New and Atypical Families of Type I Interferons in Mammals: Comparative Functions, Structures, and Evolutionary Relationships1

New and Atypical Families of Type I Interferons in Mammals: Comparative Functions, Structures, and Evolutionary Relationships’ R. MICHAELROBERTS? LIMINLIUAND ANDREIALEXENKO Departments of Veterinary Pathobiology and Animal Sciences University of Missouri Columbia Missouri 65211

...................

I. Interferon-w

11. Interferon-T . ................... 111. Comparison of Structures of IFN-w and IFN-Twith Other Type I Inter-

291 295

ferons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . N.Evolution of 1FNW and IFNT

304

MI. Is There a Human IFN-T? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VIII. Concluding Remarks References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

3 19

320

The concept of viral interference grew primarily out of experiments performed on chick allantoic membranes 40 or more years ago, when it was realized that tissue exposed to an inactivated influenza virus could resist a challenge from virulent live virus ( I , 2). Initially it was thought that the protective factor comprised only a single antiviral substance, for which the term “inter-

’

Abbreviations: b P - 1 , bovine trophoblast protein-1 (bovine IFN-T);CL, corpus luteum (or corpora lutea); GAF, gamma (interferon)activating factor; GAS, gamma (interferon)activating sequence; GM-CSF, granulocyte-macrophagecolony stimulating factor; IFN, interferon; IFNAR, interferon a/P receptor; lFNA, gene for IFN-a; ZFNB, gene for IFN-P; IFNT, gene for IFN-T;ZFNW, gene for Im-w; IGF, insulin-like growth factor; ISGFS, interferon-stimulated gene factor-3; ISRE, interferon-stimiulated response element; Jak, Janus kinase; MDBK, Madin-Darby bovine kidney (cells);o n - 1 , ovme trophoblast protein-1 (ovine IFN-7); PGFza, prostaglandin F2-; STAT, signal transducers and activators of transcription; tyk, tyrosine kinase. To whom correspondence should be addressed. Progress in Nucleic Acid Research and MolecularBiology, Val. 56

287

Copyright 0 1997 by Academic Press.

AU rights of repruductlon in m y form reserved 0079.6603197 $25.00

288

R. MICHAEL ROBERTS ET AL.

feron” was coined. It was not until the first interferon (IFN) cDNA and IFN genes were cloned in the early 1980s that the full complexity of the IFN system began to be appreciated, although attempts at purification and serological studies had earlier hinted that more than one active factor was present in the preparations from virally challenged cells (3). There are two distinct groups of IFN, type I and type I1 (Fig. 1)(4,5).The latter, better known as IFN-y, and once referred to as “immune interferon,” seems to be confined to mammals (Table I). In whatever species it has been studied, IFN-r has been encoded by a single gene containing three introns (5).IFN--y is a homodimeric molecule and bears little or no resemblance to huIFNARl

huIFNAR2a hulFNAKZb

FIG.1. The type I interferon signal transduction pathway. The figure summarizes what is known about type I IFN. The IFNARl receptor, originally cloned by Uzi: et aE. (24, has an exh-acellular structure consisting of four immunoglobulin-likedomains. The intracellular region associates with the tyke kinase and undergoes phosphorylation on IFN binding (P). The IFNAR2c receptor (the so-called long form) (23) can bind type I IFN directly. High-affinity binding requires both subunits. IFNAR2c associates with Jakl kinase. The STAT factors associate with the receptors by their SH2 domains and become phosphorylated on tyrosine residues. Once activated in this manner, they can associate with p48 to form the transcription factor ISGFS, which binds to the IFN-stimulated response element (ISRE) on type-I-responsive genes. STAT1 can also homodimerize. As such, it corresponds to GAF, the transcription factor activated by IFNy. The IFNARB receptor exists in two additional forms (a and b) as the result of alternative transcript splicing. The functions of these additional binding proteins are unclear. IF”AFt2a is soluble and was originally purified from urine (see 22).IFNAR2b is membrane spanning and was originallyidentified as the type I IFN receptor by Novick et al. (22),but has a different sequence, compared to IFNAR~c,in its cytoplasmic region. The representation does not preclude additional signal pathways, e.g., involving other STAT,nor does it rule out the presence of additional receptor subunits, possibly with subtype specificity.

289

NOVEL TYPE I INTERFERONS

TABLE I A SUMMARY COMPARISON OF TYPEI AND TYPEI1 INTERFERONS Type I1 IFN

Type I IFN

Feature Distribution

Mammals, birds, fish, and possibly amphibians and reptiles

Mammals only

Genes

(a) Multiple (b)lntronless

(a) Single (c)Three introns

Protein

Monomer

Dimer

Receptor

Two known subunits

Two known subunits

Signal induction Cell type for expression Stability

See Fig. 1 Many cell types

Jak STAT pathway

Stable at low pH

Unstable at low pH

T cells and a limited range of other cells, including pig trophoblasts

"See Section VI,B.

the single-chain type I IFN in primary structure. It also binds to its own spe-

cific receptor, and its actions are potentiated through a hstinct signal transduction pathway within its target cell (6, 7). Note from Fig. 1,however, that the signal transducer and activator of transcription (STAT1) factor provides a common element to both the type I and type I1 signaling pathways. As a phosphorylated homodimer [the gamma interferon activation factor (GAF)](7),it can bind to the gamma activating sequence (GAS) element on IFN-y-responsive genes, whereas as a component of interferon-stimulated gene factor 3 (ISGF3) [the heterotrimeric complex that binds the interferon-stimulated response element (ISRE)],it is involved in the transactivation of genes that are transcriptionally regulated by type I IFN. It is possibly for this reason that the biologcal activities of type I and type I1 IFN overlap. Genes that contain both GAS and ISRE elements are probably responsive to both types of IFN. The type I IFNs are a &verse group of molecules (Table 11).By about 1980, two major subtypes (IFN-a and IFN-P) had been recognized. In humans and mice, there is only a single gene for IFN-P (ZFNB),although cattle cany at least five (8,9).In contrast, there are multiple genes for IFN-a (IFNA) in all mammalian species so far examined (lo),including humans (11,12) and cattle (13,14).As discussed later, humans cany 13 ZFNA genes that are transcribed, and several additional pseudogenes (12). The multiplicity of type I IFN has raised to important questions regarding IFN function (15).First, do individual IFNs have special biological properties that equip them particularly well for certain roles? Second, are individual IFN genes induced differentially, so that a cell can provide an IFN

290

R. MICHAEL ROBERTS I X AL.

TABLE I1 TYPEI INTERFERONSOF CATTLE Subtype

>15

-5

-4a

-4-5

virus

virus

virus

UnknOWn

Cell of origin

Leukocytes and others

Fibroblasts and others

Leukocytes and others

Trophectoderm

Genes

Intronless

Intronless

Intronless

Intronless

Length of polypeptide sequence

166

166

172h

172

Number of genes Inducer

Percent sequence identity of IFN-a

100

-30

-75

-50

Antiviral activity

Yes

Yes

Yes

Yes

Antiproliferativeactivity

Yes

Yes

3

Yes

<'Threeto four genes a r detected ~ with a highly specific 3' cDNA probe, but at least 15 are detectable with a less specific,full-length probe (see Fig. 2) Additional genes related to IF"* probably exist. bHuman IFN-w is either 172 or 174 amino acids long.

response to a wide range of different pathogens and other external cues? If the answers to either of these questions are yes, there has likely been positive Darwinian selection operating on the IFNA genes, i.e., they have not assumed their individual sequence identities simply by random genetic drift. What also seems probable is that the IFNA genes have duplicated independently in different orders of placental mammals (10, 16). Therefore, if selection has driven ZFNA duplication and diversity, different mammals may not utilize their IFN-a for identical purposes. Despite the large numbers of type I IFNs and claims that some of them might have unique properties, only a single kind of type I receptor has so far been recognized (Fig. 1).Within a species, all known type I IFNs appear capable of binding to this receptor and competing with other type I IFNs for occupancy (17-20). The human receptor consists of at least two distinct subunits, IFNARl (21) and IFNAR2 (22,23). The former is sometimes referred to as the transducing subunit because it has little ability to bind IFN on its own. The second subunit, which occurs in several forms as the result of alternative splicing, is considered to be the primary binding subunit. Both may be required to provide high-affinity binding (29, and each forms at least one noncovalent association with a tyrosine kinase (Fig. 1). The two chains be-

291

NOVEL TYPE I INTERFERONS

come phosphorylated at specific tyrosines in their cytoplasmic regons following ligand binding to the extracellular domain of the receptor (25,26) and are then able to recruit STATl and STAT2 as substrates for the tyrosine kinases. Once STATl is phosphorylated, it can dimerize, creating GAF (6, 7). Alternatively, STATl heterodimerizes with STAT2 and then associates with the DNA-binding protein p48 to form ISGF3, which migrates into the nucleus and activates type-I-responsive genes (Fig. 1).The receptor complex thus functions as an adapter molecule, linking tyrosine kinases to potential transcription factors. Although type I IFNs are undoubtedly a primary line of defense against viruses, they are also pleiotropic cytokines capable of inducing a remarkably varied range of changes on their targets (4, 19). They form part of the complex regulatory network that controls the immune system and can also influence the growth, behavior, and metabolic activities of many kinds of nonimmune cells. To regard the IFN system as merely a response to infection would be a serious underestimation of much broader role in cellular homeostasis and development. Over the last decade it has become evident that the type I IFNs are an even more extensive family than was anticipated from the initial cloning studies. Screening of human and bovine cDNA and genomic libraries under nonstringent conditions revealed an entirely new subtype, serologically and structurally distinct from the IFN-a and -p. Although originally named IFNaII (II),the term IFN-w, coined by Hauptman and Swetly (27),is now recommended. IFN-w is the first of the atypical IFNs reviewed in this essay. In 1987, yet a different subtype was described. In this case, the IFN was the major secretory product of the trophoblast of preimplantation ovine embryos and functioned as a hormone of pregnancy. It has become known as IFN-T. Since that time other type I IFNs have been described, including ones from nonmammalian species. The purpose of this essay is to describe what is known about IFN-w and IFN-Tand related mammalian type I IFNs, and to discuss, as far as it is possible, their function. Wherever it is appropriate, we have made comparisons with the better known IFN-a and -p (Table 11).Finally, we speculate on the evolutionary origin and relationships among the various subtypes so far discovered.

