et al., 2018). This study further validated the TIS results, and MviN was identified as another novel regulator of esrB expression (Fig. 1 a,b). Interestingly, we also revealed that MviN might modulate the esrB and T3/T6SS virulence gene expression through its roles in osmotic stress tolerance. MviN, which also named MurJ, has been identified as a lipid II flippase (Ruiz et al., 2016). It is an integral 14-transmembrane-domain membrane protein, which is required for peptidoglycan biosynthesis. It also widely distributed in the Gram-negative bacteria, such as E. coli, Burkholderia cenocepacia and E. piscicida (Fig. 1c-e) (Inoue et al., 2008; Mohamed and Valvano, 2014; Wang et al., 2009). In many bacteria, the deletion of MviN reduces their resistance to osmotic pressures, which leads to cell lysis (Ruiz, 2008). Thus, mviN was often regarded as an essential gene. Although the mviN gene was successfully deleted in E. piscicida, the ΔmviN also showed significant growth defect when cultured in DMEM (Fig. 2b). As expected, the growth defect of ΔmviN could be rescued by the addition of sucrose (Fig. 2c), which usually acts as an osmotic stabilizer to prevent cell lysis (Joseleau-Petit. et al., 2007). Moreover, ΔmviN had a more complicated ECP profile than that of WT, which might be caused by the cell lysis (Fig. 3b). These suggested that MviN was also critical for the stability of E. piscicida cell
Ethics statement All animal protocols used in this study were approved by the Animal Care Committee of the East China University of Science and Technology (2006272). The Experimental Animal Care and Use Guidelines from Ministry of Science and Technology of China (MOST-2011-02) were strictly followed. CRediT authorship contribution statement Kaiyu Yin: Investigation, Formal analysis, Writing - original draft, Funding acquisition. Jin Zhang: Investigation, Writing - original draft. Jiabao Ma: Formal analysis, Data curation. Peng Jin: Validation. Yue Ma: Formal analysis. Yuanxing Zhang: Supervision. Xiaohong Liu: Resources, Writing - review & editing. Qiyao Wang: Conceptualization, Methodology, Writing - review & editing, Funding acquisition, Project administration. Acknowledgments This work was sponsored by China Postdoctoral Science Foundation (2019M651420) and Shanghai Sailing Program (19YF1411500), as well as the National Key Research and Development Program of China (2018YFD0900500), the Ministry of Agriculture of China (CARS-47), and the Science and Technology Commission of Shandong and Shanghai Municipality (2017CXGC0103 and 17391902000). References Cao, X.D., Wang, Q.Y., Liu, Q., Liu, H., He, H.H., Zhang, Y.X., 2010. Vibrio alginolyticus MviN is a LuxO-regulated protein and affects cytotoxicity towards epithelioma papulosum cyprini (EPC) cells. J. Microbiol. Biotechnol. 20, 271–280.
6
Microbiological Research 239 (2020) 126528
K. Yin, et al.
flippase in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 105, 15553–15557. Ruiz, N., 2016. Lipid flippases for bacterial peptidoglycan biosynthesis. Lipid Insights 8, 21–32. Sekhar, M.S., Tumati, S.R., Chinnam, B.K., Kothapalli, V.S., Sharif, N.M., 2017. Virulence gene profiles of Arcobacter species isolated from animals, foods of animal origin, and humans in Andhra Pradesh, India. Vet. World 10, 716–720. Ulland, T.K., Buchan, B.W., Ketterer, M.R., Fernandes-Alnemri, T., Meyerholz, D.K., Apicella, M.A., Alnemri, E.S., Jones, B.D., Nauseef, W.M., Sutterwala, F.S., 2010. Cutting edge: mutation of Francisella tularensis mviN leads to increased macrophage absent in melanoma 2 inflammasome activation and a loss of virulence. J. Immunol. 2010, 2670–2674. Wang, Q.Y., Yang, M.J., Xiao, J.F., Wu, H.Z., Wang, X., Lv, Y.Z., Xu, L.L., Zheng, H.J., Wang, S.Y., Zhao, G.P., Liu, Q., Zhang, Y.X., 2009. Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One 4, e7646. Wei, L.F., Wu, Y.Y., Yang, G.H., Xu, R.J., Liu, X.H., Liu, Q., Zhang, Y.X., Ma, Y., Wang, Q.Y., 2019a. Genome-wide identification of fitness factors in seawater for Edwardsiella piscicida. Appl. Environ. Microbiol. 85, e00233–19. Wei, L.F., Qiao, H.X., Sit, B., Yin, K.Y., Yang, G.H., Ma, R.Q., Ma, J.B., Yang, C., Yao, J., Ma, Y., Xiao, J.F., Liu, X.H., Zhang, Y.X., Waldor, M.K., Wang, Q.Y., 2019b. A bacterial pathogen senses host mannose to coordinate virulence. iScience. 20, 310–323. Xiao, J.F., Wang, Q.Y., Liu, Q., Wang, X., Liu, H., Zhang, Y.X., 2008. Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China. Aquac. Res. 40, 13–17. Xie, H.X., Yu, H.B., Zheng, J., Nie, P., Foster, L.J., Mok, Y.K., Finlay, B.B., Leung, K.Y., 2010. EseG, an effector of the type III secretion system of Edwardsiella tarda, triggers microtubule destabilization. Infect. Immun. 78, 5011–5021. Xie, H.X., Lu, J.F., Zhou, Y., Yi, J., Yu, X.J., Leung, K.Y., Nie, P., 2015. Identification and functional characterization of the novel Edwardsiella tarda effector EseJ. Infect. Immun. 83, 1650–1660. Xu, T., Zhang, X.H., 2014. Edwardsiella tarda: an intriguing problem in aquaculture. Aquaculture 431, 129–135. Yang, G.H., Billings, G., Hubbard, T.P., Park, J.S., Leung, K.Y., Liu, Q., Davis, B.M., Zhang, Y.X., Wang, Q.Y., Waldor, M.K., 2017. Time-resolved transposon insertion sequencing reveals genome-wide fitness dynamics during infection. mBio. 8, e01581–17. Yin, K.Y., Wang, Q.Y., Xiao, J.F., Zhang, Y.X., 2017. Comparative proteomic analysis unravels a role for EsrB in the regulation of reactive oxygen species stress responses in Edwardsiella piscicida. FEMS Microbiol. Lett. 364 fnw269. Yin, K.Y., Guan, Y.P., Ma, R.Q., Wei, L.F., Liu, B., Liu, X.H., Zhou, X.S., Ma, Y., Zhang, Y.X., Waldor, M.K., Wang, Q.Y., 2018. Critical role for a promoter discriminator in RpoS control of virulence in Edwardsiella piscicida. PLoS Pathog. 14, e1007272. Yin, K.Y., Peng, Y., Ahmed, M.A.H., Ma, J.B., Xu, R.J., Zhang, Y.X., Ma, Y., Wang, Q.Y., 2020. PepA binds to and negatively regulates esrB to control virulence in the fish pathogen Edwardsiella piscicida. Microbiol. Res. 232, 126349. Zhang, L.Z., Jiang, Z.W., Fang, S., Huang, Y.J., Yang, D.H., Wang, Q.Y., Zhang, Y.X., Liu, Q., 2018. Systematic identification of intracellular-translocated candidate effectors in Edwardsiella piscicida. Front. Cell. Infect. Microbiol. 16, 8–37.
