Neuroprotective and growth-promoting effects of bone marrow stromal cells after cervical spinal cord injury in adult rats

Cytotherapy, 2011; 13: 873–887

Neuroprotective and growth-promoting effects of bone marrow stromal cells after cervical spinal cord injury in adult rats

LIUDMILA N. NOVIKOVA1, MARIA BROHLIN1, PAUL J. KINGHAM1, LEV N. NOVIKOV1 & MIKAEL WIBERG1,2 1Department

of Integrative Medical Biology, Section of Anatomy, Umeå University, Umeå, Sweden, and 2Department of Surgical and Perioperative Science, Section of Hand and Plastic Surgery, Umeå University, Umeå, Sweden

Abstract Background aims. Bone marrow stromal cells (BMSC) have been shown to provide neuroprotection after transplantation into the injured central nervous system. The present study investigated whether adult rat BMSC differentiated along a Schwann cell lineage could increase production of trophic factors and support neuronal survival and axonal regeneration after transplantation into the injured spinal cord. Methods. After cervical C4 hemi-section, 5-bromo-2-deoxyuridine (BrdU)/ green fluorescent protein (GFP)-labeled BMSC were injected into the lateral funiculus at 1 mm rostral and caudal to the lesion site. Spinal cords were analyzed 2–13 weeks after transplantation. Results and Conclusions. Treatment of native BMSC with Schwann cell-differentiating factors significantly increased production of brain-derived neurotrophic factor in vitro. Transplanted undifferentiated and differentiated BMSC remained at the injection sites, and in the trauma zone were often associated with neurofilament-positive fibers and increased levels of vascular endothelial growth factor. BMSC promoted extensive in-growth of serotonin-positive raphaespinal axons and calcitonin gene-related peptide (CGRP)-positive dorsal root sensory axons into the trauma zone, and significantly attenuated astroglial and microglial cell reactions, but induced aberrant sprouting of CGRP-immunoreactive axons in Rexed’s lamina III. Differentiated BMSC provided neuroprotection for axotomized rubrospinal neurons and increased the density of rubrospinal axons in the dorsolateral funiculus rostral to the injury site. The present results suggest that BMSC induced along the Schwann cell lineage increase expression of trophic factors and have neuroprotective and growth-promoting effects after spinal cord injury. Key Words: bone marrow, mesenchymal stromal cells, red nucleus, retrograde degeneration, spinal cord trauma, transplantation

Introduction Spinal cord injury in humans usually results from local contusion and is often characterized by massive compression and laceration. The primary lesion also triggers a cascade of secondary necrotic changes that lead to cavitation and glial scar formation in the lesion zone. Delayed degenerative changes may gradually enlarge the cavity, with a subsequently increased loss of neurons and axons (1–6). In recent years, cell transplantation strategies have become an intriguing possibility in spinal cord injury treatment. Among various types of cellular grafts tested experimentally, the most promising effects on axonal regeneration after spinal injury have been reported using cultured Schwann cells (7,8) and olfactory ensheathing cells (9–12). These cells provide a supportive environment and neuroprotective effect as they produce extracellular matrix molecules, integrins and neurotrophic factors. However, limited

access to autologous donor material and problems with allograft rejection have prompted a search for bridging grafts based on different types of stem cells (13–17). Adult stem cells have several advantages that make them unique in comparison with other cells because they can be isolated from a range of tissues and have the capacity for self-renewal and potential to differentiate into multiple lineages (18). From a clinical standpoint, bone marrow-derived stromal cells (BMSC) constitute an interesting source for intraspinal transplantation. BMSC can be modified in culture to overcome germ layer commitment and differentiate into cells resembling neurons or glial cells (19–23). After transplantation into injured spinal cord, BMSC can promote functional recovery in different experimental models of spinal cord injury (reviewed in 13,24–26). The therapeutic implications of these findings are significant, because the bone marrow cells are more easily accessible than neural

Correspondence: Dr Liudmila N. Novikova, Department of Integrative Medical Biology, Section of Anatomy, Umeå University, SE-901 87 Umeå, Sweden. E-mail: [email protected] (Received 29 August 2010; accepted 10 March 2011) ISSN 1465-3249 print/ISSN 1477-2566 online © 2011 Informa Healthcare DOI: 10.3109/14653249.2011.574116

874

L. N. Novikova et al.

or embryonic stem cells and have the advantage of possessing inherent host compatibility. The present study investigated whether adult rat BMSC differentiated along a Schwann cell lineage (21,22) could increase production of neurotrophins and promote neuronal survival and axonal regeneration after cervical spinal cord injury in adult rats.

then transferred to α-MEM containing 10% FBS, 5 μM forskolin, 10 ng/mL recombinant human basic fibroblast growth factor (rh-bFGF; Invitrogen, Paisley, Scotland), 5 ng/mL recombinant human platelet-derived growth factor-AA (rh-PDGF; Chemicon, Solna, Sweden) and 200 ng/mL recombinant human heregulin-beta 1 (HRG; R&D Systems, Abingdon, UK) for 7 days.

Methods Experimental animals

Reverse transcription–polymerase chain reaction

The experiments were performed on adult (10– 12 weeks, n ⫽ 115) female Sprague–Dawley rats (Taconic Europe A/S, Laven, Denmark). The animal care and experimental procedures were carried out in accordance with the European Communities Council Directive (86/609/EEC) and approved by the Northern Swedish Committee for Ethics in Animal Experiments. All surgical procedures were performed under general anesthesia using a mixture of ketamine (Ketalar®, 100 mg/kg intravenously; Pfizer AB, Täby, Sweden) and xylazine (Rompun®, 10 mg/kg intravenously; Bayer, Leverkusen, Germany).

Total RNA was isolated from BMSC using an RNeasy™ kit (Qiagen, Sollentuna, Sweden) and then 1 ng RNA incorporated into a One-Step RTPCR kit (Qiagen) per reaction mix. A thermocycler (Biometra, Goettingen, Germany) was used with the following parameters: a reverse transcription (RT) step (50°C, 30 min) and a nucleic acid denaturation/ RT inactivation step (95°C, 15 min) followed by 35 cycles of denaturation (95°C, 30 s), annealing (30 s) and primer extension (72°C, 1 min) followed by a final extension incubation (72°C, 5 min). Forward and reverse primer (all 5′→3′) pairs (SigmaAldrich) with annealing temperatures used were: brain-derived neurotrophic factor (BDNF), ATGG GACTCTGGAGAGCGTGAA and CGCCAGC CAATTCTCTTTTTGC (66.5°C), neurotrophin-3 (NT-3), CTTATCTCCGTGGCATCCAAGG and TCTGAAGTCAGTGCTCGGACGT (65.5°C), and β-actin, ACTATCGGCAATGAGCGGTTC and AGAGCCACCAATCCACACAGA (65°C). Polymerase chain reaction (PCR) amplicons were electrophoresed (50 V, 90 min) through a 1.5% (w/v) agarose gel and the size of the PCR products estimated using Hyperladder IV (Bioline, London, UK). Samples were visualized under ultraviolet (UV) illumination following GelRed™ nucleic acid stain (Bio Nuclear, Bromma, Sweden) incorporation into the agarose.