I. Interferon-w

A. Discovery IFN-w was first described by Capon et al. (11)and Hauptman and Swetly (27) in 1985. The former screened human and bovine genomic libraries

292

R. MICHAEL ROBERTS ET AL.

under low-stringency conditions with huIFN-ol probes. Weakly hybridizing clones were isolated that represented novel type-I IFNs distinct from IFN-ol and -P. They were named IFN-a,,. Hauptman and Swetly used a similar strategy to screen a human lymphoma cDNA library, but named the novel IFN they discovered IFN-w. The latter designation is now accepted (28).The most unusual feature that sets IFN-w apart from the related IFN-ol is that it possesses an extension of six amino acids at the carboxyl terminus. A similar hexapeptide "tail" characterizes IFN-T (discussed in Section 11). Although IFN-w is believed to be widespread (29)(Fig. 2), it has not been extensively studied. (For a full discussion of IFN-o origin and species distribution, see Section IV.) HuIFN-w is readily induced by viruses in a wide range of cells, including peripheral blood leukocytes and lymphoma ceU lines (11, 27,30,31) and placental trophoblast cells (32).In the latter it is expressed simultaneously with IFN-p, but in leukocytes, where it constitutes about 15% of the antiviral activity induced by Sendai virus, it is partnered by a mixture of IFN-a.

B. Structure Recombinant huIFN-w has been produced in yeast (30),in insect cells by employing Baculovirms (33),in Escherichia coli (34,and in Chinese hamster ovary cells (34).A monoclonal antibody (31)raised against the bacterial form was used (34)to punfy IFN-w from the total mixture of IFN released by virally induced human leukocytes.Leukocyte IFN-w is a mixture of two formsa predwted 172-amino acid polypeptide with a cysteine at position 1, and a longer 174-aminoacid form with a 2-amino acid extension at the N terminus that has been proposed to arise by aberrant cleavage by signal peptidase (35, 36).The two are othenvise identical and are probably transcribed from a single functional gene. HuIFN-wl possesses a single N-linked complex biantennary carbohydrate chain on Asn-78 (Asn-80 in the long form) and has a molecular weight calculated from SDS-PAGE of 24,500 (35, 36). Little information is available about the stability of huIFN-w. Unlike IFN-a, it has been suggested that huIFN-w is denatured at low pH (37),but this observation has not been reconciled with several purification procedures in which an acid treatment step is incorporated to precipitate contaminating proteins (27, 32, 35).

C . Genes The IFN-w genes (ZFNW) are believed to have diverged from the ZFNA 116 to 132 million years ago (10, U ) ,i.e., well before the establishment of eutherian mammals (see Section IV).Curiously, they have been reported to be absent from the dog DNA (38),and they have not so far been detected in rodents. However, they are found in diverse mammalian groups, including cat-

NOVEL TYFE I INTERFERONS

293

FIG.2. Genomic Southern blot analysis of gene distribution for IFNW genes (encoding IFN-w)and IFNT genes (encoding IFN-T)in a variety of mammalian species (zoo blots). DNA from each species (5-8 pg except from musk ox, where only 3 pg was utilized) was digested to completionwith restriction enzyme EcoRI, electrophoresed,and transferred to nylon membrane for hybridization. (A) Blot hybridized with a full-length oT€-1 cDNA probe, expected to recognize both IFNTand IFNW genes but not IFNA and ZFNB genes in a variety of species. (B) Same blot after it was stripped and hybridized with a full-length equine IFNW probe to see ifthe same pattern of genes was identified with this nonruminant IFN-w probe. (C) Duplicate blot hybridized with a specific IFNTprobe derived from the 3’ untrdnslated region of the oTp-1cDNA. This probe has been shown to recognize only IFNT genes in sheep and cattle, and was utilized to determine how widely distributed similar genes were in other mammalian species. Molecular sizes are indicated in kilobase pairs.

tle, goats and sheep (Ruminantia) (11,27,29,39-41), pigs (Suina) (42),horses (Perissodactyla) (43),rabbits (44),and humans (11, 12, 27, 34) (Fig. 2, A and B). In most cases, there appear to be multiple lFNW or ZFNW-related genes.

2 94

R . MICHAEL ROBERTS ET AL.

There is only a single functional gene for IFN-w in human DNA, although there are six pseudogenes (12).The single gene product is therefore IFN-wl. All the genes are located on the short arm of chromosome 9 in band 9p22-pl3 in association with the ZFNA (see Section V). As with all other type I genes, I F N W lacks introns and is believed to be about 2 kbp long. The I F W 1 transcript size is 1.2 kb ( f l ,27). The ZFNW from humans (11,27,32)and cattle (45)is virally inducible, but the viral response elements in the promoters have not been well-studied or well-defined. The genes are expressed simultaneously with certain IFN-a in peripheral leukocytes from human blood after the cells are exposed to virus (11, 31, 35, 36). Overexpression of interferon transcription factor 1 (IRF-1) will induce IFN-w as well as IFN-a and IFN-P from the transfected human genes in Cos-1 cells (46).These observations suggest that there may be features common to the promoter elements of all these type I IFNs.

D. Receptor HuIFN-w1 competes for binding to the common type-I receptor complex shared by IFN-a and -@ (20, 47). Antibodies against the ligand-binding subunit of this receptor block the antiviral activity of IFN-wl (25, 48). As with huIFN-a and IFN-p, huIFN-w binding to human cells induces tyrosine phosphorylation of the receptor subunits (25), the associated tyrosine kinases tyk2 and Jak-1,and the STAT components of the transcription factor ISGFS (26).It is presumably through this signaling pathway that IFN-w exerts its antiviral activity and an ability to up-regulate interferon-responsive genes (49, 50).As with the IFN-T, discussed in the next section, it remains to be seen whether IFN-w can trigger signaling pathways distinct from those utilized by other type I IFNs and unrelated to their antiviral activities. To date, there are no suggestions that IFN-o possesses properties that set it apart from IFN-a, but it would not be surprising to find that it does.

E. Function What then is the function of IFN-o? It appears to be no less potent than the commoner IFN-a in antiviral and antiproliferative activities (34,51)and is coinduced with IFN-a in leukocytes by virus. No unusual biological activity has yet been ascribed to it. As with IFN-a and IFN-@,it may prove to have value in controlling viral hepatitis and chronic papillomavirusinfections (52), in limiting progression of certain kinds of tumor, or in alleviating autoimmune conditions (53).The type I IFNs are now widely used in treatment of many diseases of humans and animals. Conceivably, IFN-w may find a special niche among these therapies.

295

NOVEL TYPE I INTERFERONS

II. Interferon-.r

A. Identification of the Antiluteolytic Factors in Cattle and Sheep as a Type I IFN IF“-? was discovered as a result of efforts to identify a factor released from ovine and bovine embryos prior to embryonic attachment to the uterine wall; the factor of interest was responsible for “rescuing” the corpus luteum during early pregnancy (54, 58).A failure to prevent the normal cyclic regression of this ovarian structure results in a decrease in serum progesterone concentration and a subsequent inability of the uterine endometrium, a progesterone-responsive tissue, to support the continued growth and development of the fetus and its membranes. The mechanism that preserves corpus luteum function in these ruminant species is totally unlike that found in the human and higher primates, wherein the hormone, chorionic gonadotropin, is released by the invading trophoblast tissue, enters the maternal bloodstream, and acts directly via receptors on the luteal cells to promote continued progesterone synthesis (59).In cattle and sheep, and probably in all related ruminant ungulates, including goats, deer, antelopes, and giraffes (29), the antiluteolyhc factor produced by the embryo acts locally on the uterus rather than directly on the corpus luteum and, by mechanisms still not understood, prevents the pulsatile release of the luteolyhc hormone prostaglandin F,a, whose action on the corpus luteum normally causes luteal cell death and leads to the initiation of a new ovarian cycle (58, 60). The pregnancy factor responsible for preventing luteolysis was identified by culturing preimplantation sheep embryos flushed from the uterine lumen of pregnant ewes in medium supplemented with radioactive amino acids (55).Two-dimensional electrophoresis identified several isoforms of a protein of M , approximately 20,000 that was produced transiently in the period immediately preceding firm attachment of the trophoblast (preplacenta) to the uterine wall. Small amounts of this protein, known originally as ovine trophoblast protein-1 ( o n - 1 ) (61), or trophoblastin (54), were purified and shown to be capable of extending estrous cycle length when introduced into the uterine lumen of nonpregnant ewes. Parallel experiments in cattle revealed a protein (bT€-1)immunologically related to oT€-1, but slightly larger (57).The difference in size of the two proteins is now known to be due to the presence of a single asparagine-linked carbohydrate chain, present on bV-1 but missing on oTP-1 (62-64).