Chakraborty, S., Sivaraman, J., Leung, K.Y., Mok, Y.K., 2011. Two-component PhoB-PhoR regulatory system and ferric uptake regulator sense phosphate and iron to control virulence genes in type III and VI secretion systems of Edwardsiella tarda. J. Biol. Chem. 286, 39417–39430. Chen, H., Yang, D., Han, F., Tan, J., Zhang, L., Xiao, J., Zhang, Y., Liu, Q., 2017. The bacterial T6SS effector EvpP prevents NLRP3 inflammasome activation by inhibiting the Ca2+-dependent MAPK-Jnk pathway. Cell Host Microbe 21, 47–58. Esteve, C., Alcaide, E., 2018. Seasonal recovery of Edwardsiella piscicida from wild European eels and natural waters: isolation methods, virulence and reservoirs. J. Fish Dis. 41, 1613–1623. Gao, Z.P., Nie, P., Lu, J.F., Liu, L.Y., Xiao, T.Y., Liu, W., Liu, J.S., Xie, H.X., 2015. Type III secretion system translocon component EseB forms filaments on and mediates autoaggregation of and biofilm formation by Edwardsiella tarda. Appl. Environ. Microbiol. 81, 6078–6087. Griffin, M.J., Greenway, T.E., W.D, 2017. Edwardsiella spp. In: Woo, P.T.K., Cipriano, R.C. (Eds.), Fish Viruses and Bacteria: Pathobiology and Protection. CABI, Boston, pp. 281–304. Guan, Y.P., Yin, K.Y., Zhou, M., Yang, M.J., Zhang, Y.X., Liu, X.H., Wang, Q.Y., 2018. EsrB negatively regulates expression of the glutamine sythetase GlnA in the fish pathogen Edwardsiella piscicida. FEMS Microbiol. Lett. 365 fny007. Inoue, A., Murata, Y., Takahashi, H., Tsuji, N., Fujisaki, S., Kato, J., 2008. Involvement of an essential gene, mviN, in murein synthesis in Escherichia coli. J. Bacteriol. 190, 7298–7301. Joseleau-Petit, D., Liebart, J.C., Ayala, J.A., D’Ari, R., 2007. Unstable Escherichia coli L forms revisited: growth requires peptidoglycan synthesis. J. Bacteriol. 189, 6512–6520. Leung, K.Y., Wang, Q.Y., Yang, Z.Y., Siame, B.A., 2019. Edwardsiella piscicida: a versatile emerging pathogen of fish. Virulence 10, 555–567. Liu, Y., Zhao, L.Y., Yang, M.J., Yin, K.Y., Zhou, X.H., Leung, K.Y., Liu, Q., Zhang, Y.X., Wang, Q.Y., 2017. Transcriptomic dissection of the horizontally acquired response regulator EsrB reveals its global regulatory roles in the physiological adaptation and activation of T3SS and the cognate effector repertoire in Edwardsiella piscicida during infection toward turbot. Virulence 8, 1355–1377. Lv, Y.Z., Xiao, J.F., Liu, Q., Wu, H.Z., Zhang, Y.X., Wang, Q.Y., 2012. Systematic mutation analysis of two-component signal transduction systems reveals EsrA-EsrB and PhoPPhoQ as the major virulence regulators in Edwardsiella tarda. Vet. Microbiol. 157, 190–199. Mo, Z.L., Xiao, P., Mao, Y.X., Zou, Y.X., Wang, B., Li, J., Xu, Y.L., Zhang, P.J., 2007. Construction and characterization of a live, attenuated esrB mutant of Edwardsiella tarda and its potential as a vaccine against the haemorrhagic septicaemia in turbot, Scophthamus maximus (L.). Fish Shellfish Immunol. 23, 521–530. Mohamed, Y.F., Valvano, M.A.A., 2014. Burkholderia cenocepacia MurJ (MviN) homolog is essential for cell wall peptidoglycan synthesis and bacterial viability. Glycobiology 24, 564–576. Rubinelli, P.M., Lee, S.I., Roto, S.M., Park, S.H., Ricke, S.C., 2015. Regulated expression of virulence gene mviN provides protective immunity and colonization control of Salmonella in poultry. Vaccine 33, 5365–5370. Ruiz, N., 2008. Bioinformatics identification of MurJ (MviN) as the peptidoglycan lipid II
7
Contents lists available at ScienceDirect
Microbiological Research journal homepage: www.elsevier.com/locate/micres
MviN mediates the regulation of environmental osmotic pressure on esrB to control the virulence in the marine fish pathogen Edwardsiella piscicida
T
Kaiyu Yina, Jin Zhanga, Jiabao Maa, Peng Jina, Yue Maa,b,c, Yuanxing Zhanga,b,c, Xiaohong Liua,b,c,*, Qiyao Wanga,b,c,* a
State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai 200237, China c Shanghai Engineering Research Center of Maricultured Animal Vaccines, Shanghai 200237, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Edwardsiella piscicida EsrB Lipid II flippase Osmotic pressure In vivo colonization
Edwardsiella piscicida is a notorious pathogen infecting diverse kinds of fish and causes substantial economic losses in the global aquaculture industries. The EsrA-EsrB two-component system plays a critical role in the regulation of virulence genes expression, including type III and type VI secretion systems (T3/T6SSs). In this study, the putative regulators of esrB were screened by the transposon insertion sequencing (TIS) technology. As a result, MviN, a lipid II flippase, was identified as a modulator to upregulate esrB and downstream T3/T6SS gene expression in the earlier growth phases while downregulate esrB at the later stages. Complement or overexpression of the mviN restored the esrB as well as T3/T6SS expression in the ΔmviN mutant strain. Moreover, MviN also mediated the regulation of environmental osmotic pressure on the expression of esrB. MviN was also found to significantly influence the in vivo colonization of E. piscicida in turbot. Collectively, this study enhanced our understanding of pathogenesis and virulence regulatory network of E. piscicida.