BMSC culture To isolate and prepare primary cultures of BMSC, a modification of a previous protocol (27) was used. The tibiae and femora of adult female rats (n ⫽ 10) were removed, washed with cold normal saline and stored on ice in α-Minimum Essential Media (α-MEM) containing 20% fetal bovine serum (FBS), penicillin 100 U/mL and streptomycin 100 μg/mL. The epiphyses were removed and the bone marrow flushed with medium using a 21-G needle attached to 5-mL syringe. After centrifuging the suspension at 1500 r.p.m. for 5 min, the supernatant was removed and the cells resuspended in the same medium. The resulting suspension was filtered through a 70-μm nylon mesh and plated on 75-cm2 culture flasks. After 24 h, the supernatant containing non-adherent cells was discarded and fresh medium added. The medium was changed every 48 h. The cells were detached with 1.25% trypsin/ethylene diamine tetra acetic acid (EDTA) before reaching confluence and replated in culture flasks at a density of 5 ⫻ 103 cells/cm2. To differentiate BMSC into cells with a Schwann cell-like phenotype, we followed in detail a previously published protocol (21). After passage 4, BMSC were incubated with α-MEM containing 1 mM beta-mercaptoethanol (Sigma-Aldrich, Stockholm, Sweden) for 24 h. After washing with 0.1 M phosphate-buffered saline (PBS; pH 7.4), medium was replaced with αMEM containing 10% FBS and 35 ng/mL all-trans-retinoic acid (Sigma-Aldrich) for 3 days. Cells were washed with 0.1 M PBS and

Enzyme-linked immunosorbant assay Fifteen thousand undifferentiated BMSC (uBMSC) or differentiated BMSC (dBMSC) were seeded in 200 μL medium (n ⫽ 5) in a 96-well plate. After 72 h of culture, the medium was analyzed by enzymelinked immunosorbant assay ELISA using a ChemiKine™ BDNF sandwich ELISA kit (Chemicon) according to the manufacturer’s protocol. The absorbance was measured at 450 nm using a Spectra Max 190 microplate reader (Molecular Devices, Sunnyvale, USA). All samples were analyzed in triplicate. Labeling of BMSC for transplantation To express green fluorescent protein (GFP) in BMSC, we used a retroviral expression system.

BMSC for spinal cord injury The retroviral packaging cell line PT67 (Clontech, Mountain View, USA) was propagated in high-glucose Dulcbecco’s modified Eagle medium (DMEM; Invitrogen) supplemented with penicillin, 100 U/mL, streptomycin 100 μg/mL (Invitrogen) and 10% FBS and transfected with a retroviral expression vector, pLEGFPpuro. The GFP expression vector pLEGFPpuro resulted from substitution of the neomycinresistance gene in the retroviral vector pLEGFP-N1 (Clontech) by the puromycin-resistance gene from pMSCVpuro (Clontech). The transfection of PT67 cells was done by a lipofection method with Lipofectamine 2000 (Invitrogen) according to the protocol provided by the manufacturer. Successfully transfected cells were selected with puromycin and maintained (Clontech). For virus production, the packaging cells were seeded at a confluence of about 60%, incubated overnight at 37°C and transferred into a 32°C incubator with 95% humidity and 5% CO2. After 72 h, virus-containing medium was collected and filtered through a 0.45-μm low-protein binding filter (Pall Corporation, Lund Sweden). For transduction, BMSC at passage 4 were seeded at a density of 5 ⫻ 103 cells/cm2 and 2 days later their growth medium was replaced with the viral medium containing 8 μL/mL polybrene (Sigma-Aldrich). The cells were kept at 32°C for 24 h. After transduction, the viral medium was changed to a fresh BMSC growth medium. In addition, 48 h before transplantation BMSC were supplemented with 10 μM 5-bromo-2-deoxyuridine (BrdU; Sigma-Aldrich) to label the nuclei of dividing cells.

875

the cell suspension (100 000–120 000 cells) were slowly (10 min) pressure-injected into the lateral funiculus (depth 1.0 mm) at approximately 1 mm rostral and 1 mm caudal to the lesion site, using a Stoelting’s Lab Standard Stereotaxic Instrument (Stoelting Co., Dublin, Ireland). The micropipette was left in place for an additional 2–3 min. Dura mater was covered with stretched parafilm and Spongostan®, muscles and skin were closed in layers, and the rats were given analgesic Finadyne (2.5 mg/kg intramuscularly; Schering-Plough, Ballerup, Denmark), saline (2 mL s.c.) and benzylpenicillin (60 mg intramuscularly; Boehringer Ingelheim, Ingelheim am Rhein, Germany). Retrograde labeling of rubrospinal neurons In the experiments studying neuronal survival (n ⫽ 18), rubrospinal neurons projecting to lumbar spinal segments were labeled with non-toxic retrograde fluorescent tracer Fast Blue (FB; EMS-Chemie GmbH, Groβ-Umstadt, Germany) 1 week before cervical C4 spinal cord injury (28,29). Following a laminectomy, the L1 spinal cord segment was exposed and the dorsal portion of the left lateral funiculus including the rubrospinal tract (30) was transected with fine scissors under an operating microscope. A small pellet prepared from 1–2 μL of a 2% aqueous solution of the tracer Fast Blue was placed into the lesion cavity and covered with a thin sheet of parafilm and a small piece of Spongostan®. Anterograde tracing of rubrospinal axons

Spinal cord injury and BMSC transplantation After cervical laminectomy, the lateral funiculus and adjacent gray matter of the C4 spinal cord segment were transected on the left side. The rats were randomly divided into three experimental groups: (i) spinal cord injury without treatment (SCI, n ⫽ 27), (ii) SCI followed by transplantation of uBMSC (n ⫽ 23) and (iii) SCI followed by transplantation of dBMSC (n ⫽ 36). Cells were transplanted within 30 min after SCI. Nine normal rats (immunohistochemistry and Western blotting), five rats at 1 week after Fast Blue application to the lumbar spinal cord and five rats at 1 week after anterograde labeling of rubrospinal axons with biotinylated dextran amine (‘control’ in the histograms) served as baseline controls (see below). For transplantation, the cells were detached with trypsin/EDTA, washed and concentrated to 75 ⫻ 103 cells/μL in αMEM without serum. The cells were transplanted at passage 5. After transfer into a siliconized glass micropipette (outer diameter 100 μm) attached to a 5-μL Hamilton syringe, 1.5–1.6 μL of

At 12 weeks after the first operation, the rats (n ⫽ 15) were mounted in a stereotaxic frame and a 2-mm hole drilled in the skull to allow access to the red nucleus. A glass micropipette (outer tip diameter 40–50 μm) filled with a 10% solution of biotinylated dextran amine in saline (BDA; 10 000 MW, lysine fixable; Molecular Probes, Invitrogen, Paisley, Scotland) was inserted into the magnocellular and parvicellular regions of the red nucleus (6.6 and 6.1 mm caudal to the bregma, 0.7 mm lateral to the midline and 7.2 mm ventral to the bregma) using a Stoelting’s Lab Standard Stereotaxic Instrument (Stoelting Co.). BDA was injected iontophoretically by passing anodal current pulses of 10 μA (7 s on/7 s off) through the microelectrode for 10 min and the microelectrode was then left in place for an additional 2–3 min (29,31). The rats were killed 1 week after labeling. Tissue processing At the end of experiment, the animals were deeply anesthetized with an intraperitoneal overdose of