B. Structure Molecular cloning of oTP-1 and bTP-1 cDNA showed that both were represented by multiple mRNA copies of length approximately 1 kb (63-67).

296

R . MICHAEL ROBERTS ET AL.

The open reading frames encoded polypeptides 195 amino acids long, which included a 23-amino acid signal peptide. Surprisingly,both trophoblast proteins showed a clear structural resemblance to known type I IFN. For example, there was an approximately 50% degree of amino acid sequence identity to IFN-u and -30% to IFN-p. However, the greatest similarity was to the IFN-w (-75%), and, like the latter, the trophoblast IFN had an extension of six amino acids at the carboxyl end relative to the IFN-u and -6.The four cysteines involved in intrachain disulfide bridges in IFN-u (1 --+ 99; 29 + 139) were conserved, and hydrophobicity/hydrophilicityplots for IFN-a, -w, oTP1 and bTP-1 were barely distinguishable (68). That oT€-1and bTP-1 were indeed IFNs was confirmed by showing that they possessed just about every activity expected of this class of protein (see 58). They have, for example, potent antiviral activity and antiproliferative properties (58, 69);they can activate natural killer cells (70)and can up-regulate a variety of IFN-responsive genes (71, 72).As discussed in Section II,C, IFN-Twill compete with IFN-u for binding to a common type I receptor on uterine endometrium and other tissues, and can activate both STAT-l-containing factors ISGF-3 and GAF (D.Leaman, A. Alexenko, K. Cox and R. M. Roberts, unpublished results). Initially, the trophoblast IFNs were considered to be variant forms of IFN-o (63-66), but they were sufficiently dissimilar in structure and immunogenicity to be given a separate subtype designation (28).Their trophoblast-specific expression, lack of viral inducibility, and the unique promoter regions in their genes (see Section II,D) reinforced the view that they were indeed a distinct subtype of type I IFN.

C. Binding of IFNT to the Type I Receptor Among the first indications that the antiluteolybc product produced by the sheep embryo is an interferon was its ability to compete with huIFN-a2 for binding to an apparently common receptor (73).This competition between subtypes has since been confirmed for both endometrial tissues and cultured Madin-Darby bovine kidney (MDBK) cells (58, 74-77) (Fig. 3). Both boIFN-a1 and boIFN-.r had similar affinities for the receptors (-3.5 X 10- A4) on bovine endometrium, and the binding data were consistent with the presence of only a single receptor class (75).Affinity cross-linkinganalysis also revealed a major receptor-ligand complex, with a M , around 130,000 (Fig. 3). Treatment of the cross-linked polypeptide-IFN with N-glycosidase decreased its apparent M,. to -75,000. Thus, the receptor polypeptide had a mass of -55 kDa. Most likely this polypeptide is the “long form” of the ligand-binding subunit (IFNAR2)of the type I receptor known to be capable of binding IFN-a, -p, and -w (23)(Fig. 1). The binding and cross-linkingdata obtained with boIFN-.r on bovine en-

NOVEL TYPE I INTERFERONS

297

FIG.3. Electrophoretic analysis of cross-linked [1251]boIFN-~land [12JI]boIFN-cy1complexes with polypeptides in bovine endometrial membranes and MDBK cells. (A) 20 ng of iodinated IFN was bound (18 hr, 4°C) and cross-linked to either bovine e n d o m e ~ amembranes l or to MDBK cells in the presence of either 0 or 400 ng of the alternative IFN. After immunoprecipitation, the IFN-bound complexes were analyzed by eleckophoresis in 7.5% polyacryamide gels. (B) 20 ng of [1251]boIFN-~1 was bound (18 hr, 4°C) and cross-linkedto IFN receptors on MDBK cells (2 X lo7 cells per reaction) in the presence of either 0 (lane 1)or 500 ng (lane 4)of unlabeled boIFN-71. The complex was analyzed in either the presence (lane 1)of the absence (lane 2) of 6-mercaptoethanol (BME).The complex was also digested with (N-glycosidase F (lane 3). Arrows indicate positions of main radioactive bands. The IFN-Tused, recombinant (r) boIFN-rY2, is genetically engineered IFN-Twith additional tyrosine (Y) residues near the carboxyl terminus, allowing it to be readily iodinated (75).

dometrium contrasts with observations made on the interaction of a mixture of naturally occurring OVIFN-T (74) and recombinant boIFN-.r (77) with ovine e n d o m e t d membranes. With such combinations of ligand and receptor, at least one additional cross-linked band of -95,000 is obseived. The identity of this complex is unclear because it seems to be too small to represent the other subunit (IFNAFU) of the type I receptor (21, 78);possibly it is an accessoryprotein associated with the receptor complex. Why cross-linking to ovine receptor reveals this second band whereas bovine cells and tissues do not is puzzling, but the difference probably reflects the relative distribution of reactive amino groups on both the ligand and the polypeptides with which the ligand associ-

298

R . MICHAEL ROBERTS ET AL.

FIG.4. Expression of IFN-TmRNA (a and b) and actin mRNA (c and d) in day 12 ovine conceptuses during the initial period of elongation. Sections were prepared from a single day 12 conceptus (86).In situ hybridization was performed with a 35S-labeled probe specific for the 3’ nntranslated region of an IFN-TDNA or for y-actin. (a and c) Sections are stained with toluidine blue and are viewed (b and d) by dark-ground illumination. The open arrow shows the embryonic disk; the closed arrow shows the trophectoderm. The solid arrowhead indicates extraembryonic endoderm that detached from the trophectoderm during tissue processing; bar = 100 pm. Note the low signal for IFN-TmRNA hybridization over the embryonic disk and endoderm, but high silver grain density over trophectoderm (b).By contrast, aciin mRNA is present in all cell types (d).This figure was prepared by Charlotte Farin.

ates. Similar complex cross-linking patterns have been observed with certain human IFN-a subtypes in their binding to particular cells (79, 80).

D . Trophoblast-specif ic Expression Perhaps the most unusual feature of IFN-Tis its massive and apparently constitutive expression in the outer epithelial layer (trophectoderm) of the de-

NOVEL TYPE I INTERFERONS

299

veloping placenta during the days precedmg attachment of the embryo to the uterine wall (81, 82) (Fig. 4). The trophectoderm forms as the cavitating blastocyst develops from a ball of cells constituting the morula at approximately day 7 of pregnancy in cattle and sheep. As the blastocele cavity expands, two cell types become evident, a cluster of what appear to be undifferentiated cells constituting the inner cell mass, whch ultimately gives rise to the embryo proper, and the trophectoderm, a polarized epithelium responsible for pumping fluid into the blastocoelic cavity. A layer of extraembryonic endoderm also quickly grows out from the inner cell mass and attaches to the inner surface of the trophectoderm. About this time (day 8), the blastocyst, which is only about 150 pm in diameter, hatches from the acellular sheet (zona pellucida) that encloses it, but rather than attaching to the uterine wall, as does the human or mouse blastocyst, it continues to be free-floating and to expand until it reaches a diameter of a millimeter or more (82) (Fig. 4).

300

R. MICHAEL ROBERTS ET AL.

This sphere of cells then grows and elongates. Within 3 to 4 days, it can reach 10-15 cm in length and occupy most of the uterine lumen. However, it remains only loosely associated with the uterine wall and, with care, can be flushed out in intact form (55).By day 17 in sheep and by days 19-20 in cattle, definitive attachment is evident and invasive binucleate cells present in the trophectoderm begin to invade the uterine epithelium (83). IFN-Tsecretion first occurs as the blastocyst starts to expand and then to hatch (84, 85). It is also about this stage that IFN-T mRNA can be detected by reverse transcription polymerase chain reaction (PCR) (85).Expression per cell is low in these early blastocysts but increases markedly just prior to when the conceptus begins its elongation (58, 81, 86) (Fig. 4). This increase in expression could be prompted by factors released by the maternal endometrium (84).For example, the cytokines GM-CSF (87) and IL-3 (88)and the insulin-like growth factor 1 (IGF-1)(89) have been reported to increase IFN-Tproduction by cultured ovine conceptuses. IFN-Ttranscripts are confined to the mononucleate cells of the trophectoderm, and expression quickly falls as attachment begins (90). At its zenith, at about day 15, production of IFN-Tfrom a single ovine conceptus can produce well over 200 pg in a 24-hr period of in vi&o culture (91). There seems to be no comparable system whereby type I interferons are produced in such quantity. Amounts must far exceed those that are required to saturate type I IFN receptors present in the tissue abutting the uterine lumen. Possibly a low-affinity receptor is required for antiluteolyhc function. Alternatively, the action of IFN-Tmay not be strictly local, although there is no convincing evidence that it enters the peripheral blood circulation of pregnant ewes in appreciable quantity. Perhaps the best explanation is that the embryo must declare its presence when it is quite small, possibly when it is only beginning to elongate and occupying only a fraction of the full uterine lumen. In order to increase its sphere of influence to the rest of the uterine endometrium at a time when the corpus luteurn is wavering on the verge of regression in anticipation of prostaglandin F2a(F'GF,,) release from the uterus, it is crucial that the embryo produces the antiluteolytic factor in large amounts. The apparently excessive production a few days later (see 58)may be merely an outcome of this early commitment to signal vigorously to the mother. This pattern of expression contrasts sharply with that associated with expression of IFN-a, -p, and o,whose genes are normally quiescent and activated only in response to viral infection. The induction of IFN-a and -p expression by virus requires only about 120 bases beyond the site of transcriptional initiation and depends on many minienhancer sites that provide a flexible and graded response to virus and various modulating stimuli (92-99). A variety of transcription factors bind to this region and have been implicated in the IFN response. By contrast, the genes for IFN-T have pro-