1. Introduction
we previously reported, RpoS could sense the multiple environmental signals and repress the expression of EsrB and T3/T6SS (Yin et al., 2018). Therefore, it’s important to further investigate the regulatory mechanism of EsrB to improve our understanding of the pathogenesis of E. piscicida and facilitate the invention of effective control and prevention strategies against this bacterium. MviN (MurJ), which has multiple predicted transmembrane helices, is a kind of integral membrane protein (Mohamed and Valvano, 2014). MviN is highly conserved in bacteria, such as Salmonella species, Burkholderia cenocepacia and E. piscicida (Rubinelli et al., 2015; Mohamed and Valvano, 2014; Wang et al., 2009). In the previous works, MviN has been identified as a kind of lipid II flippase, which is critical for the peptidoglycan (PG) biosynthesis (Ruiz, 2008). Also, MviN was reported to participate in the regulation of tolerance to environmental osmotic stresses (Joseleau-Petit. et al., 2007; Ruiz, 2008). Although several reports have demonstrated that MviN participates in the regulation of virulence and in vivo colonization of Vibrio alginolyticus and Francisella tularensis (Cao et al., 2010; Ulland et al., 2010), its functions in bacterial pathogenesis remain unclear. In this study, MviN was identified as an inhibitor of esrB. We found that MviN sensed the environmental osmotic pressure to control the expression of EsrB and T3/T6SSs, and then affected the in vivo
Edwardsiella piscicida (formerly called E. tarda) is an important Gram-negative and facultative aerobic marine pathogen. It causes haemorrhagic septicaemia, and leads to enormous economic loss in the fish aquaculture industry (Griffin et al., 2017; Leung et al., 2019). E. piscicida expresses type III and type VI secretion systems (T3/T6SSs), the critical virulence factors of this pathogen, to translocate more than 20 kinds of effectors into host cells to interrupt the host immune systems (Chen et al., 2017; Liu et al., 2017; Xie et al., 2010, 2015). EsrAEsrB two-component system strictly controls the expression of T3/ T6SSs (Lv et al., 2012). Besides, the response regulator (RR) EsrB plays essential roles in the regulation of diverse kinds of metabolic pathways, such as carbon sources utilization, amino acid biosynthesis, stress resistance, and so on (Liu et al., 2017; Guan et al., 2018; Yin et al., 2017). Because of the critical roles EsrB in virulence regulation in E. piscicida, it’s also a potential target for live-attenuated vaccine development (Mo et al., 2007). E. piscicida is an intracellular bacterium and invades many kinds of cell types in fish (Leung et al., 2019). It has been determined that the edwardsiellosis outbreak is closely related to environmental changes (Esteve and Alcaide, 2018; Xu and Zhang, 2014; Wei et al., 2019a). As ⁎
Corresponding authors at: State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China. E-mail addresses: [email protected] (X. Liu), [email protected] (Q. Wang).
https://doi.org/10.1016/j.micres.2020.126528 Received 22 April 2020; Received in revised form 31 May 2020; Accepted 13 June 2020 Available online 27 June 2020 0944-5013/ © 2020 Elsevier GmbH. All rights reserved.
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Table 1 Strains and plasmids used in this study. Strains or plasmids Edwardsiella piscicida EIB202 WT WT ΔP ΔesrB ΔmviN WT-pUTat mviN+ mviNOE ΔmviN/pUTat WT::PesrB-luxAB ΔmviN::PesrB-luxAB mviN+::PesrB-luxAB WT::Plac-esrB ΔmviN::Plac-esrB Escherichia coli DH5α λpir SM10 λpir BL21(DE3) Plasmids pDMK pDMK-mviN pUTat pUTat-PrpsU pUTat-mviN
Description
References
Wild-type strain, CCTCC M208068, Colr, Strr EIB202, pEIB202 cured, Colr EIB202, in-frame deletion of esrB, Colr, Strr EIB202, in-frame deletion of mviN, Colr, Strr EIB202, containing pUTat-PrpsU, Colr, Strr, Carbr ΔmviN, containing pUTat-mviN, Colr, Strr, Carbr EIB202, containing pUTat-mviN, Colr, Strr, Carbr ΔmviN, containing pUTat, Colr, Strr, Carbr EIB202, insertion disrupt of PesrB-luxAB in a neutral position, Colr, Strr, WT::PesrB-luxAB, in-frame deletion of mviN, Colr, Strr ΔmviN::PesrB-luxAB, containing pUTat-mviN, Colr, Strr, Carbr WT, replacing PesrB with Plac from pAKgfp1, Colr, Strr, WT::Plac-esrB, in-frame deletion of mviN, Colr, Strr
Xiao et al., 2008 Liu et al., 2017 Lv et al., 2012 This study Yin et al., 2017 This study This study This study Yin et al., 2018 This study This study Yin et al., 2018 This study
Host for π requiring plasmids Host for π requiring plasmids, conjugal donor Host strain for protein expression
Yin et al., 2018 Yin et al., 2018 Liu et al., 2017
Suicide vector, pir dependent, R6K, SacBR, Kanr,Cmr pDMK with ETAE_1425 fragment deleted 4–1535 nucleotides Medium copy number cloning vector, pAT153 replicon, Carbr pUTat derivative containing the promoter of rpsU, Carbr pUTat-PrpsU derivative containing mviN orf, Carbr
Yin et al., 2018 This study Yin et al., 2018 Yin et al., 2018 This study
For the auto-aggregation assay, the WT, ΔesrB, ΔmviN and mviNOE cultured in glass tubes were photographed by a camera after 24 h of incubation. For ECPs analysis, 100 ml DMEM culture supernatants of indicated strains with protease addition went through a kind of 0.22 μm Millex filter (Millipore) and were then concentrated to 250 μl with a 10kDa-cutoff centrifugal filter device (Millipore). As we previously reported, the ECPs of indicated strains were detected with SDS-PAGE assays (Yin et al., 2018). For Western blot analysis, the cell pellets of indicated strains were resuspended in low-salt buffers to normalize the cell densities depend on OD600 (Yin et al., 2020). The migration of samples form SDS-PAGE to PVDF membranes (Millipore) was performed as described previously (Yin et al., 2020). Additionally, DnaK was used as a loading control in the western blot analysis.