876

L. N. Novikova et al.

Figure 1. uBMSC (A–D) immunostained for vimentin (A), fibronectin (B), laminin (C) and nestin (D), and BMSC (E, F) after treatment with Schwann cell differentiation medium and immunostained for S-100 protein (E) and GFAP (F). The nuclei were counterstained with DAPI. Scale bar 50 μm.

sodium pentobarbital. For Western blotting, C3 spinal cord segments rostral to the injury site were divided into two halves in the sagittal plane and immediately frozen in liquid nitrogen. All other animals were transcardially perfused with Tyrode’s solution followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). In the experiments using anterograde BDA labeling, the fixation consisted of a mixture of 4% paraformaldehyde and 0.5% glutaraldehyde in 0.1 M phosphate buffer (pH ⫽ 7.4). Spinal cord segments C2 and C3–C5 and the brain stem were removed and transferred into the same fixative. For immunohistochemistry, spinal cord segments were post-fixed for 2–3 h, cryoprotected in 10% and 20% sucrose for 2–3 days and frozen in liquid isopentane. Serial longitudinal 16-μm thick sections were cut on a cryomicrotome (Leica Instruments, Kista, Sweden), thaw-mounted in pairs onto SuperFrost®Plus slides, dried overnight at room temperature and stored at –85°C before processing. For fluorescence microscopy and cell counts, 50-μm thick serial transverse sections from the midbrain were cut on a vibratome (Leica Instruments), mounted on gelatin-coated glass slides, air dried, quickly immersed in xylene and coverslipped in distyrene plus plasticizer and xylene (DPX) (Kebo Lab AB, Stockholm, Sweden). For demonstration of anterogradely BDA-labeled

rubrospinal axons and arborizations, serial 50-μm thick transverse sections (C2 spinal cord segments) and longitudinal sections (C3–C5 spinal cord segments) were cut on a cryomicrotome or vibratome and processed according to a modified Avidini Biotiin Complex (ABC) method (31). Briefly, freefloating sections were washed in PBS, incubated for 6 h at room temperature with avidin–biotin–peroxidase complex (1:1:100; Vector Laboratories, Peterborough, UK) in PBS containing 0.3% Triton X-100 and 1% bovine serum albumin, developed in a solution containing 0.05% 3,3′ - diaminobenzidine tetrahydrochloride (DAB; Sigma-Aldrich), 0.06% NiCl2 and 0.003% H2O2, mounted on glass slides, counterstained with cresyl violet and cover slipped in DPX. Western blotting C3 spinal cord segments were homogenized in lysis buffer containing 5 mM ethylene glycol tetraacetic acid (EGTA), 100 mM 1,4-Piperazinediethanesulfonic acid (PIPES), 5 mM MgCl2, 20% (v/v) glycerol, 0.5% (v/v) Triton X-100 and protease inhibitor cocktail (Sigma-Aldrich) and then protein levels determined using a DC Protein Assay (BioRad, Sundbyberg, Sweden). Eighteen micrograms of protein

BMSC for spinal cord injury

877

Walkersville, MD, USA), which performs peak area integration to determine the area of each band in pixel units. The optical density of each protein was expressed as a ratio of the corresponding signal for actin. Immunohistochemistry

Figure 2. RT-PCR and ELISA analysis of neurotrophic factors. (A) uBMSC and dBMSC express BDNF transcripts but not NT-3 transcripts. The housekeeping gene, β-actin, was used as loading control. Amplicon size is indicated in base pairs (bp). (B) ELISA shows dBMSC released significantly (P ⬍ 0.001) more BDNF into the cell culture medium compared with uBMSC.

were loaded per lane onto 10% (v/v) or 15% (v/v) sodium dodecyl (SDS)–polyacrylamide gels and resolved at 200 V. Following electrophoresis, protein was transferred to nitrocellulose membranes (80 V for 75 min) and then blocked in 5% (w/v) non-fat milk in Tris-buffered saline with Tween (TBS-T) for 1 h. The following primary antibodies were diluted in the blocking solution and incubated with membranes overnight at 4°C: rabbit anti-BDNF (1:200; Santa Cruz, Biotechnology, Heidelberg, Germany), rabbit anti-NT-3 (1:200; Santa Cruz), rabbit antivascular endothelial growth factor (VEGF) (1:200; Santa Cruz) and rabbit anti-laminin (1:500; Sigma, Poole, UK). After 6 ⫻ 5-min washes in TBS-T, rabbit IgG horseradish peroxidase (HRP)-linked secondary antibody (1:1000; Cell Signaling Technology, Boston, USA) was applied for 1 h at room temperature. Finally the membranes were washed for 6 ⫻ 5 min in TBS-T and the blots exposed enhanced chemiluminescence (ECL) reagent (GE Healthcare, Uppsala, Sweden) and developed onto Kodak XPS films. To ensure equal protein loading of samples, the membranes were stripped of antibody using 100 mM glycine, pH 2.9, and then processed for blotting with mouse anti-actin (1:5000; Millipore). Films were scanned using an Epson Photoscanner and then analyzed using Scion Image (Scion Corporation,

Immunostaining was performed on longitudinal 16-μm thick spinal cord sections and cells cultured on Lab-Tek® slides. After blocking with normal serum, the following primary antibodies were used: mouse anti-vimentin (1:1000; Chemicon), mouse anti-laminin (1:200; Chemicon), mouse antifibronectin (1:200; Chemicon), mouse anti-nestin (1:2000; Chemicon), rabbit anti-S-100 protein (1:1000; Dakopatts, Stockholm, Sweden), rabbit anti-glial fibrillary acidic protein (GFAP) (1:500; Dako), rabbit anti-GFP (1:500; Molecular Probes, Invitrogen), anti-BrdU (1:2000; Sigma-Aldrich), rabbit anti-serotonin (1:1000; Sigma-Aldrich), rabbit anti-calcitonin gene-related peptide (CGRP; 1:1000; Chemicon), monoclonal antibodies reacting with C3bi complement receptors (OX42; 1:250; Serotec, Düsseldorf, Germany) and a cocktail of monoclonal antibodies reacting with 68 kDa, 160 kDa and 200 kDa neurofilament proteins (pan-NF; 1:200; Zymed Laboratories, San Francisco, USA). All primary antibodies were applied for 2 h at room temperature. After rinsing in PBS, secondary goat anti-mouse and goat anti-rabbit antibodies Alexa Fluor® 488 and Alexa Fluor® 568 (1:300; Molecular Probes, Invitrogen) were applied for 1 h at room temperature in the dark. The slides were coverslipped withVectashield® mounting medium containing 4’,6-diamidino-2-phenyl indole (DAPI) (Vector Laboratories). The staining specificity was tested by omission of primary antibodies. Expression of BMSC markers was quantified in 10 randomly selected areas of the LabTek slide at ⫻ 250 final magnification using a 400 ⫻ 400-μm sampling frame. Quantification of axonal sprouting and glial reaction Serotonin-positive nerve fibers in the ventral horn, CGRP-positive nerve fibers in Rexed’s lamina III, GFAP-positive astrocytes and OX42-positive microglial cells in lamina VII were studied in 20 randomly selected transverse sections from the C2 spinal cord segments of normal rats and at 6 weeks after SCI and BMSC transplantation. Images were captured at 400 final magnifications with a Nikon DS-U2 digital camera and imported into Image-Pro Plus software (Media Cybernetics Inc., Bethesda, MD, USA). The resolution was 3840 ⫻ 3072 pixels for images of nerve fibers and 1280 ⫻ 1024 pixels for