NOVEL TYPE I INTERFERONS

bTP-1 oTP-p7

- 400

-380

-

301

-

-360

-340

TGAGTGACTCTGCATTCCTATGTGTAAGATAAGGAGGGAAAAATGCAGTTAAGAATCAATGGAAAATTATATTCC

...G ................................................. -320

-300

G..........G....

- 280

- 260

bTP-1 OTP-p7

TGACATAAGATAAACAAAAGGAATGTTTATATATATTATACCTA TAATAACTATGTACACATCTA . . .T ..................... ..................................................

bTP-1 oTP - p 7

TAAG

-180

bTP-1 oTP-p7

bTP- 1 oTP-P~

~

200

-140

-160

CAA

-120

ACCCA$~~FEK+AAAATTAAATTTCTACTGTAAAAATTAAGP$-+C . T . . . . . . . . . . . . . . . . . . .G . . . . C . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . T . . . . . . . .

-

-100

bTP-1 OTP-p7

- 220

- 240

CTTACATAACT TCAGCCTT$~-$I$-ATA ......... C ..... G . . . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . .

I

-

-80

-

-

- 60

- 40

AACAGAAAATATCTAACTGAAAACACAAACAGGAAGTGAGAGAGAAATTTTCGGATAATGAGTACCGTCTTCCC .GT .......G . . . . A . .................... G .................................

m

- 20

TATTTAAAAGCCTTGCTTAGAACGATCATC

......................

C...G..

FIG.5. Nucleotide sequences of a bovine and an ovine IFN-T gene 5' of the start site for fmnscription. Differences between the two genes are few and are indicated in the appropriate position on the ovine gene sequence. Several base sequence motifs are illustrated. G A A A " motifs (where N is any nucleotide) are underlined by thick, solid bars; decamers similar to those that bind the Ant gene product are in open boxes, and octamers resembling those that bind the Oct-3 gene product are in bold letters. Sequences similar to those that bind IRF-1 and IRF-2 are highlighted by a narrow bar above the line. The TATA box is underlined. Numbers indicate the number of bases from the transcription start site. Note that bTP and oTP are terms previously used to refer to bovine and ovine IFN-T, respectively.

moter regions that are highly conserved up to approximately 400 bp beyond the transcription start site (29, 200) (Fig. 5). Although there is limited similarity to other type I genes within the proximal regions of these promoters, most of the general features that apply to the transcriptional regulation of other type I IFNs, including viral induction, seem not to pertain to IFN-T.Indeed, it seems that it is the promoters of lFNT that, more than any other feature, set these genes apart from all other type I IFNs.

E. Transcriptional Regulators Study of the transcriptional regulation of IFN-Thas been considerably hampered because there are currently no well-defined trophoblast cell lines

302

R. MICHAEL ROBERTS E T AL.

available from cattle or sheep to study IFN-Texpression in vitro. Fortunately, human choriocarcinoma cells, such as JAr, are competent to support constitutive IFN-Tpromoter activity from transfected reporter genes and presumably contain a complement of transcription factors compatible with IFN-7 expression (101, 102), despite the apparent absence of ZFNT genes in human DNA (see Section VII) and the fact that these cells, when cultured normally and in the absence of virus, do not display expression of any other type I IFN. Transient transfection experiments with JAr cells suggest that two distinct promoter regions are required for full constitutive expression (101, 102). One, proximal to position - 126, appears to be necessary for basal ex. pression, whereas a more distal region (-280 to 400) seems to be an enhancer. Electrophoretic mobility-shift assays employing nuclear extracts from ovine embryos prepared during the period of maximal IFN-T expression are consistent with the above transfection assays. For example, a proximal region (-69 to 91) (Fig. 5) was defined that formed high-mobility cornplexes with nuclear proteins from day 15 embryos. These complexes could not be disassociatedby competition with a 100-fold molar excess of DNA derived from the same region of an ZFNW gene promoter. In addition, a single complex, specific for the time in which IFN-T expression was maximal, was formed in association with the -322 to -358 (distal) region of the promoter. The association of transcription factors with these regions is presently being examined by using the yeast single-hybrid system. Between the - 120 proximal region and the distal enhancer region there is a domain of -200 nucleotides that can b e deleted without influencing expression (102).This region also fads to form complexes with nuclear proteins in electrophoretic mobility-shift assays, yet is well-conserved across species and contains several decamers identical or closely related to the sequence ATITAATTGA (Fig. 5). The latter corresponds to the recognition sequence most favored by the horneodomain regions of products of the Antennupedia (an@)locus of Drosophilu (see 100). A second homeodomain protein engruited (en)binds the same 10-base sequence, although its recognition sites seem generally to be found in the opposite orientation relative to the direction of transcription-that is, TCAATIAAAT. The presence of these binding sites has suggested that homeodomain factors might be involved in regulation of possibly silencing IFN-Texpression during early development.

F. Production of IFN-7 and Its Value in Medicine and Agriculture

IFN-T(known originally as ovine trophoblast protein-1, or oTP-1)was first purified as a mixture of isoforms from the medium after culturing ovine conceptuses in vitro (55).Purification involved DEAE ion-exchange and gel-filtration chromatography.A protein, now known to be identical to IFN-WOTP-

NOVEL TYPE I INTERFERONS

303

I, and called trophoblastin, had previously been identified in extracts of sheep embryos (54). Although IFN-Tis the principal secretory product of the preimplantation embryo, purification from this source yields only small amounts of product, depends on access to pregnant ewes, and requires surgical intervention. As a consequence, various procedures for producing recombinant product have been pursued. IFN-T has, for example, been synthesized in amounts sufficient for large-scale experimental animal testing in E. coli (103-104) and yeast (105, 106).The products are active in all in vitro tests for type I IFN and have the ability to extend estrous cycle length in both sheep and cattle (1015-107). Recombinant IFNs may have value as fertility agents for livestock (58,82, 108, 109). A significant proportion of pregnancies are believed to be lost in mammals because the embryo fails to signal its presence significantly robustly at the time that the corpus luteum (CL) is poised on the verge of regression. Administering IFN-7 to pregnant ewes or cows by intramuscular injection may serve to rescue embryos that are lagging in development and are otherwise destined to be lost. Experiments utilizing boIFN-a supplied by CIBA-GEIGYillustrated the potential of this procedure for improving pregnancy success in sheep (108, 109),but not in cattle (110),wherein the injections caused pronounced hyperthermia and flulike symptoms (110-112). One other drawback of the procedure is that it might override a maternal mechanism for selecting “good” embryos. However, experiments so far have not indicated any increase in frequency of abnormal lambs born to ewes treated with IF”? during the penod of maternal recognition of pregnancy (108, 109). . The IFN-Tmay have other properties that make it attractive for pharmaceutical purposes. It has been reported to be much less cytotoxic than IFNa and hence likely to exert fewer side effects in treatment of autoimmune and inflammatory diseases and even cancer (53,113-115). On the other hand, it seems improbable that ovine or bovine IFNs will be used for human therapy because they are hkely to evoke an immune response. Therefore, the reported existence of a human IFN-T(116)has raised expectations that this IFN might be a valuable therapeutic agent (53,115).However, as discussed later, the existence of such an IFN-7 still remains in doubt.

G. Do the IFN-T Possess Unique Function? The question has been posed as to whether IFN-T possesses special biological features that enable it to act as a pregnancy hormone or whether it is effective as a result of being produced in the right place, at the right time, and in quantities sufficient to fulfill its function. Evidence is accumulating that IFN-Tis more efficient at extendmg estrous cycle length than is IFN-a (see 58), and may be able to induce expression of one or more unique en-

304

R. MICHAEL ROBERTS ET AL.

dometrial proteins that are not up-regulated by IFN-a (117, 118).There are precedents for believing that different type I IFNs might differ in their relative activities. For example, huIFN-a8, unlike other huIF'N-a tested, has no ability to activate natural killer (NK) cells (19,119).Similarly,antiviral and antiproliferative properties of various IFN-a subtypes are not necessarily wellcorrelated (120).Human cells lacking the tyk2 component of the signal transduction pathway cannot undergo an antiviral response to IFN-a, but can still do so when treated with IFN-P (121).Also, huIFN-a and huIFN-P cause different phosphorylation patterns in the interferon receptor and its associated kinases (122),despite competing with each other for receptor binding. These differences are often quite subtle but have been difficult to reconcile with the presence of a common type I receptor. One explanation is that several signal transduction pathways, which are differentially activated by binding of different ligands, emanate from the receptor. Another is that there are subtype accessory polypeptides associated with the receptor complex that trigger different phosphorylation or second-messenger cascades within the target cell.