colonization of E. piscicida. This study advanced our understanding of the pathogenesis and virulence regulatory mechanism of E. piscicida. 2. Materials and methods 2.1. Bacterial strains construction and culture conditions Table 1 is the list of the plasmids and strains used in this study. The mviN in-frame deletion mutant (ΔmviN), mviN complementary and over-expression strains (mviN+ and mviNOE) were constructed as described previously (Yin et al., 2020). The strains for minimal inhibitory concentration assays and fluorescence value detection (ΔmviN::PesrBkanr, ΔmviN::PesrB-luxAB and mviN+::PesrB-luxAB) were constructed based on the WT::PesrB-kanr or WT::PesrB-luxAB, which contained the reporter fusions (PesrB-kanr or PesrB-luxAB) at the end of glmS gene on the genome (Yin et al., 2018). The construction of ΔmviN::Plac-esrB was based on the WT::Plac-esrB, which replaced the original esrB promoter with lac promoter (Yin et al., 2018). All the primers were listed in Table 2. The Luria-Bertani (LB) broth (Becton Dickinson, Sparks, MD, USA), Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Grand Island, NY, USA) or LB agar were used to culture the strains. The cultural temperature was 28 °C (E. piscicida) or 37 °C (Escherichia coli). In this study, the final concentration of the antibiotics used as follow: colistin, 16.7 μg ml-1; chloramphenicol, 25 μg ml-1; and carbenicillin, 100 μg ml-1.
2.4. Quantitative real-time PCR (qRT-PCR) The WT and mviNOE strains were cultured overnight, and then subinoculated into DMEM and cultured at 28 °C for 14 h, respectively. The RNA isolation kit (Tiangen, Beijing, China) was used to extract the RNA samples from each culture. Nanodrop was used to measure the concentrations of RNA samples, and the reverse transcription was conducted with PrimeScript II 1 st Strand cDNA Synthesis Kit (TaKaRa). The qRT-PCR assays were performed as we described previously (Yin et al., 2020). The quantification of the relative qualities for each transcript was performed following the comparative CT (2−ΔΔCT) method, and the internal control was the housekeeping gyrB gene.
2.2. Minimum inhibitory concentration assay 2.5. Relative fluorescence units (RFUs) measurement The MIC assay was performed as previously described (Yin et al., 2018). The WT::PesrB-kanr and ΔmviN::PesrB-kanr strains were statically cultured in DMEM, which contains a series of concentrations of kanamycin (Kan), at 28 °C for 24 h, respectively. The cell numbers were calculated by measuring the optical densities at 600 nm (OD600) (Biotek, Winooski, VT, USA).
The indicated strains were cultured in DMEM at 28 °C. 200 μl of each sample were taken out at indicated time points, and the measurement of the fluorescence units was performed as described previously (Yin et al., 2020). The calculation method of relative fluorescence units (RFUs) of each sample was as follows: RFU = (AFU-BFU)/ OD600, in which AFU means the actual fluorescence unit. At the same time, BFU represents the background fluorescence unit.
2.3. Auto-aggregation, extracellular proteins (ECPs) analysis and Western blot
2.6. Growth curve measurement Overnight cultured E. piscicida strains were sub-inoculated into DMEM at a 1:100 dilution and statically cultured at 28 °C, respectively.
107 CFU overnight cultures of WT, ΔmviN and mviN+ were sub2
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Table 2 Primers used in this study. Name
Sequence (5′ - 3′)
Mutants construction mviN-P1 CCCCCCCGAGCTCAGGTTACCCGGATCTATTTTTGCCGATGTGACTGAGG mviN-P2 CCCGACGTCGGTTCATCGTCAGGGTT mviN-P3 ATGAACCGACGTCGGGGCAGCGGCT mviN-P4 GAGTACGCGTCACTAGTGGGGCCCTTCTAGTGCGGATCTCTCCAAAAACC mviN-outF CTTCATAGCCGCACTTTCGG mviN-outR TGACGGCCCGTACGCTGA Complementary and overexpression strains construction mviN-OE-PF TGAGAGGCACGAGCTCGATTATGAATCTACTTAAATCACT mviN-OE-PR CTGCAGGTCGACGGATCCCCTTATAGCACCGCGCTGCGGG qRT-PCR esrB-F GGGCTTTGCTTCAGGACGTA esrB-R GCCCGATCTGGTCTTACTCG eseB-F CCCCTTTATCCAGCCCCTTG eseB-R GCCAAGTTCAAGAAAGCGGG evpA-F ATCTGTCATTCCGCACCGAG evpA-R TTTTCAGGTCAGAGAGGCGG ethA-F TTCTGGGACAATACGCCGAC ethA-R TCCCGGTTAAATAGACGCCG ethB-F CGATACGCAAAACGAGCAGG ethB-R TATCGCGGTTATTGGCCTCC mviN-F CTGGCTGCGGTCAGCTCAA mviN-R GTCGCGCAGGCGGAAT gyrB-F CCGATGATGGTACGGGTCTG gyrB-R GCTTTTCAGACAGGGCGTTC
such as Salmonella enterica, Escherichia coli, E. piscicida, and so on (Fig. 1c). As a kind of lipid II flippase, the primary function of MviN is responsible for the translocation of peptidoglycan precursors (lipid II) across the cytoplasmic membrane to periplasmic space (Fig. 1d). However, there were few reports on the regulatory function of MviN. Interestingly, the encoding gene of MviN (mviN or murJ) is locating nearby the flg cluster for flagellar biosynthesis either in E. coli or S. enterica, while the one in E. piscicida is closing to argS gene (ArgininetRNA ligase) (Fig. 1e). This result illustrates that MviN might have specific functions in E. piscicida.
inoculated into indicated media. The cell densities were measured with Synergy 2 microplate reader at OD600. 2.7. Competition index (CI) assay Sub-cultured strains were diluted, and then mixed at equally CFU. The injection dose of each group was 105 CFU/tail. At indicated time points, the livers from turbot (Scophthalmus Maximus) in each group (3 tails/group) were taken out, ground and swapped on DHL agar plates containing or not containing Cm. Colonies numbers on each plate were counted, and ratios of the bacterial determined the CIs.