878

L. N. Novikova et al.

Figure 3. Horizontal spinal cord sections showing BrdU-labeled (A, B; red) and GFP-labeled (C, D; green) dBMSC at 2 weeks and 5 weeks after transplantation, respectively. Sections in (C, D) immunostained for pan-NF (NF, red). Boxed areas in (A) and (C) are enlarged in (B) and (D), respectively. Dashed line in (A) indicates trauma zone border, asterisks indicate injection sites and arrow in (D) indicates association of GFP-labeled dBMSC with NF-positive axons. Note in-growths of NF-stained fibers into the trauma zone and injection sites (C). The nuclei in (A, B) were counterstained with DAPI. Scale bar 200 μm.

images of glial cells. The relative tissue area occupied by labeled profiles was quantified in a 100 ⫻ 100μm area for serotonin-positive axons, 50 ⫻ 150-μm area for CGRP-positive axons and 150 ⫻ 150-μm area for glial cells. Counts of rubrospinal neurons and axons The nuclear profiles of the retrogradely labeled neurons were counted in all sections through the red nucleus at ⫻ 250 magnification. The total number of profiles was not corrected for split nuclei because the nuclear diameters were small in comparison with the section thickness used (28,29,32). We have previously demonstrated that the accuracy of this counting technique in estimation of retrograde neuronal cell death is similar to that obtained with the physical disector method (33) and counts of neurons reconstructed from serial sections (34). BDA-labeled rubrospinal axons were studied in 25 randomly selected transverse sections from the C2 spinal cord segments of normal rats and at

13 weeks after SCI and dBMSC transplantation, as described previously (29). In brief, rubrospinal axons in dorsolateral funiculus and terminal arborizations in lamina V were captured in four nonoverlapping areas at a 2000 final magnification with a Nikon DXM1200 digital camera and imported into Matrox Inspector 3.1 software (Matrox Electronic Systems Ltd, Quebec, Canada). The final image size was 1280 ⫻ 1024 pixels and corresponded to an area of 54.18 ⫻ 43.35 μm. The density of labeled profiles was quantified for each image at a constant discrimination level and an average value was calculated for each section.

Image processing Preparations were photographed with a Nikon DXM1200 or Nikon DS-U2 digital camera. The captured images were resized, grouped into a single canvas and labeled using Adobe Photoshop CS4 software. The contrast and brightness were adjusted to provide optimal clarity.

BMSC for spinal cord injury

879

Figure 4. Representative Western blots for BDNF, NT-3, VEGF and laminin expression in C3 spinal cord segments. Protein was prepared from healthy uninjured rats (control) or rats subjected to cervical spinal cord injury in the absence (SCI) or presence of cells (uBMSC, dBMSC). Histograms show the mean optical density (OD) for each band expressed relative to the corresponding actin levels for each sample, for a total of four animals per group. Error bars show SEM. P ⬍ 0.05 is indicated by ∗(control versus injured animals in the absence or presence of cells) and P ⬍ 0.01 is indicated by ∗∗(SCI versus dBMSC).

Statistical analysis

Results

One-way analysis of variance (ANOVA) followed by a post-hoc Newman-Keuls multiple comparison test was used to determine statistical differences between the experimental groups (Prism®; GraphPad Software Inc., San Diego, CA, USA).

BMSC in culture Although uBMSC in primary cultures displayed significant variability, the majority of cells had a flat fibroblast-like morphology. In agreement with previous observations (22,35), all uBMSC were

880

L. N. Novikova et al.

Figure 5. Horizontal C3–C5 spinal cord sections showing axonal growth in the trauma zone at 8 weeks after C4 spinal cord hemi-section (A, B) and after injury followed by transplantation of uBMSC (G) and dBMSC (E, F, H). Sections in (A–D) are immunostained for pan-NF, in (E, F) for serotonin (5HT; raphaespinal axons) and in (G, H) for CGRP (sensory axons). Boxed areas in (A), (C) and (E) are enlarged in (B), (D) and (F), respectively. Scale bars 200 μm (A–F) and 100 μm (G–H).

BMSC for spinal cord injury

881

Figure 6. Histogram showing relative tissue area occupied by serotonin-positive raphaespinal axons in the ventral horn (A), CGRP-positive axons in lamina III (B), GFAP-positive astrocytes in lamina VII (C) and OX42-positive microglial cells in lamina VII (D) at 6 weeks after cervical spinal cord injury followed by transplantation of uBMSC and dBMSC. Error bars show SEM. P ⬍ 0.01 is indicated by ∗(SCI versus BMSC) and ∗∗(control versus SCI and BMSC).

immunopositive for vimentin, laminin and fibronectin (Figure 1A–C). A small proportion of uBMSC also expressed nestin (6.1 ⫾ 2.0%; Figure 1D) and S-100 protein (6.5 ⫾ 1.7%). Following treatment with induction medium (21), BMSC slowly reached confluence and many cells changed their shape from a flat to spindle-like morphology. Immunoreactivity for the S-100 protein was found in 53 ⫾ 2.0% of dBMSC (Figure 1E). In addition, dBMSC began to express glial marker GFAP (⬍ 1%; Figure 1F). Transcripts for BDNF but not NT-3 were detected in both uBMSC and dBMSC (Figure 2A). RT-PCR amplification efficacy of the mRNA was confirmed by amplification of the β-actin housekeeping gene. Semi-quantitatively, the results suggested that BDNF transcript levels were elevated in dBMSC. Therefore, to confirm that differentiation of the BMSC led to increased protein expression, we analyzed BDNF levels in the cell supernatants (Figure 2B). uBMSC produced 6.4 ⫾ 0.3 pg/mL BDNF and this was significantly (P ⬍ 0.001) increased to 99.7 ⫾ 1.8 pg/mL BDNF from the dBMSC. Distribution of BMSC after transplantation BrdU- and GFP-labeled BMSC were found in the injection sites rostral and caudal to the spinal

hemi-section and in the trauma zone (Figure 3). The number of labeled cells was decreased at 5 weeks postoperatively and only a few labeled BMSC could be found at 8 weeks after implantation into the injured spinal cord. No significant migration from the corresponding injection sites was observed. Additional immunostaining with pan-NF antibodies revealed that axons readily entered sites of cell transplantation and in many cases could be found in close association with grafted BMSC (Figure 3). BMSC transplantation and neurotrophic factor expression in the host tissue Western blot analysis of C3 spinal cord segments was performed to determine the expression levels of various growth-promoting molecules (Figure 4). The 14-kDa mature form of BDNF was detected in control tissue and showed a significantly (P ⬍ 0.05) reduced expression level in spinal cord hemi-sectiontreated animals. The presence of uBMSC or dBMSC did not alter expression levels of BDNF. The levels of NT-3 protein were not altered by spinal cord hemisection in the absence or presence of cells (Figure 4). VEGF migrated in the SDS–polyacryamide gels as a dimer of 42 kDa and a monomer of 21 kDa.