111. Comparison of Structures of IFN-w and IFN-7 with Other T-pe I Interferons

A. Primary and Secondary Structures Only in cattle have genes for all four type I subtypes (a,P, o and T) been cloned and sequenced, thereby permitting full pairwise comparisons to be made (9, 11, 13, 14)(Table 111).There is a report of an ZFNT in human DNA TABLE 111 PAIRWISE COMPARISONS OF AMINO ACIDSEQUENCES AMONG TYPEI INTERFERONFROM CATTLE N

N

IFN subtype

GenBank accession no.

1

2

3

4

5

6

7

29.8 34.8 50.0 46.3 73.9

27.7 34.2 49.5 45.7 72.8 97.4 -

Similarity (Oh)

~~~

1 2 3 4 5 6

7

IFN-p

IFN-p

IFN-a IFN-(Y IFN-w IFN-T 1m-T

M15477 M15478 MllOOl M29314 M11002 M60913 M31557

84.4 -

28.8 31.5 -

-

29.8 31.5 92.6

-

28.3 33.2 53.2 50.0 -

-

-

NOVEL TYPE I INTERFERONS

305

(116), but the nucleotide sequence of the cDNA more resembles that of O V F W (94% identity) than of OVIFN-T(86% identity). A comparison of the bovine sequences indicates that the boIFN-.r exhibits about 50,30, and 75% amino acid sequence identity to the bovine IFN-a, -p, and w identity, respectively (Table 111).These values are consistent with the view that the ZFNT diverted from the Z F W relatively recently (see Section IV). Compared with IFN-a, both IFN-w and IFN-T have six amino acid extensions at their carboxyl termini. It is unclear how this tail originated, but it may have occurred by a frameshift or a mutation in the stop codon. Comparison of the six extra codons on IFN-Tand IFN-w with the proximal end of the 3' UTR of IFN-a is not particularly revealing in this regard, most probably because of the length of time that has passed since the genes diverged. It is unclear whether the extra length of IFN-w and IFN-T has any functional signhcance. Figure 6 provides an alignment of selected IFN-a, -w, and -7. Each structure is based on five major regons of a-helix (helices A, B, C, D, and E). The refinement of the original mouse IFN-p structure (123)shows that it contains an additional short helix (CD) (124).Because this structure appears to be conserved in IFN-T(1251, it is likely to be ubiquitous. IFN-T and IFN-w generally possess the conserved cysteines characteristic of IFN-a at positions, 1, 29, 99, and 139, although there are several exceptions. In human IFN-wl, which possesses an additional two residues at its amino terminus (35, 36), these cysteines would be Cys3, 31, 101, and 141. Similarly,porcine IFN-o has a deletion of five amino acids between residues 113 and 117, so that the conserved cysteines are 1,29,99, and 134. Such minor changes in the primary sequence, including the two above, probably do not interfere with the formation of the two disulfide bonds analogous to 1-99, and 29-139 generally considered to be typical of all IFN-a (226,127) and IFN-w (34).The C y ~ ~ ~ - Cdisulfide y s ' ~ ~is essential for biological activity in huIFN-a (128-230),whereas the 1-99 bond seems less important (131). Mouse IFN-P lacks both disulfides, but an engineered cysteine, equivalent to Cys29-Cys139in huIFN-a, increases its antiviral activity 10-fold (132). All IFN-T and most IFN-w have an additional Cys at 86 in the center of helix C, and both bovine (bo)and giraffe (gi) IFN-Thave a Cys at 64 in helix B as well (Fig. 6). Residues at 64 and 86, which are present on the antiparallel helices B and C, respectively, may be sufficiently close to each other to permit formation of an additional disulfide bond (see Section IILB). In the case of gdFN-7, which lacks an equivalent of Cys-99, this bond could provide the second stabilizing disulfide, substituting for 1-99. Several other IFN-T also possess a sixth cysteine, but not at position 64 (Fig. 6), and these residues are unlikely to be positioned appropriately to interact with Cys-86. Dog IFN-a has a Cys at 69, which has been suggested to form a third dsul-

hum-w

I

HelixA

Helix C

Helix D

C

FIG.6. An alignment of selected type I IFNs (ci,w, and T) showing the regions of (Y helix (for IFN-T)and the relative positions of cysteine (C) and proline (P) residues. Capitalized letters indicate f d conservation; lower case, italicized letters indicate residues that are not fully conserved. Numbers indicate amino acid residue. Abbreviations: hu, human; bo, bovine; ca, caprine (goat);eq, equine; gi. giraffe; PO, porcine; ra, rabbit.

NOVEL TYPE I INTERFERONS

307

fide bond ( C y ~ ~ ~ - C(38), y s but ~ ~ its ) existence has not been confirmed experimentally (38). In addition to comparing the distribution of cysteines among IFNs, Fig. 6 also provides the locations of prolines. As expected, prolines are generally found in nonhelical regions or at the end of helices. Pro-55, found in helix B of some IFN-a and in some OVIFN-T, is an exception. The distribution of proline residues confirms that IFN-w are intermediate in structure between IFNa and IFN-T.Two prolines (at positions 26 and 39) are well conserved across all type I IFNs, whereas the one at position 4 (or 5 ) is generally common to IFN-a and IFN-o, and the one at 116 to IFN-w and IFN-T. The simultaneous presence of prolines at positions 4 and 9 in rabbit IFNw and in some ovine IFN-w strongly suggests that helix A must be shorter than the usual 4-20 residues in these molecules. Similarly, the absence of Pro4 in all IFN-7 probably ensures that the conformation of the IFN-Tamino terminus is different than that of either IFN-o or IFN-a. Although most huIFN-a do not carry an Asn-X-ThrISer consensus glycosylation site, many other type I IFNs, including most IFN-w and many IFNT , do have such a sequence, centered around Asn-78 (or its equivalent). In cases where it has been studied, cg., huIFN-wl (33, 34) and boIFN-.r (62), this asparagine is glycosylated. Despite the lack of N-glycosylation sites on many huIFN-a, there are repoi-ts that these molecules are glycoproteins (4, 133, 134), presumably at serine or threonine residues. It is unclear whether similar modifications occur on IFN-Tand IFN-w. However, the significance of such carbohydrate groups is unclear. Sugar chains may be important for stability, solubility, or in controlling circulating half-life. In general, however, bacterially produced and natural forms of these IFNs have comparable antiviral activities, although they are hkely to differ in antigenicity.

B, Th ree-dirnensionaI Structures Although crystals of IFN-a and IFN-P were reported well over a decade ago (135,136),they have not been of sufficient quality for X-ray crystal structure analysis. However, recombinant murine IFN-P did yield crystals that allowed its structure to be solved (123, 124).That success may stem from the lack of disulfide bonds in muIFN-P, thus obviating disulfide interchange reactions and the possibility of oligomer formation. The structural information on muIFN-P has allowed homology models for huIFN-a (137-139) and later for IFN-T(125,140)to be constructed. The basic feature, five a-helices and the Iong loop between helices A and B, is remarkably preserved in all three IFNs and is illustrated for muIFN-P and ov IFN-Tin Fig. 7. The short CD helix, recently demonstrated in the refined muIFN-P structure (123),also appears to be preserved, although it is somewhat shorter in OVIFN-T than in muIFN-P. BoIFN-T differs from muIFN-P in

308

R . MICHAEL ROBERTS ET AL.

FIG.7. Stereo overlay of the crystallographically determined structure of murine IF"-p (thin line) and the modeled structure of bovine IFN-T(thick line). Helix identifications A-E, as well as the N and C termini, are marked. The largest deviation in overlap occurs in loop AB (see text). The C-terminal "tail" part of IFNT could not be uniquely modeled. Cys residues that form disu6de bridges (Cysl-Cysg", C y ~ ~ W y sare l ~marked ~ ) by solid circles. From Senda et al. (125) with permission.

three additional respects. The first is the carboxyl tail,which extends nine residues beyond the terminus of muIFN-@and which therefore cannot be modeled. Its conformation relative to the rest of the structure is unknown, but it would have a length of -30A if fully extended (e.g., Fig. 7),but could possibly fold back over the body of the molecule rather than project downward as shown. A second difference is that IFN-T,as well as IFN-a and IFNa,has a three-amino acid insertion in loop AI3 and a likely disulfide bridge between Cys-29 in that loop and Cys-139 at the beginning of helix E. These features would almost certainly provide conformational differences between them and muIFN-@in a region of loop AB (Leu-22 to Arg-33) thought likely to interact with the receptor (see Section 111,C). A final difference is that all IFN-Tand most IFN-w possess a Gly at 126 in place of the normally conserved Arg at that position (125).In muIFN-@and huIFN-a, this Arg forms a hydrogen bond network with several residues in the distal end of the AB loop; this network probably stabilizes this rather unstructured region in its association with helix D. The Gly replacement at 126 would impair such in-

NOVEL TYPE I INTERFERONS

309

teractions and may provide more conformational flexibility to the loop of IFN-T. As mentioned earlier, boIFN-T and ~IIFN-TIhave cysteines at positions 64 and 86. Figure 8 illustrates that the side chains of these cysteines are positioned relatively close to each other and could be in an appropriate conformation during folding to form an additional disulfide bond.