3.2. MviN mediates the regulation of osmotic pressure on esrB transcription 2.8. Statistical analysis According to the TIS analysis, MviN behaved as an activator of esrB. To validate this, the strains carrying the PesrB-luxAB reporter, which indicating the activities of esrB promoter, at the neutral site, i.e. WT::PesrB-luxAB, ΔmviN::PesrB-luxAB and mviN+::PesrB-luxAB (Table 1), were constructed and then statically cultured in DMEM at 28 °C, respectively. The normalized RFUs respective to cell densities (OD600) were measured every 3 h (Fig. 2a). At early exponential growth phase (∼ 3 h), RFUs of WT::PesrB-luxAB and mviN+::PesrB-luxAB were markedly higher than that of ΔmviN::PesrB-luxAB. However, the RFUs of ΔmviN::PesrB-luxAB were significantly higher than that of WT::PesrBluxAB and mviN+::PesrB-luxAB at late growth phase. These mean that MviN exerts different functions respective to the regulation on esrB expression at early and late growth phase. As an essential protein in the process of cell wall biosynthesis, MviN is critical for the osmotic pressure response (Ruiz, 2008). We thus suspect that the environmental osmotic pressure might mediate MviN regulation of esrB expression. To validate this, we first detected the growth of WT, ΔmviN and mviN+ grown in DMEM, a medium that enables T3/T6SS production. After cultured in DMEM media for 12 h, ΔmviN showed slightly but significant growth defect compared with that of WT and mviN+ (Fig. 2b). However, when we added a moderate amount of sucrose (Suc), which was used as a kind of osmotic stabilizer in the medium to prevent cell lysis (Joseleau-Petit. et al., 2007), into DMEM media, the growth defects of ΔmviN disappeared (Fig. 2c). We then measured the RFUs of WT::PesrB-luxAB, ΔmviN::PesrB-luxAB and mviN+::PesrB-luxAB under indicated conditions at 3 h. Notably, the
Data analysis was conducted with the help of GraphPad Prism (version 6; GraphPad Software, Inc., La Jolla, CA, USA). A two-tailed Student’s unpaired t-test was used to compare the differences between the indicated groups. P < 0.01 was considered significant difference. GeneDoc (version 2.7) was used to align the amino acid sequences. 3. Results 3.1. MviN regulates the transcription of esrB The transposon insertion sequencing (TIS) technology was employed to investigate the regulatory mechanism of esrB (Yin et al., 2018). Analysis of the TIS data indicated that a protein named MviN might be a novel activator of esrB, as the insertion frequency of its encoding gene (mviN, ETAE_1425) showed a significant decrease (Fold Change = 7.4, P < 0.05) in the output group (Fig. 1a). To validate the result, we constructed the deletion mutant of mviN (ΔmviN::PesrB-kanr) based on the WT::PesrB-kanr (the background strain of the transposon insertion library). These two strains were then cultured in DMEM media with gradient concentrations of kanamycin (Kan), and the bacteria densities were measured. As expected, the ΔmviN::PesrB-kanr showed significant growth defect at higher Kan concentration (> 300 μg/ml), respective to that of the WT::PesrB-kanr (Fig. 1b). These results suggested that MviN might activate the transcription of esrB. MviN is conserved and widely exists in Gram-negative bacteria, 3
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Fig. 1. MviN participates in the regulation of esrB according to the transposon insertion sequencing (TIS) screen. (a) Artemis plots of the transposon insertion frequencies in mviN in DMEM (red, input) vs DMEM plus Kanamycin (Kan) (green, output) medium. The height of each bar represents the insertion frequencies. (b) Relative growth of WT::PesrB-kan vs ΔmviN::PesrB-kan cultured in DMEM medium with gradient concentrations of Kan. Three repeated experiments of each assay were performed, and the representative figure is shown. (c) Amino acid sequence alignment of MviN (MurJ) in E. coli (Ec), S. enterica (Se), and E. piscicida (Ep). (d) Lipid II (peptidoglycan precursor) is translocated across IM by MviN. (e) Locations of MviN (MurJ) encoding genes on the genomes of E. coli, S. enterica, and E. piscicida.
phenocopying ΔesrB. Subsequently, the extracellular proteins (ECPs) profiles of each strain grown in DMEM for 12 h were detected by SDSPAGE (Fig. 3b). According to the results, the deletion of mviN slightly increased the productions of T3/T6SS (EseB/C/D), while the over-expression of mviN significantly decreased those proteins’ yield. Noticeably, the empty complementary plasmid did not affect the ECPs profile (Fig. 3b) (Yin et al., 2018). Finally, the qRT-PCR analysis was used to detect whether MviN influences the transcription of esrB and its regulon genes (Fig. 3c). When grown in DMEM, the mviNOE cells showed significantly decreased transcription of EsrB-activated genes (esrB, eseB and evpA), while up-regulation of the EsrB-repressed genes. These data collaborated the results of RFU analysis of the mviN mutant at late growth stages (Fig. 2a). These data also demonstrated that MviN played different roles in the regulation of T3/T6SS productions during the earlier and later growth stages (Fig. 2a).
reporters did not influence the growth of all the strains (data not shown). The results showed that the addition of sucrose in DMEM could significantly increase the esrB promoter activity in ΔmviN::PesrB-luxAB, while there was little effect to that of WT::PesrB-luxAB and mviN+::PesrBluxAB (Fig. 2d). These data illustrated that MviN was critical for the osmotic pressure resistance in E. piscicida, and further confirmed that MviN could be both activator and repressor of esrB expression. We speculate that MviN plays crucial roles in mediating the regulation of osmotic pressure on esrB transcription.