882

L. N. Novikova et al. cord hemi-section-treated animals compared with control animals; addition of cells did not change the levels further. Effects of BMSC on axonal regeneration and glial reaction At 6–8 weeks after spinal cord hemi-section, only a few thin pan-NF-immunolabeled terminals were found within the trauma zone. Transplantation of uBMSC and dBMSC induced extensive in-growth of NF-positive fibers, serotonin-positive raphaespinal axons and CGRP immunostained sensory axons into the trauma zone (Figure 5). An interesting finding was that in some experiments BMSC promoted regeneration of raphaespinal fibers across the lesion site and into the caudal spinal cord (Figure 5E, F). Quantification of axonal arborizations in the C2 spinal segment at 6 weeks post-operatively demonstrated that spinal cord hemi-section induced significant sprouting of serotonin-positive raphaespinal axons in the ventral horn but did not affect the number CGRPlabeled sensory terminals in the dorsal horn (Figure 6A, B). Transplantation of dBMSC but not uBMSC attenuated sprouting of raphaespinal axons (P ⬍ 0.05; Figure 6A). However, both uBMSC and dBMSC caused aberrant in-growth of CGRP-immunoreactive axons into Rexed’s lamina III (P ⬍ 0.01; Figure 6B). Spinal cord hemi-section increased immunoreactivity of GFAP-positive astrocytes and OX42-positive microglial cells in lamina VII rostral to the injury site. Transplantation of BMSC significantly attenuated astroglial and microglial reactivity (P ⬍ 0.01; Figure 6C, D). Effects of BMSC on rubrospinal neurons

Figure 7. Histogram showing survival of Fast Blue-labeled rubrospinal neurons at 8 weeks post-operatively (A), the density of BDA-labeled rubrospinal axons in the dorsolateral funiculus (B) and the density of rubrospinal terminal arborizations in the gray matter (C) at 13 weeks after cervical spinal cord injury followed by transplantation of dBMSC. Control indicates untreated rats at 1 week after Fast Blue labeling (A) or normal uninjured rats at 1 week after BDA labeling (B–D). Error bars show SEM. P ⬍ 0.01 is indicated by ∗(SCI versus dBMSC) and P ⬍ 0.001 is indicated by ∗∗(control versus SCI and dBMSC).

The dimer expression levels were unaffected by spinal cord hemi-section or treatment with cells. The monomer was not detected in control tissue and was expressed at low levels in spinal cord hemi-sectiontreated animals. The addition of dBMSC significantly (P ⬍ 0.01) elevated the expression levels of VEGF monomer and there was also a smaller increase upon treatment with uBMSC (Figure 4). Laminin expression was significantly (P ⬍ 0.05) elevated in spinal

In order to assess possible neuroprotective effects of BMSC, we pre-labeled rubrospinal neurons projecting to the lumbar spinal cord with the fluorescent dye Fast Blue. In control animals, at 1 week after Fast Blue application to the lumbar spinal cord, the red nucleus contained 1704 ⫾ 58-labeled neuronal profiles located in the ventral portions of the magnocellular and parvicellular regions of the nucleus. Spinal cord hemi-section at the C4 cervical level induced significant cell death in the red nucleus, and at 8 weeks post-operatively only about 50% of the Fast Blue-labeled rubrospinal neurons remained in the nucleus (Figure 7A). Transplantation of uBMSC had no neuroprotective effect of rubrospinal neurons. In contrast, dBMSC promoted survival of rubrospinal neurons to 68% (P ⬍ 0.05; Figure 7A) and increased the number of BDA-labeled rubrospinal axons in the dorsolateral funiculus rostral to the injury site (P ⬍ 0.01, Figure 7B and Figure 8A, C, E).

BMSC for spinal cord injury

883

Figure 8. Transverse sections through the C2 spinal cord segment showing BDA-labeled rubrospinal axons and terminal arborizations in a control uninjured animal (A, B), at 13 weeks after spinal cord injury (C, D) and after injury followed by transplantation of dBMSC (E, F). Arrows indicate labeled stem axons in the dorsolateral funiculus and arrowheads indicate labeled arborizations in the gray matter (enlarged in right column). Scale bars 200 μm (left column) and 50 μm (right column).

However, the density of labeled rubrospinal arborizations in Rexed’s lamina V was not affected by dBMSC transplantation (Figure 7C and Figure 8B, D, F) and no regeneration of rubrospinal axons was found in the trauma zone. Discussion The present study shows that differentiation of BMSC into Schwann cell-like cells changes the morphology and immunocytochemical profile of BMSC. Moreover, the differentiation protocol increases production of BDNF by BMSC in culture. After transplantation, BMSC change the expression of VEGF in the injured spinal cord tissue rostral to the injury but do not affect expression of neurotrophins BDNF and NT-3. Transplanted cells increased in-growth of different types of

nerve fibers into the trauma zone, attenuated the glial cell reaction but induced sprouting of CGRP-immunoreactive axons in the dorsal horn. In contrast to uBMSC, dBMSC also reduced retrograde degeneration of axotomized rubrospinal neurons and increased the number of rubrospinal axons in the dorsolateral funiculus. BMSC contain different cell populations, including multipotent adult progenitor cells, that can proliferate with limited senescence and differentiate into mesodermal, neuroectodermal and endodermal cell types (20,36,37). The present findings, showing that differentiated BMSC express glial markers and increase production of BDNF, are in line with previous observations made in rat and human BMSC (17,21–23). The ability of BMSC to differentiate along a neural or glial lineage generated controversy as

884

L. N. Novikova et al.

a number of reports have demonstrated very little or no differentiation following transplantation of native BMSC in the central nervous system (38–42). However, it has been demonstrated repeatedly that both native and differentiated BMSC can prevent secondary degeneration, reduce cavity formation and stimulate axonal regeneration and remyelination in different spinal cord injury models (17,43–49). Moreover, BMSC have been found to enhance angiogenesis in the ischemic boundary zone, stimulate neurogenesis, reduce the infarct size, restore the cerebral blood flow and blood–brain barrier, and support neurologic functional recovery after traumatic brain injury and stroke in adult rats (50–53). Although the mechanisms of neuroprotective and growth-promoting effects of BMSC are largely unknown, it has been proposed that neurologic benefits resulting from BMSC transplantation may come from the increased production of neurotrophic factors in the trauma zone and reduced secondary degeneration and cavitation (54). The latter hypothesis seems to be in line with the discussion that functional improvements appear relatively soon after injury and BMSC transplantation, and can indicate that neuroprotection has been achieved through secretion of trophic factors rather than anatomical restoration as a result of axonal growth and synaptogenesis (55). In recent years, numerous studies have reported that native BMSC could produce various growth factors, including neurotrophins BDNF and NT-3 (56–63). Different expression profiles for chemokines and cytokines in BMSC from different donors have been reported recently (64). In addition, it has been shown that transplanted BMSC can enhance production of endogenous VEGF and glial derived neurotrophic factor (GDNF) in the reactive host astrocytes (65). It has been demonstrated repeatedly that neurotrophic factors BDNF, NT-3, glial derived neurotrophic factor (GDNF) and ciliary neurotrophic factor (CNTF) can rescue axotomized descending and ascending tract neurons from retrograde cell death, support axonal regeneration and reduce secondary degeneration and cavitation in different models of spinal cord injury (66–73). We have reported previously that continuous intrathecal infusion of exogenous BDNF can protect more that 90% of axotomized rubrospinal neurons (29,32). Recently, it has been shown that human BMSC can attenuate retrograde degeneration of corticospinal neurons after spinal cord injury (47), and the present study also showed a moderate neuroprotective effect of transplanted dBMSC on rubrospinal neurons. Although we did not find BMSC expressing NT-3 transcripts in our cultures, the present results demonstrate that treatment of BMSC with a specific