C. Receptor-bindingSites A number of different approaches have been used to define the functionally important regions of type I IFN, including site-directed mutagenesis, limited proteolysis, construction of hybrid IFN molecules from the same or different species, competition with synthetic peptides, and antibodies directed toward particular surface epitopes (reviewed in 141, 142). Recent interpretations of such data applied to the structural models discussed above (Fig. 8) have defined certain “hot areas” on type I IFNs that would appear to be the most important regions for receptor binding, and include the central part of loop AB,helix D, and loop DE (138,141).In addition, it has been suggested that helix A and helix C also make primary contact with one or another of the two known receptor subunits (143).There may be other functionally important regions in addition. Site-directed mutagenesis of Lys-160 on IFN-T,for example, reduces antiviral activity on bovine cells by about 90% without greatly altering receptor-binding affinity (144).The amino terminus of IFN-Thas also been suggested to contribute to its biological activity (145, 146).One possibility is that the sequences on the distal end of helix E and the adjacent amino terminus (see Fig. 8) form a contact with a receptor subunit responsible for signal transduction, e.g., IFNARl or some other accessory polypeptide. As emphasized earlier, any unique biological activities that might distinguish IFN-T from IFN-u could possibly require an additional dedicated subunit.

IV. Evolution of lfNW and IFNT A. Coding Region Phylogenetic analyses the primary structures and gene sequences of type

I IFN show three main clusters in mammals: ZFNB, I F ” , and IFNW/T, wellseparated from the type I IFNs of birds and fish (10).ZFNB and ZFNA are

thought to have arisen by a duplication event occurring at least 250 million years ago (MYA) (4,147).Calculated values have varied, most likely because assumed mutational rates dlffer. The divergence occurred after the separation of the mammalian and avian linkages. What remains controversial is whether the different ZFNA genes duplicated independently from their prog-

99 C

FIG.8. The three-dimensional structures of bovine IFN-Trepresented in ribbon format. The diagram is based on a model of ovine

IFN-S4 (BrooWlaven data base; lovI), which was calculated from the atomic coordinates of murine IF"-p (124). The structures were prepared by using SYBYL 6.2 software (Tripos Inc., St. Louis, MO). Three views of the molecule are shown: from beneath (left), from above

(right),and a side view (middle).The carboxyl terminus (C)and the amino terminus (N) are shown. Because the most distal nine residues (relative to murine IFN-p) cannot be modeled, the carboxyl terminus here is -163 and is at the end of helix E. The IFN-Tis characterized by five major helices (A-E) and a smaller helix (CD),which is separated from helix C only by Pro-102. The positions of the two disulfides (1-99; 29-139) are shown. A possible third disulfide between Cys-86 and Cys-64 is illustrated and would connect helices B and C. As computed in the murine IFN-P, the distance between the cysteine side chains may be too great to permit such a bond.

NOVEL TYPE I INTERFERONS

311

enitor gene after the major eutherian orders diverged, or whether there were already multiple ZFNA genes in the earliest eutherian mammals (10, 148).A recent opinion (lo),based on comparison of all available human and rodent sequences available in 1995, favors the former hypothesis, i.e., duplication occumng late rather than early. The same controversy exists for IFNW. Multiple ZFNW genes have been identified in humans (12),cattle (11, 39), sheep (29, 40, 149),pig (42),horse (43),rabbit (44)and many other mammalian species (29)(see Fig. 2). If rates of mutational changes provide a clock, it has been calculated that ZFNW diverged from ZFNA prior to the divergence of placental mammals, between 116 and 132 MYA ( I f ) . A more recent calculation has given a value of 129 MYA (10).Curiously, ZFNW genes are absent from the dog (38)and have not been detected in rodents. Either these genes have been lost or ZFNW originated more recently than mutational rates predict. A more detailed analysis of the distribution and sequences of ZFNW genes among modem mammals must be undertaken before this question can be properly addressed. Hughes, in an analysis of type I genes, concluded that the ZFNW family failed to show species-specific clusters (10).He has suggested that duplication of ZFNW genes occurred relatively early and probably well before primates and Artiodactyla &verged. However, he failed to take into consideration that ZFNW and the recently evolved ZFNT genes are distinct subtypes. Moreover, his analyses did not include the extensive group of rabbit ZFNW genes (94). A follow-up determination by us shows that the sequence similarities of ZFNW genes from the same species are relatively high, and that there are, in fact, considerable differences between species. For example, there is over 96% nucleotide sequence conservation of the coding region among the cloned ZFNW genes in rabbits (44),over 92% in pigs (42),and about 94% in sheep (29, 40, 146). By contrast, pig and cattle IFNW genes show only about 83%identity. Again, there are two explanations. Recent duplications could have provided multiple genes of considerable similarity. Alternatively, frequent recombination events between homologous, but relatively ancient, genes may have continued to blend differences and prevent divergence within species. Examination of ZFNT genes also reveals species-specificclusters of genes (Fig. 9), although in this case there is also considerable conservation across species and clear differences between them and the IFNW genes of their own species (29, 58).These data strongly suggest that the IFNT genes arose relatively recently and that the duplication events occurred since the divergence from the ZFNW genes. Divergence in sequence provides a measure of evolutionary distance. When two genes diverged relatively recently from a common ancestor, the observed “distance” between two sequences is a reasonably accurate repre-

IFNT

FNW

HuIFNA

7

IFNA I

L lvhunl

~

FIG.9. A phylogenetic tree based on amino acid sequence identities for the type I IFNs from several different species. Protein sequences were obtained from the Swiss Protein, GenBank, and PIR data bases. The tree was established by doing a pairwise alignment that scores the similarity between every possible pair of sequences (UPGMA dendrogram; see 164).The sequences chosen for the analysis from a particular species were selected only if they differed by

NOVEL TYPE I INTERFERONS

313

sentation of the evolutionary dvergence between them. With time, more than one substitution event can occur at a single site and the observed distance has to be corrected appropriately (150). As a general rule, nucleotide substitutions at synonymous sites, ie., ones that do not alter the amino acid sequence, will be better tolerated than ones that alter primary polypeptide sequence and provide a better clock than ones occurring at nonsynonymous sites when short evolutionary time periods are involved. Table IV is a matrix of corrected &stances w i h the codmg repons of several representative ZFNW and ZFNT genes within the suborder Ruminantia. The calculations of average distances are based on the distances between d reported full-length sequences of ZFNT and ZFNW genes in the species listed. There is presently little evidence to support the presence of lFNT in the two other suborders of Artiodactyla (Suiformes and Tylopoda) (29).The distances between the ZFNTgenes of cattle (subfamilyBovinae) and those of sheep, goat, and musk ox (subfamilyCaprinae) average 10.9 per 100 bases calculated by the Kimura two-parameter method. It is generally accepted that the ancestors of the Bovinae and Caprinae diverged about 20 MYA (148).If it is assumed that the ZFNT genes evolved at the same rate in both lineages, the base substitution rate has been 0.271 2 0.004 per 100 bases per million years (MY).A quite similar substitution rate (0.275 2 0.008) can be calculated for the single ZFNT of the giraffe (familyGiraffidae),whose ancestors diverged from Bovinae approximately 24 MYA. If similar calculations are performed for the ZFW genes, the results are quite different. The substitution rate within Bovinae is 0.186 (* 0.015) over 20 MY and is 0.179 (+ 0.003) if the bovine and ovine ZFNW genes are compared with those of pigs (suborder Suiformes), whose ancestors diverged from the precursors of modem-day ruminants approximately 55 MYA. Clearly, the ZFNT genes are evolving almost 50% faster than the ZFNW genes, a feature that may be indicative of adaptive diversification within the IFN-T subtype. The results in Table lV confirm the view that IFN-T and IFN-o are distinct groupings despite their similarities in primary sequence. If the same base substitution rates noted in Table IV are assumed to have been maintained in the two sets of genes after they diverged from the common IFNTIIFNW ancestor, the branch point for the IFNT and IFNW genes occurred 36.5 ( 2 0.24) MYA. It predicts that the lFNT gene evolved from the l F W gene after the appearance of the suborder Ruminantia (45-48 MYA) more than 1%from each other. Each IFN is listed by its databank code identification and by its common name (bo, bovine; ca, goat; do, dog; fe, cat; pi, giraffe; mo, mouse; ov, ovine; ov mo, musk ox; PO, pig; ra, rat; rb, rabbit). Distances along the horizontal axis are proportional to the differences between sequences.