3.3. MviN represses the expression of T3/T6SS In E. piscicida, EsrB is essential for the expression and production of T3/T6SS proteins (Yin et al., 2018). We hypothesized that MviN could also regulate the expression of T3/T6SS. To validate this hypothesis, the auto-aggregation assay, which depended on the level of T3SS protein EseB (Gao et al., 2015), was first evaluate the effects of mviN deletion (ΔmviN) and over-expression (mviNOE) on the expression of T3SS in cells grown in DMEM for 24 h (Fig. 3a). Interestingly, ΔmviN sank to the bottom of the tube, while the mviNOE cells suspended in the medium,
3.4. MviN influences the in vivo colonization of E. piscicida As an intracellular pathogen, E. piscicida uses EsrB and T3/T6SS to infect the host and survive in vivo (Liu et al., 2017; Zhang et al., 2018). 4
Microbiological Research 239 (2020) 126528
K. Yin, et al.
Fig. 2. MviN is involved in osmotic pressure tolerance in E. piscicida. (a) Relative fluorescence units (RFUs) of the WT, ΔmviN and mviN+ strains statically cultured in DMEM medium were determined at the indicated time points. (b-c) Growth curves of the WT, ΔmviN and mviN+ strains statically in DMEM (b), and DMEM with addition of sucrose (DMEM + Suc) (c). (d) RFUs of WT, ΔmviN and mviN+ strains statically cultured in indicated media were determined at 3 h. The results are shown as the mean ± SEM (n = 3). ***, P < 0.0001; **, P < 0.001; NS, no significance, P > 0.05.
level than that of WT (Fig. 4). However, ΔmviN also showed slight colonization defect compared with WT (Fig. 4). Then, a ΔmviN::Plac-esrB strain, which could constitutively express esrB, was constructed, and the CI assay showed slight colonization defect in this strain compared with that of WT (Fig. 4). These data suggested that MviN might modulate the in vivo colonization of E. piscicida not only through the regulation of EsrB, but also other unknown mechanisms.
We next hypothesized that MviN could influence the in vivo colonization of E. piscicida. The competition index (CI) assay was employed to evaluate the effects of MviN to E. piscicida in vivo colonization. At 8 dpi, the infection stage when E. piscicida mainly existed in turbot livers (Yin et al., 2018), the liver samples were collected in each group and then were enumerated to determine the colonized bacterial numbers. As expected, ΔesrB showed significant growth defect in fish (Fig. 4) (Yin et al., 2018), and the number of mviNOE also showed significant lower
Fig. 3. MviN represses the expression of EsrB and T3/T6SS. (a) Autoaggregation of WT, ΔesrB, ΔmviN, mviNOE (mviN over-expression), ΔmviN/pUTat(ΔmviN with pUTat empty plasmid), and mviN+ statically cultured in DMEM, at 28 °C for 24 h. (b) SDS-PAGE gels were used to separate the extracellular protein profiles of indicated strains (b, up), and the bands corresponding to T3/T6SS proteins (Lv et al., 2012) are marked. The loading control of each strain was the housekeeping DnaK in the whole cellular proteins (WCP) (b, bottom). (c) qRT-PCR analysis of the indicated genes in WT vs. mviNOE. The results were presented as the mean ± SEM (n = 3). The internal control was the gyrB gene. Three repeated experiments of each assay were performed, and the representative figure is shown.
5
Microbiological Research 239 (2020) 126528
K. Yin, et al.
membrane and protecting the bacterium from the osmotic pressure. The reason why the mviN could be deleted in E. piscicida might be that the cell wall of this bacterium was much thicker than that of E. coli (data not shown), which compensated the influence of mviN absence in E. piscicida. MviN was also reported as a virulence factor in many pathogens, i.e. Salmonella species, Arcobacter species and so on (Rubinelli et al., 2015; Sekhar et al., 2017). The low level of mviN significantly attenuated Salmonella Typhimurium, and the mviN knock-down strain was developed as a novel attenuated vaccine of this bacterium (Rubinelli et al., 2015). However, the regulatory mechanism of MviN on virulence was yet unclear. In this study, the MviN was identified as a repressor of esrB and T3/T6SS (Figs. 2a, d and 3), which also behaved as an activator at early growth stage (Fig. 1a and 2a). We also found that MviN might mediate the regulation of environmental osmotic pressure on the expression of esrB (Fig. 2d). Additionally, MviN was critical to the in vivo colonization of E. piscicida, especially at the early and middle infection stages (Fig. 4) (Yang et al., 2017). We hypothesized that when encountering severe environments, such as high osmotic pressure or cell wall biosynthesis defect, the bacteria might turn off the expression of virulence genes and express the resistance-related genes to meet the requirements of nutrients. In this process, MviN might act as a harmonizer to maintain the balance between virulence and survive. Moreover, we hypothesized that MviN dysfunction or disruption might affect the membrane homeostasis to indirectly modulate the EsrA-EsrB phosphorylation signally cascades in E. piscicida. Further investigations shall be warranted to illuminate the mechanisms underlying MviN modulating osmotic pressure on the virulence expression in E. piscicida. In conclusion, MviN was identified as a regulator of EsrB and T3/ T6SS expression and modulate the in vivo colonization in E. piscicida. This study contributes to the finding of new functional aspects of MviN in virulence regulation, which will expend the understanding of the pathogenesis of bacterial pathogens.
Fig. 4. MviN influences in vivo colonization of E. piscicida in turbot. In vivo competition assays for the ΔesrB, ΔmviN, mviNOE and ΔesrB::Plac-esrB strains vs. WT or WT ΔP (WT with pEIB202 cured), which are resistant or sensitive to Cm, respectively. The indicated strains were mixed at 1:1 ratio, and then the mixtures were i.p. injected into turbots, respectively. At 8 day-post infection (dpi), the turbot livers of each group were taken, and the CFUs of indicated strains were enumerated. The comparisons of the CI values for the corresponding WT/ WT ΔP or WT/WT-pUTat samples were based on ANOVA followed by Bonferroni’s multiple-comparison post-test, and *, P < 0.01; **, P < 0.001; ***, P < 0.0001.