differentiation protocol (21) significantly increases production of BDNF in vitro. However, following transplantation into the injured spinal cord, BMSC did not increase expression of neurotrophins BDNF and NT-3 in the host tissue but elevated levels of VEGF. It is known that VEGF can provide significant neuroprotection after experimental spinal cord injury (74) and a similar effect on VEGF expression has been described after BMSC transplantation into an experimental stroke model in rats (75). Despite the findings that BMSC transplants can promote partial functional recovery after spinal cord injury, only limited axonal regeneration across the trauma zone has been reported (35,49,57,76–79). In the present study, dBMSC induced axonal in-growth into the trauma zone but only in some experimental animals did regenerated axons cross the lesion site and enter into the distal spinal cord. However, it has been demonstrated that BMSC can stimulate neurite out-growth over inhibitory extracellular matrix molecules such as chondroitin sulphate proteoglycan (CSPG), myelin associated glycoprotein (MAG) and Nogo-A (80). Moreover, a combined approach of stimulating the neuronal cell body with 3’-5’ -cyclic adenosine monophosphate (cAMP) and the injured axon with neurotrophins and BMSC transplantation could promote axonal growth into and beyond sites of spinal cord injury (5). In addition, we have demonstrated that dBMSC increased regeneration of rubrospinal axons in the white matter rostral to the injury site but did not increase sprouting of rubrospinal arborizations in lamina V. Sprouting of raphaespinal axons in the ventral horn was also reduced. The latter effects support the hypothesis that successful long-distance regeneration after spinal cord injury is accompanied by inhibition of axonal branching (81). In contrast to descending pathways, BMSC transplantation caused aberrant sprouting of CGRPpositive sensory axons in lamina III. A similar effect has been shown following transplantation of neural stem cells (82). The same authors also demonstrated that suppression of astrocytic differentiation of transplanted neural stem cells prevents graft-induced sprouting of CGRP-positive fibers and allodynia. However, in our study transplanted BMSC significantly attenuated astroglial and microglial activity. The results are in line with a previous report that BMSC can reduce chronic inflammation and injuryinduced sensitivity to mechanical stimuli in experimental spinal cord injury (48). In summary, the present results demonstrate that the grafting of BMSC into injured spinal cord increases production of trophic factors, stimulates axonal growth and provides neuroprotection for central neurons.

BMSC for spinal cord injury Acknowledgments This study was supported by the Swedish Medical Research Council, Umeå University, County of Västerbotten, Åke Wibergs Stiftelse, Magn. Bergvalls Stiftelse, Clas Groschinskys Minnesfond, Anna-Stina och John Mattsons Minnesstiftelse för sonen Johan and the Gunvor and Josef Anér Foundation. We thank Mrs G. Folkesson and Mrs G. Hällström for technical assistance. Disclosure of interest: All contributing authors have no conflict of interest for this study. References 1. Tator CH. Review of treatment trials in human spinal cord injury: issues, difficulties, and recommendations. Neurosurgery. 2006;59:957–82. 2. Rossignol S, Schwab M, Schwartz M, Fehlings MG. Spinal cord injury: time to move? J Neurosci. 2007;27:11782–92. 3. Adams M, Carlstedt T, Cavanagh J, Lemon RN, McKernan R, Priestley JV, et al. International spinal research trust research strategy. III. A discussion document. Spinal Cord. 2007;45:2–14. 4. Fitch MT, Silver J. CNS injury, glial scars, and inflammation: inhibitory extracellular matrices and regeneration failure. Exp Neurol. 2008;209:294–301. 5. Lu P, Tuszynski MH. Growth factors and combinatorial therapies for CNS regeneration. Exp Neurol. 2008;209:313–20. 6. Bradbury EJ, McMahon SB. Spinal cord repair strategies: why do they work? Nat Rev Neurosci. 2006;7:644–53. 7. Oudega M, Xu XM. Schwann cell transplantation for repair of the adult spinal cord. J Neurotrauma. 2006;23:453–67. 8. Pearse DD, Bunge MB. Designing cell- and gene-based regeneration strategies to repair the injured spinal cord. J Neurotrauma. 2006;23:438–52. 9. Raisman G, Carlstedt T, Choi D, Li Y. Clinical prospects for transplantation of OECs in the repair of brachial and lumbosacral plexus injuries: opening a door. Exp Neurol. May 19. [epub ahead of print], doi:10.1016/j.expneurol.2010.05.007. 10. Richter MW, Roskams AJ. Olfactory ensheathing cell transplantation following spinal cord injury: hype or hope? Exp Neurol. 2008;209:353–67. 11. Franssen EH, de Bree FM, Verhaagen J. Olfactory ensheathing glia: their contribution to primary olfactory nervous system regeneration and their regenerative potential following transplantation into the injured spinal cord. Brain Res Rev. 2007;56:236–58. 12. Munoz-Quiles C, Santos-Benito FF, Llamusi MB, RamonCueto A. Chronic spinal injury repair by olfactory bulb ensheathing glia and feasibility for autologous therapy. J Neuropathol Exp Neurol. 2009;68:1294–308. 13. Coutts M, Keirstead HS. Stem cells for the treatment of spinal cord injury. Exp Neurol. 2008;209:368–77. 14. Lowry N, Goderie SK, Adamo M, Lederman P, Charniga C, Gill J, et al. Multipotent embryonic spinal cord stem cells expanded by endothelial factors and Shh/RA promote functional recovery after spinal cord injury. Exp Neurol. 2008;209:510–22. 15. Parr AM, Kulbatski I, Wang XH, Keating A, Tator CH. Fate of transplanted adult neural stem/progenitor cells and bone marrow-derived mesenchymal stromal cells in the injured adult rat spinal cord and impact on functional recovery. Surg Neurol. 2008;70:600–7.