TABLE Jv DISTANCES BETWEEN NUCLEIC ACID SEQUENCES I N CODING REGIONS OF IFNT AND IFNW

IN

RUMINANTIA~

Coding regionb

1

2

3

4

5

6

7

8

9

10

11

12

1 OVIFN-wl 2 OvIFN-w2 3 OVIFN-U~ 4 BOIFN-wl 5 OvIFN-rl 6 GOIFN-71 7 OvIFN-72 8 MuIFN-T 9 BoIFN-71 10 BoIFN-72 11 BoIFN-73 12 CiIFN-7

0.00

5.87 0.00

6.06 6.61 0.00

7.37 6.43 8.51 0.00

17.14 16.92 17.33 17.35 0.00

18.23 18.00 17.97 18.22 1.91 0.00

16.68 16.91 16.43 16.47 3.68 3.50 0.00

17.34 17.34 17.06 17.80 6.62 6.05 4.59 0.00

16.56 15.92 16.96 16.57 11.68 12.28 10.88 12.11 0.00

15.71 15.49 16.11 16.14 10.69 11.27 9.89 11.11 1.03 0.00

16.96 16.32 17.14 17.43 11.87 12.46 11.06 12.29 1.91 1.55 0.00

16.33 18.35 18.26 18.36 14.18 15.23 13.34 15.30 11.61 10.82 11.99 0.00

=Distancesare number of substitutions per 100 bases calculated by the Kimura two-parametermethod (150)by using the Genetic Computer Group (Universityof Wisconsin) sequence analysis software package (Version 7.1).The access numbers for IFN used in this comparison are X59067 (OvIF’h-w2),M73245 (OvIFN-w3),M11002

(BoIFN-wl), X56345 (OVIFN-~l), M73243 (GoIFN-TI),X56346 (OvIFN-TZ),M73244 (MdFN-T),M31557 (RoIFN-T~), M31558 (BoIFN-~l), and M60913 (BoIFN-TZ). T from this laboratory. OvIFN-ol is from Charlier et al. (40) and G ~ I F N - is ’Ov, Ovine; Bo, bovine; Go, goat, Mu, musk ox; Gi, giraffe.

315

NOVEL TYPE I INTERFERONS

and before the radiation of the “true” ruminants (Pecora) (24 MYA) (148).The predction is fully in agreement with the experimental data that there are ZFNT in Bovidae and Giraffidae, but not in either pigs (suborder Suiformes) or llamas (family Camelidae, suborder Tylopoda) (29).A tree indicating evolutional relationships among representative ZFNA, l F W , and ZFNT genes is shown in Fig. 9.

B.

Promoter Region

The expression of the ZFNT gene is limited to the trophoblast of Ruminantia, and the genes are not inducible by virus. By contrast, the ZFNW genes are responsive to virus and are more generally expressed. Presumably these differences can be accounted for in the promoter regions of the respective genes. The first 130 bases of the promoter region of lFNT are highly conserved among sheep, goats, musk ox, cattle and giraffes (Fig. 10) (29; L. Liu, D. W. PoIFNW5 BoIRYWl

-133

OVIFNW3

w 1 m 1 OVIFNWZ IFNW Consensus IFNT c ~ n s e n s u s oVIFNT4 OVIFNT5

OvIFNT6 Calm?

hrm0IFN-I

WOIFNTC GilFNT

POIm-65 601FWii C.Jiir,i3

oViFWi oVIFN#2 IFKd Consensus IEET ~onsensus

oVIFNT4

oVIFNTS OVIFNT6 CaIFNT OvmalFNT BoIFNT4 GiIFm

-65

...%..G...

G . . . . . . . .C.U . . . . . . . . . . . . . . . C.... ..... C . .G......T.G.... . . . . .U . . . . . . . . . . .CG ............................... C . . . A . . C . . . . . . . . . . . . . . . .T.. . . . . .T. ................................ .ATT.G.... . . . . . TO.C . . ......................................... T.... T . . . . . . . . .....................................

............. ’..*.. ..

.

~ U C U T m C T I T G A C C U T A ~ X G ~ T U C U T ~ ~ ~ ~ ~ ~ ~ G T ~ G ~

.***

.* *.

*

tf. (I..

.. f

* .* .) I

f......

f

f

f

A C T A C U T T T C C T A C G T C R a x T U G ~ T A ~ T ~ ~ ~ C ~ C ~ ~ A ~ G ~ - - - - - ~ - U ~ ~ G

. . . . . .G . . . . . . . . . . . . . . . . . . G... . . . . . . . . . . . . . . . . G....-T . . . . . . . . . . . . . . . . . . . . . . .T . . . . . . . . .0.. . . . . . . . . . . . . . . . . . . .G ..................... . . . . .T.. . . . . . . . . .0 GT ..................... G. .. .............. G.G ...................... R ......................... . . . . . . . . . . . . . . . . .AC ............. c ....... u................ . . . . . . . . A , . . . . . . . . .T . . . . . . . . . . . A . . . . . . . . T.

-1

-66

. . .T . . . . . . . . . . . . . . . . . . . . . . . . . . . G.................... G..U. . . . . . . . . . . .c . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .c . . . ......................................... ......................................... c ................... . . . . c ............ C . . .................. U . . . . C ........... C .......

U

.............. ............. T

G

-

~

I

\

~

A

O

A

T

A

A

I

V

I

f

~

G

O

G

G......

M

r

r

J

....

T

C

L

D

C

A

T

..........................................

G

. . . .R.............R.T.................... .............................................. G

~

..... ..... ~

~

~

C

~

C

C

C...G..... U...T. . . .

~

R

~

C

~

A

~

~ ~

~ ~

0.

G.T . . .

FIG.10. Alignment of the putative promoter sequence for I F W and ZFNT genes. Caps (indicated by a dash) have been introduced into the sequences to provide optimal alignments.Sequences identical to those in the respective consensus sequences of ZFNW and ZFNT genes are indicated by dots. Nucleotides that differ between the consensusesofthe IFNW and IFNTgenes are marked by an asterisk. Po, pig; Bo, bovine; Ov, ovine; Ca, goat; Ov mo, musk ox;Gi, giraffe. The access numbers for IFNs used here are X57196 (PiIFN-w5),M11002 (BoIFN-wl),X59067 (OVIFN-we),M73245 (OVIFN-wS),M88771 (OVIFN-T~), M73241 (OVIFN-~5), M73242 (OVIFN-T~), M73243 (GoIFN-Tl),M73244 (MuIFN-T),and X65539 (BoIFN-74).OvIFN-wl is from Charlier d al. (40) and GiIFN-7 is from this laboratory (unpublished).

~ ~

~ A

U

~

~

C

R ~

316

R. MICHAEL ROBERTS ET AL.

TABLE V DISTANCES IN NUCLEOTIDE SEQUENCES Average distance (SEM)"

Promoter Coding region 3' UTR

50.78 2 0.78 16.69 It 0.11 43.97 t 0.75

9.02 ? 0.85 10.85 t 0.16 10.05 t 0.20

11.56 t 0.91 7.44 -+ 0.60 8.5aband 31.0

aDistances are number of substitutions per 100 bases calculated by the Kimura two-parameter method (150).Cattle sequences are compared to sheep, musk ox, and goat sequences to obtain the distances of IFN-T(IFN-TIIFN-T) and IFN-w (IFN-w/IFN-w)in Bovinae and Caprinae. Both intra- and interspecies comparisons are included in calculating the average distance between IFNT and I F N W within the family Bovidae. The promoter region used in the comparison is about 130 bp upstream of the transcription start site, and the 3' UTR is about 300 bp downsbeam of the stop codon. "The distance between the bovine IFNW and ovine l F N W 2 (8.58)was very different from that (31.0)between bovine I F N W and ovine I F N W I . The access numbers for IFN used in this comparison are M11002, M31557, M31558, M60908, M60913, M73241, M73242, M73243, M73244, M73245, M88771, M88772, X56342, X56345, X56346, X59067, and X65539. The sequences for IFNT and IFNW from Charlier et al. (40) are also included in the comparison; they are not in GenBank.

Leaman and R. M. Roberts, unpublished results). In cases where more extended regions of the promoters have been sequenced, conservation is evident up to about 400 bases beyond the transcription start site (see Fig. 5) and is then lost. The evolutionary distances between I F N T genes of Bovidae and Caprinae within the promoter region are quite close to those within the coding region (Table V). Thus, the regions are equally conserved and have evolved at similar rates. The I F N W promoters are also relatively well conserved, not only within these pecoran species, but between them and pigs (suborder Suiformes). Not unexpectedly, the rate of substitution has been somewhat higher in the promoter and 3' UTR than in the coding region, however (Table V). The promoter sequences of the I F N T and I F N W genes bear only a limited resemblance to each other (Fig. 10) and the calculated substitution rate (0.71 per 100 bases per MY) is improbably high. The actual substitution rate within the I F N T promoter over the 24 MY since the beginning of the pecoran radiation is quite modest (-0.23 per 100 bases per MY) and consistent with that within the coding region. It could not account for the dfferences between the I F N T genes and the I F N W genes. Presumably a more abrupt series of genetic changes, e.g., deletions and recombination events, in thepromoter region accompanied the first emergence of the IFNT gene as a distinct subtype. This acquisition of a unique promoter may have been the triggering

NOVEL TYPE I INTERFERONS

317

event that provided placental expression and negated viral inducibility of these genes. Surprisingly,the entire 3' UTR (-300 bp) of the IFNTgenes is conserved as the 5' UTR and the open reading frame (ORF) (Tablev). The average evolutionary distance (number of substitutions per 100 bases) between the 3' UTR of the IFNT gene of the Bovidae and Caprinae, for example, is only 10.05 -t 0.20. The 3' UTRs of the l F N T and I F N W genes share about 80% (range 74-83Oo) sequence identity over the first -120 bases beyond the stop codon, but then diverge markedly (<65%) further downstream. It is for this reason that probes prepared from the 3' UTR can be used for Southern genomic blotting to distinguish IFNT from ZFNW genes, whereas probes representing the ORF cannot (29) (Fig. 2). These observations strongly suggest that the duplication event that initially separated the I F N W and IFNT genes was initiated by acquisition, not only of a specialized promoter, but also of a unique region in the 3' end of the genes. It seems possible that the conserved 3' UTR of the IFNT gene plans some role in the control of IFN-T expression.