4. Discussion EsrB is a horizontally acquired important global regulator and regulates diverse pathways, such as the T3/T6SS, hemolysins, environmental stresses resistance, iron uptake, amino acid biosynthesis and so on in fish pathogen E. piscicida (Chakraborty et al., 2011; Guan et al., 2018; Liu et al., 2017; Lv et al., 2012; Yin et al., 2017). However, few proteins except PhoP, EvrA, RpoS, and PepA were identified as the regulators of esrB (Lv et al., 2012; Wei et al., 2019b; Yin et al., 2018, 2020). Therefore, further investigation on the regulatory network of esrB is necessary to understand the pathogenesis of this bacterium in respective to the sensing of signals and cues from the host and environments. In the previous TIS analysis, 39 putative esrB regulators, including RpoS, were identified (Yin et al., 2018). This study further validated the TIS results, and MviN was identified as another novel regulator of esrB expression (Fig. 1 a,b). Interestingly, we also revealed that MviN might modulate the esrB and T3/T6SS virulence gene expression through its roles in osmotic stress tolerance. MviN, which also named MurJ, has been identified as a lipid II flippase (Ruiz et al., 2016). It is an integral 14-transmembrane-domain membrane protein, which is required for peptidoglycan biosynthesis. It also widely distributed in the Gram-negative bacteria, such as E. coli, Burkholderia cenocepacia and E. piscicida (Fig. 1c-e) (Inoue et al., 2008; Mohamed and Valvano, 2014; Wang et al., 2009). In many bacteria, the deletion of MviN reduces their resistance to osmotic pressures, which leads to cell lysis (Ruiz, 2008). Thus, mviN was often regarded as an essential gene. Although the mviN gene was successfully deleted in E. piscicida, the ΔmviN also showed significant growth defect when cultured in DMEM (Fig. 2b). As expected, the growth defect of ΔmviN could be rescued by the addition of sucrose (Fig. 2c), which usually acts as an osmotic stabilizer to prevent cell lysis (Joseleau-Petit. et al., 2007). Moreover, ΔmviN had a more complicated ECP profile than that of WT, which might be caused by the cell lysis (Fig. 3b). These suggested that MviN was also critical for the stability of E. piscicida cell
Ethics statement All animal protocols used in this study were approved by the Animal Care Committee of the East China University of Science and Technology (2006272). The Experimental Animal Care and Use Guidelines from Ministry of Science and Technology of China (MOST-2011-02) were strictly followed. CRediT authorship contribution statement Kaiyu Yin: Investigation, Formal analysis, Writing - original draft, Funding acquisition. Jin Zhang: Investigation, Writing - original draft. Jiabao Ma: Formal analysis, Data curation. Peng Jin: Validation. Yue Ma: Formal analysis. Yuanxing Zhang: Supervision. Xiaohong Liu: Resources, Writing - review & editing. Qiyao Wang: Conceptualization, Methodology, Writing - review & editing, Funding acquisition, Project administration. Acknowledgments This work was sponsored by China Postdoctoral Science Foundation (2019M651420) and Shanghai Sailing Program (19YF1411500), as well as the National Key Research and Development Program of China (2018YFD0900500), the Ministry of Agriculture of China (CARS-47), and the Science and Technology Commission of Shandong and Shanghai Municipality (2017CXGC0103 and 17391902000). References Cao, X.D., Wang, Q.Y., Liu, Q., Liu, H., He, H.H., Zhang, Y.X., 2010. Vibrio alginolyticus MviN is a LuxO-regulated protein and affects cytotoxicity towards epithelioma papulosum cyprini (EPC) cells. J. Microbiol. Biotechnol. 20, 271–280.
6
Microbiological Research 239 (2020) 126528
K. Yin, et al.
flippase in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 105, 15553–15557. Ruiz, N., 2016. Lipid flippases for bacterial peptidoglycan biosynthesis. Lipid Insights 8, 21–32. Sekhar, M.S., Tumati, S.R., Chinnam, B.K., Kothapalli, V.S., Sharif, N.M., 2017. Virulence gene profiles of Arcobacter species isolated from animals, foods of animal origin, and humans in Andhra Pradesh, India. Vet. World 10, 716–720. Ulland, T.K., Buchan, B.W., Ketterer, M.R., Fernandes-Alnemri, T., Meyerholz, D.K., Apicella, M.A., Alnemri, E.S., Jones, B.D., Nauseef, W.M., Sutterwala, F.S., 2010. Cutting edge: mutation of Francisella tularensis mviN leads to increased macrophage absent in melanoma 2 inflammasome activation and a loss of virulence. J. Immunol. 2010, 2670–2674. Wang, Q.Y., Yang, M.J., Xiao, J.F., Wu, H.Z., Wang, X., Lv, Y.Z., Xu, L.L., Zheng, H.J., Wang, S.Y., Zhao, G.P., Liu, Q., Zhang, Y.X., 2009. Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One 4, e7646. Wei, L.F., Wu, Y.Y., Yang, G.H., Xu, R.J., Liu, X.H., Liu, Q., Zhang, Y.X., Ma, Y., Wang, Q.Y., 2019a. Genome-wide identification of fitness factors in seawater for Edwardsiella piscicida. Appl. Environ. Microbiol. 85, e00233–19. Wei, L.F., Qiao, H.X., Sit, B., Yin, K.Y., Yang, G.H., Ma, R.Q., Ma, J.B., Yang, C., Yao, J., Ma, Y., Xiao, J.F., Liu, X.H., Zhang, Y.X., Waldor, M.K., Wang, Q.Y., 2019b. A bacterial pathogen senses host mannose to coordinate virulence. iScience. 20, 310–323. Xiao, J.F., Wang, Q.Y., Liu, Q., Wang, X., Liu, H., Zhang, Y.X., 2008. Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China. Aquac. Res. 40, 13–17. Xie, H.X., Yu, H.B., Zheng, J., Nie, P., Foster, L.J., Mok, Y.K., Finlay, B.B., Leung, K.Y., 2010. EseG, an effector of the type III secretion system of Edwardsiella tarda, triggers microtubule destabilization. Infect. Immun. 78, 5011–5021. Xie, H.X., Lu, J.F., Zhou, Y., Yi, J., Yu, X.J., Leung, K.Y., Nie, P., 2015. Identification and functional characterization of the novel Edwardsiella tarda effector EseJ. Infect. Immun. 83, 1650–1660. Xu, T., Zhang, X.H., 2014. Edwardsiella tarda: an intriguing problem in aquaculture. Aquaculture 431, 129–135. Yang, G.H., Billings, G., Hubbard, T.P., Park, J.S., Leung, K.Y., Liu, Q., Davis, B.M., Zhang, Y.X., Wang, Q.Y., Waldor, M.K., 2017. Time-resolved transposon insertion sequencing reveals genome-wide fitness dynamics during infection. mBio. 8, e01581–17. Yin, K.Y., Wang, Q.Y., Xiao, J.F., Zhang, Y.X., 2017. Comparative proteomic analysis unravels a role for EsrB in the regulation of reactive oxygen species stress responses in Edwardsiella piscicida. FEMS Microbiol. Lett. 364 fnw269. Yin, K.Y., Guan, Y.P., Ma, R.Q., Wei, L.F., Liu, B., Liu, X.H., Zhou, X.S., Ma, Y., Zhang, Y.X., Waldor, M.K., Wang, Q.Y., 2018. Critical role for a promoter discriminator in RpoS control of virulence in Edwardsiella piscicida. PLoS Pathog. 14, e1007272. Yin, K.Y., Peng, Y., Ahmed, M.A.H., Ma, J.B., Xu, R.J., Zhang, Y.X., Ma, Y., Wang, Q.Y., 2020. PepA binds to and negatively regulates esrB to control virulence in the fish pathogen Edwardsiella piscicida. Microbiol. Res. 232, 126349. Zhang, L.Z., Jiang, Z.W., Fang, S., Huang, Y.J., Yang, D.H., Wang, Q.Y., Zhang, Y.X., Liu, Q., 2018. Systematic identification of intracellular-translocated candidate effectors in Edwardsiella piscicida. Front. Cell. Infect. Microbiol. 16, 8–37.
Chakraborty, S., Sivaraman, J., Leung, K.Y., Mok, Y.K., 2011. Two-component PhoB-PhoR regulatory system and ferric uptake regulator sense phosphate and iron to control virulence genes in type III and VI secretion systems of Edwardsiella tarda. J. Biol. Chem. 286, 39417–39430. Chen, H., Yang, D., Han, F., Tan, J., Zhang, L., Xiao, J., Zhang, Y., Liu, Q., 2017. The bacterial T6SS effector EvpP prevents NLRP3 inflammasome activation by inhibiting the Ca2+-dependent MAPK-Jnk pathway. Cell Host Microbe 21, 47–58. Esteve, C., Alcaide, E., 2018. Seasonal recovery of Edwardsiella piscicida from wild European eels and natural waters: isolation methods, virulence and reservoirs. J. Fish Dis. 41, 1613–1623. Gao, Z.P., Nie, P., Lu, J.F., Liu, L.Y., Xiao, T.Y., Liu, W., Liu, J.S., Xie, H.X., 2015. Type III secretion system translocon component EseB forms filaments on and mediates autoaggregation of and biofilm formation by Edwardsiella tarda. Appl. Environ. Microbiol. 81, 6078–6087. Griffin, M.J., Greenway, T.E., W.D, 2017. Edwardsiella spp. In: Woo, P.T.K., Cipriano, R.C. (Eds.), Fish Viruses and Bacteria: Pathobiology and Protection. CABI, Boston, pp. 281–304. Guan, Y.P., Yin, K.Y., Zhou, M., Yang, M.J., Zhang, Y.X., Liu, X.H., Wang, Q.Y., 2018. EsrB negatively regulates expression of the glutamine sythetase GlnA in the fish pathogen Edwardsiella piscicida. FEMS Microbiol. Lett. 365 fny007. Inoue, A., Murata, Y., Takahashi, H., Tsuji, N., Fujisaki, S., Kato, J., 2008. Involvement of an essential gene, mviN, in murein synthesis in Escherichia coli. J. Bacteriol. 190, 7298–7301. Joseleau-Petit, D., Liebart, J.C., Ayala, J.A., D’Ari, R., 2007. Unstable Escherichia coli L forms revisited: growth requires peptidoglycan synthesis. J. Bacteriol. 189, 6512–6520. Leung, K.Y., Wang, Q.Y., Yang, Z.Y., Siame, B.A., 2019. Edwardsiella piscicida: a versatile emerging pathogen of fish. Virulence 10, 555–567. Liu, Y., Zhao, L.Y., Yang, M.J., Yin, K.Y., Zhou, X.H., Leung, K.Y., Liu, Q., Zhang, Y.X., Wang, Q.Y., 2017. Transcriptomic dissection of the horizontally acquired response regulator EsrB reveals its global regulatory roles in the physiological adaptation and activation of T3SS and the cognate effector repertoire in Edwardsiella piscicida during infection toward turbot. Virulence 8, 1355–1377. Lv, Y.Z., Xiao, J.F., Liu, Q., Wu, H.Z., Zhang, Y.X., Wang, Q.Y., 2012. Systematic mutation analysis of two-component signal transduction systems reveals EsrA-EsrB and PhoPPhoQ as the major virulence regulators in Edwardsiella tarda. Vet. Microbiol. 157, 190–199. Mo, Z.L., Xiao, P., Mao, Y.X., Zou, Y.X., Wang, B., Li, J., Xu, Y.L., Zhang, P.J., 2007. Construction and characterization of a live, attenuated esrB mutant of Edwardsiella tarda and its potential as a vaccine against the haemorrhagic septicaemia in turbot, Scophthamus maximus (L.). Fish Shellfish Immunol. 23, 521–530. Mohamed, Y.F., Valvano, M.A.A., 2014. Burkholderia cenocepacia MurJ (MviN) homolog is essential for cell wall peptidoglycan synthesis and bacterial viability. Glycobiology 24, 564–576. Rubinelli, P.M., Lee, S.I., Roto, S.M., Park, S.H., Ricke, S.C., 2015. Regulated expression of virulence gene mviN provides protective immunity and colonization control of Salmonella in poultry. Vaccine 33, 5365–5370. Ruiz, N., 2008. Bioinformatics identification of MurJ (MviN) as the peptidoglycan lipid II
7