885

16. Sharp J, Keirstead HS. Stem cell-based cell replacement strategies for the central nervous system. Neurosci Lett. 2009; 456:107–11. 17. Kamada T, Koda M, Dezawa M, Anahara R, Toyama Y, Yoshinaga K, et al. Transplantation of human bone marrow stromal cell-derived Schwann cells reduces cystic cavity and promotes functional recovery after contusion injury of adult rat spinal cord. Neuropathology. 2011;31:48–58. 18. Singec I, Jandial R, Crain A, Nikkhah G, Snyder EY. The leading edge of stem cell therapeutics. Annu Rev Med. 2007;58:313–28. 19. Woodbury D, Schwarz EJ, Prockop DJ, Black IB. Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res. 2000;61:364–70. 20. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 2002;418: 41–9. 21. Dezawa M, Takahashi I, Esaki M, Takano M, Sawada H. Sciatic nerve regeneration in rats induced by transplantation of in vitro differentiated bone-marrow stromal cells. Eur J Neurosci. 2001;14:1771–6. 22. Caddick J, Kingham PJ, Gardiner NJ, Wiberg M, Terenghi G. Phenotypic and functional characteristics of mesenchymal stem cells differentiated along a Schwann cell lineage. Glia. 2006;54:840–9. 23. Brohlin M, Mahay D, Novikov LN, Terenghi G, Wiberg M, Shawcross SG, et al. Characterisation of human mesenchymal stem cells following differentiation into Schwann cell-like cells. Neurosci Res. 2009;64:41–9. 24. Kocsis JD, Akiyama Y, Radtke C. Neural precursors as a cell source to repair the demyelinated spinal cord. J Neurotrauma. 2004;21:441–9. 25. Enzmann GU, Benton RL, Talbott JF, Cao QL, Whittemore SR. Functional considerations of stem cell transplantation therapy for spinal cord repair. J Neurotrauma. 2006;23: 479–95. 26. Dezawa M. Systematic neuronal and muscle induction systems in bone marrow stromal cells: the potential for tissue reconstruction in neurodegenerative and muscle degenerative diseases. Med Mol Morphol. 2008;41:14–9. 27. Azizi SA, Stokes D, Augelli BJ, DiGirolamo C, Prockop DJ. Engraftment and migration of human bone marrow stromal cells implanted in the brains of albino rats: similarities to astrocyte grafts. Proc Natl Acad Sci USA. 1998;95: 3908–13. 28. Novikov LN, Novikova LN, Mosahebi A, Wiberg M, Terenghi G, Kellerth JO. A novel biodegradable implant for neuronal rescue and regeneration after spinal cord injury. Biomaterials. 2002;23:3369–76. 29. Novikova LN, Novikov LN, Kellerth JO. Differential effects of neurotrophins on neuronal survival and axonal regeneration after spinal cord injury in adult rats. J Comp Neurol. 2002;452:255–63. 30. Paxinos G. The rat Nervous System, Sydney: Academic Press; 1985. p. 362. 31. Novikov LN. Labeling of central projections of primary afferents in adult rats: a comparison between biotinylated dextran amine, neurobiotin and Phaseolus vulgaris-leucoagglutinin. J Neurosci Methods. 2001;112:145–54. 32. Novikova LN, Novikov LN, Kellerth JO. Survival effects of BDNF and NT-3 on axotomized rubrospinal neurons depend on the temporal pattern of neurotrophin administration. Eur J Neurosci. 2000;12:776–80. 33. Ma JJ, Novikov LN, Wiberg M, Kellerth JO. Delayed loss of spinal motoneurons after peripheral nerve injury in adult rats: a quantitative morphological study. Exp Brain Res. 2001; 139:216–23.

886

L. N. Novikova et al.

34. Novikov L, Novikova L, Kellerth J-O. Brain-derived neurotrophic factor promotes axonal regeneration and long-term survival of adult rat spinal motoneurons in vivo. Neuroscience. 1997;79:765–74. 35. Hofstetter CP, Schwarz EJ, Hess D, Widenfalk J, El Manira A, Prockop DJ, et al. Marrow stromal cells form guiding strands in the injured spinal cord and promote recovery. Proc Natl Acad Sci USA. 2002;99:2199–204. 36. Kuroda Y, Kitada M, Wakao S, Nishikawa K, Tanimura Y, Makinoshima H, et al. Unique multipotent cells in adult human mesenchymal cell populations. Proc Natl Acad Sci USA. 2010;107:8639–43. 37. Ratajczak MZ, Shin DM, Kucia M. Very small embryonic/ epiblast-like stem cells: a missing link to support the germ line hypothesis of cancer development? Am J Pathol. 2009; 174:1985–92. 38. Neuhuber B, Gallo G, Howard L, Kostura L, Mackay A, Fischer I. Reevaluation of in vitro differentiation protocols for bone marrow stromal cells: disruption of actin cytoskeleton induces rapid morphological changes and mimics neuronal phenotype. J Neurosci Res. 2004;77: 192 –204. 39. Lu P, Blesch A, Tuszynski MH. Induction of bone marrow stromal cells to neurons: differentiation, transdifferentiation, or artifact? J Neurosci Res. 2004;77:174–91. 40. Castro RF, Jackson KA, Goodell MA, Robertson CS, Liu H, Shine HD. Failure of bone marrow cells to transdifferentiate into neural cells in vivo. Science. 2002;297:1299. 41. Swanger SA, Neuhuber B, Himes BT, Bakshi A, Fischer I. |Analysis of allogeneic and syngeneic bone marrow stromal cell graft survival in the spinal cord. Cell Transplant. 2005;14: 775–86. 42. Yoshihara H, Shumsky JS, Neuhuber B, Otsuka T, Fischer I, Murray M. Combining motor training with transplantation of rat bone marrow stromal cells does not improve repair or recovery in rats with thoracic contusion injuries. Brain Res. 2006;1119:65–75. 43. Someya Y, Koda M, Dezawa M, Kadota T, Hashimoto M, Kamada T, et al. Reduction of cystic cavity, promotion of axonal regeneration and sparing, and functional recovery with transplanted bone marrow stromal cell-derived Schwann cells after contusion injury to the adult rat spinal cord. J Neurosurg Spine. 2008;9:600–10. 44. Osaka M, Honmou O, Murakami T, Nonaka T, Houkin K, Hamada H, et al. Intravenous administration of mesenchymal stem cells derived from bone marrow after contusive spinal cord injury improves functional outcome. Brain Res. 2010;1343:226–35. 45. Park HW, Lim MJ, Jung H, Lee SP, Paik KS, Chang MS. Human mesenchymal stem cell-derived Schwann cell-like cells exhibit neurotrophic effects, via distinct growth factor production, in a model of spinal cord injury. Glia. 2010; 58:1118–32. 46. Hejcl A, Sedy J, Kapcalova M, Arboleda TD, Amemori T, Likavcanova-Masinova K, et al. HPMA-RGD hydrogels seeded with mesenchymal stem cells improve functional outcome in chronic spinal cord injury. Stem Cells Dev. 2010;19:1535–46. 47. Sasaki M, Radtke C, Tan AM, Zhao P, Hamada H, Houkin K, et al. BDNF-hypersecreting human mesenchymal stem cells promote functional recovery, axonal sprouting, and protection of corticospinal neurons after spinal cord injury. J Neurosci. 2009;29:14932–41. 48. Abrams MB, Dominguez C, Pernold K, Reger R, WiesenfeldHallin Z, Olson L, et al. Multipotent mesenchymal stromal cells attenuate chronic inflammation and injury-induced sensitivity to mechanical stimuli in experimental spinal cord injury. Restor Neurol Neurosci. 2009;27:307–21.

49. Zurita M, Vaquero J, Bonilla C, Santos M, De Haro J, Oya S, et al. Functional recovery of chronic paraplegic pigs after autologous transplantation of bone marrow stromal cells. Transplantation. 2008;86:845–53. 50. Brass LM. Bone marrow for the brain? Exp Neurol. 2006; 199:16–19. 51. English D, Klasko SK, Sanberg PR. Elusive mechanisms of ‘stem cell’-mediated repair of cerebral damage. Exp Neurol. 2006;199:10–15. 52. Li Y, Chopp M. Marrow stromal cell transplantation in stroke and traumatic brain injury. Neurosci Lett. 2009;456:120–3. 53. Chopp M, Mahmood A, Lu DY, Li Y. Mesenchymal stem cell treatment of traumatic brain injury. J Neurosurg. 2009; 110:1186–7. 54. Li Y, Chen J, Chen XG, Wang L, Gautam SC, Xu YX, et al. Human marrow stromal cell therapy for stroke in rat: neurotrophins and functional recovery. Neurology. 2002;59: 514–23. 55. Nandoe RD, Hurtado A, Levi AD, Grotenhuis A, Oudega M. Bone marrow stromal cells for repair of the spinal cord: towards clinical application. Cell Transplant. 2006;15: 563–77. 56. Garcia R, Aguiar J, Alberti E, de la Cuétara K, Pavon N. Bone marrow stromal cells produce nerve growth factor and glial cell line-derived neurotrophic factors. Biochem Biophys Res Commun. 2004;316:753–4. 57. Neuhuber B, Timothy HB, Shumsky JS, Gallo G, Fischer I. Axon growth and recovery of function supported by human bone marrow stromal cells in the injured spinal cord exhibit donor variations. Brain Res. 2005;1035:73–85. 58. Schuhmann B, Dietrich A, Sel S, Hahn C, Klingenspor M, Lommatzsch M, et al. A role for brain-derived neurotrophic factor in B cell development. J Neuroimmunol. 2005;163: 15–23. 59. Crigler L, Robey RC, Asawachaicharn A, Gaupp D, Phinney DG. Human mesenchymal stem cell subpopulations express a variety of neuro-regulatory molecules and promote neuronal cell survival and neuritogenesis. Exp Neurol. 2006;198: 54–64. 60. Yaghoobi MM, Mowla SJ. Differential gene expression pattern of neurotrophins and their receptors during neuronal differentiation of rat bone marrow stromal cells. Neurosci Lett. 2006;397:149–54. 61. Chen CJ, Ou YC, Liao SL, Chen WY, Chen SY, Wu CW, et al. Transplantation of bone marrow stromal cells for peripheral nerve repair. Exp Neurol. 2007;204:443–53. 62. Hokari M, Kuroda S, Shichinohe H, Yano S, Hida K, Iwasaki Y. Bone marrow stromal cells protect and repair damaged neurons through multiple mechanisms. J Neurosci Res. 2008;86:1024–35. 63. Karussis D, Kassis I, Kurkalli BG, Slavin S. Immunomodulation and neuroprotection with mesenchymal bone marrow stem cells (MSCs): a proposed treatment for multiple sclerosis and other neuroimmunological/neurodegenerative diseases. J Neurol Sci. 2008;265:131–5. 64. Zhukareva V, Obrocka M, Houle JD, Fischer I, Neuhuber B. Secretion profile of human bone marrow stromal cells: donor variability and response to inflammatory stimuli. Cytokine. 2010;50:317–21. 65. Shen LH, Li Y, Chopp M. Astrocytic endogenous glial cell derived neurotrophic factor production is enhanced by bone marrow stromal cell transplantation in the ischemic boundary zone after stroke in adult rats. Glia. 2010;58: 1074 –81. 66. Novikova L, Novikov L, Kellerth J-O. Brain-derived neurotrophic factor reduces necrotic zone and supports neuronal survival after spinal cord hemisection in adult rats. Neurosci Lett. 1996;220:203–6.

BMSC for spinal cord injury 67. Namiki J, Kojima A, Tator CH. Effect of brain-derived neurotrophic factor, nerve growth factor, and neurotrophin-3 on functional recovery and regeneration after spinal cord injury in adult rats. J Neurotrauma. 2000;17:1219–30. 68. Kobayashi NR, Fan DP, Giehl KM, Bedard AM, Wiegand SJ, Tetzlaff W. BDNF and NT-4/5 prevent atrophy of rat rubrospinal neurons after cervical axotomy, stimulate GAP-43 and Tα1-tubulin mRNA expression, and promote axonal regeneration. J Neurosci. 1997;17:9583–95. 69. Houle JD, Ye JH. Survival of chronically-injured neurons can be prolonged by treatment with neurotrophic factors. Neuroscience. 1999;94:929–36. 70. Ruitenberg MJ, Plant GW, Hamers FP, Wortel J, Blits B, Dijkhuizen PA, et al. Ex vivo adenoviral vector-mediated neurotrophin gene transfer to olfactory ensheathing glia: effects on rubrospinal tract regeneration, lesion size, and functional recovery after implantation in the injured rat spinal cord. J Neurosci. 2003;23:7045–58. 71. Tobias CA, Shumsky JS, Shibata M, Tuszynski MH, Fischer I, Tessler A, et al. Delayed grafting of BDNF and NT-3 producing fibroblasts into the injured spinal cord stimulates sprouting, partially rescues axotornized red nucleus neurons from loss and atrophy, and provides limited regeneration. Exp Neurol. 2003;184:97–113. 72. Liu Y, Himes BT, Murray M, Tessler A, Fischer I. Grafts of BDNF-producing fibroblasts rescue axotomized rubrospinal neurons and prevent their atrophy. Exp Neurol. 2002;178: 150–64. 73. Deumens R, Koopmans GC, Joosten EAJ. Regeneration of descending axon tracts after spinal cord injury. Prog Neurobiol. 2005;77:57–89. 74. Widenfalk J, Lipson A, Jubran M, Hofstetter C, Ebendal T, Cao Y, et al. Vascular endothelial growth factor improves functional

75.

76.

77.

78.

79.

80.

81. 82.

887

outcome and decreases secondary degeneration in experimental spinal cord contusion injury. Neuroscience. 2003;120: 951–60. Chen J, Zhang ZG, Li Y, Wang L, Xu YX, Gautam SC, et al. Intravenous administration of human bone marrow stromal cells induces angiogenesis in the ischemic boundary zone after stroke in rats. Circ Res. 2003;92:692–9. Wu S, Suzuki Y, Ejiri Y, Noda T, Bai H, Kitada M, et al. Bone marrow stromal cells enhance differentiation of cocultured neurosphere cells and promote regeneration of injured spinal cord. J Neurosci Res. 2003;72:343–51. Ankeny DP, McTigue DM, Jakeman LB. Bone marrow transplants provide tissue protection and directional guidance for axons after contusive spinal cord injury in rats. Exp Neurol. 2004;190:17–31. Himes BT, Neuhuber B, Coleman C, Kushner R, Swanger SA, Kopen GC, et al. Recovery of function following grafting of human bone marrow-derived stromal cells into the injured spinal cord. Neurorehabil Neural Repair. 2006;20:278–96. Ide C, Nakai Y, Nakano N, Seo TB, Yamada Y, Endo K, et al. Bone marrow stromal cell transplantation for treatment of subacute spinal cord injury in the rat. Brain Res. 2010;1332:32–47. Wright KT, El Masri W, Osman A, Roberts S, Chamberlain G, Ashton BA, et al. Bone marrow stromal cells stimulate neurite outgrowth over neural proteoglycans (CSPG), myelin associated glycoprotein and Nogo-A. Biochem Biophys Res Commun. 2007;354:559–66. Raisman G. Myelin inhibitors: does NO mean GO? Nat Rev Neurosci. 2004;5:157–61. Hofstetter CP, Holmstrom NA, Lilja JA, Schweinhardt P, Hao J, Spenger C, et al. Allodynia limits the usefulness of intraspinal neural stem cell grafts; directed differentiation improves outcome. Nat Neurosci. 2005;8:346–53.