V. Chromosomal Location and Linkage of IFNW and IFNT Human I F N W genes are closely linked to the I F N A genes w i h n 400 kb of chromosome 9, but a single ZFNB gene is placed at the distal end of the cluster relative to the centromere (Fig. 11).There are seven ZFNW genes, but only one of them, the most dstal, is functional. Diaz et al. (12)have discussed in detail the likely way in which this locus evolved and have drawn attention to the placement of many of the ZFNW genes after pairs of I F N A genes. The most likely explanation is that the I F N W genes duplicated in tandem with one or possibly a pair of I F N A genes. Clearly there has been no positive selection to maintain functionality in the majority ofthe I F N W genes. By contrast, there are 13 apparently functional I F N A genes, one closely related pseudogene, and three additional type I pseudogenes with only limited resemblance to I F N A genes. It is unfortunate that the type I IFN locus of cattle has not yet been physically mapped to determine whether it is organized similarly to that of the human. Such an analysis would probably indicate whether the duplication events that provided the multiple I F N A and I F N W genes occurred after the diversification of the major mammalian orders. Certainly, the apparent absence of I F N W in the dog and in rodents might be more easily accounted for if there were only a single IFNA-IFNW-ZFNB gene cluster at the time the carnivores and rodent lineages separated from other eutherian mammals. The I F N W and I F N T genes of cattle have been localized to bovine chro-

318

R. MICHAEL ROBERTS ET AL. 50 kb

FIG. 11. Map ofthe IFN gene cluster showing the locations of the different IFN genes and pseudogenes as vertical bars. The arrowheads show the directions of transcription inferred for each gene. The gene for I F N W I , the only IFNW that is transcribed, is distally placed relative to the centromere (cen) and located between the genes for IFNa21 (ZFNASI) and IFN-p (IFNBI), which is closest to the telomere (tel).Pseudogenes are designated with a P, e.g., IFNWPIS and ZFNAP22. The IFN-related pseudogenes are designatedby open bars. From Diaz et al. (IZ),with permission

mosome 8, band 15, by fluorescent in situ hybridization with a full-length boIFN-.r cDNA probe (152).They are closely linked to the ZFNA gene. The genes have also been localized to the homologous chromosome banding region in river buffalo (3q15) (153),goat (8q15)(44, and sheep ( 2 ~ 1 5(41). ) Physical linkage of the type I IFN gene families in the bovine genome has been addressed in only an exploratory manner by hybridizing subtype-specific probes to large, endonuclease-restricted DNA fragments that had been separated by pulse-field gel-electrophoresis (154).A tentative order of the genes IFNkZFNW-IFNT-IFNB was inferred. If correct, it seems likely that the ZFNT genes form their own minicluster, separated from the ZFNAIFNW cluster.

VI. Other Atypical T p I Interferons A. The FNWVariant (IFNW,,,) of Sheep A type I IFN gene with such limited similarity to ovine ZFNW that it appeared to constitute a separate subtype has recently been described (155). However, another analysis (156) shows that the open reading frame of this gene and the first 423 nucleotides upstream of the start codon are almost identical to those of a gene for rabbit IFN-o (44).There seems little chance that the gene was discovered as the result of rabbit DNA contamination of the ovine genomic library from which it was cloned (156). Moreover, the ovine gene had a unique 3' UTR. Because the I F W n a Tgene had an intact ORF, it was possible to express

NOVEL TYPE I INTERFERONS

319

it in E. coli. Curiously, this IFN had very low antiviral activity on bovine and goat cells but relatively normal activity on sheep and rabbit cells. One possibility is that the lFNW,,, gene was acquired by interspecies transfer from rabbits, possibly by a mechanism involving a virus. It will be important to determine whether this gene is closely linked to the true ovine I F N W genes.

B. The Short Type I Interferon (spl) Expressed by Pig Trophoblast In the period immediately preceding attachment of the pig trophoblast to the uterine wall, the conceptus begins to produce a mixture of type I and type I1 (IFN-7) interferons (157-160). There is no evidence that these IFNs play an analogous role to the IFN-T of cattle, i.e., preventing regression of the corpus luteum and ensuring continued progesterone production. Their function in early pregnancy remains unknown, although it seems likely that they influence the local immune system of the mother. conceivably they play some role in modulating immune and inflammatory responses at the uterine-placental interface. Low-stringency screening of a day 14-15 pig conceptus cDNA library with a porcine IFN-w probe allowed the type I IFN to be identified (161).This IFN is highly unusual. It is 149 amino acids long and is only distantly related to other type I IFNs (159) (Fig. 9). Nevertheless, it binds to the type I receptor (162) and has antiviral activity in the range expected for a type I porcine IFN. This activity is not neutralized by any of the common antisera available against other type I IFNs (161).The gene for this short porcine IFN lacks obvious viral response elements, and, like the ZFNT gene, appears not to be virally inducible. It seems reasonable to conclude that the short porcine IFN represents yet another type I subtype. It is unclear how widely it is represented in other mammals, although it is seemingly of relatively ancient origin (Fig. 9) and might be expected to be ubiquitous.

VII. Is There a Human IFN-T? The cloning of a cDNA from a human term placental cDNA library that encoded an IFN with close similarity to ovine and bovine IFN-Thas been reported (116). In situ hybridization indicates that the gene is expressed primarily in cytotrophoblast. This discovery raises some interesting questions regardmg the origin of the IFNT gene, because it implies that these genes arose much earlier in mammalian evolution than had been inferred from phylogenetic trees based on gene and protein sequences (58,161) (Fig. 9). As discussed in Section II,F, this report has raised considerable interest because of the prospects for using IFN-Tin treatment of human disease, includmg mul-

320

R. MICHAEL ROBERTS ET AL.

tiple sclerosis (115)and AIDS (103).Despite the initial cloning (116)and the unpublished observation that there may be as many as seven human IFNT genes (cited in 115),there are reasons to suspect that such genes may not exist. Careful analysis of the inferred amino acid sequence (116) shows that it most resembles that of bovine or ovine ZFNW (89-87Oo) rather than bovine or ovine IFNT (72-75Oo). Moreover, no such gene has been identified in the 400-kb region encompassing the type I IFN locus on human chromosome 8 (12).Attempts in this laboratory to isolate the gene either by screening a human genomic library with IFNT probes or by PCR amplification from human DNA with specific oligonucleotide primers based on the published huIFN-T sequence (116) have given only genes corresponding to a human I F N W p.Ezashi, J. Bixby and R. M. Roberts, unpublished results). Finally, the nucleotide sequence conservation between the putative human gene and that of present day ZFNW and IFNT genes of Ruminantia appears much higher than could be expected for species that diverged >65 M A .

VIII. Concluding Remarks The information reviewed here shows that the type I IFNs are considerably more diverse than was originally suspected at the time the first IFN-or and IFN-P were being identified and their genes and cDNA were cloned. Almost certainly, the headcount is not yet complete, and other IFN or IFN-like molecules will emerge. A second conclusion that can be drawn from the studies on IFN-T,in particular, is that some type I IFNs are produced without the stimulus of disease and can direct normal developmental processes. These IFNs might well be curiosities,restricted as they are to establishment of pregnancy in a rather narrow group of mammals, but they may reflect a mainstream function for IFN as developmental regulators. ACKNOWLEDGMENE We thank Jim Bixby for assisting with the sequence alignments, Charlotte Farin for supplying Fig. 4, Toshihiko Ezashi for unpublished work on the human “tau”genes,and Gail Foristal for assembling the manuscript.The work was supportedby NIH Grant HD21896.

REFERENCES 1 . W. Henle,]. Zmmunol. 64,203 (1950). 2. A. Isaacs and J. Lindenman, ROC. R. SOC.Lond. (Biol.) 147,258 (1957).

NOVEL TYPE I INTERFERONS

321

3. W. E. Stewart 11, “The Interferon System.” Springer-Verlag, Berlin and New York, 1979. 4. E. DeMaeyer and J. DeMaeyer-Guignard,“Interferons and Other Regulatory Cytokines.” Wiley, New York, 1988. 5. M. A. Farrar and R. D. Schreiber, Annu. Rev. lmmunol. 11,571 (1993). 6, J. E. Darnell, J. M. Kerr and G. R. Stark, Science 264, 1415 (1994). 7. K. S h u i C. M. Horvath, L. H. T. Huang, S. A. Qureshi, D. Cowburn and J. E. Darnell, Cell 76,821 (1994). 8. V. Wilson, A. J. Jeffreys, P. A. B e e , P. G. Boseley, P. M. Slocombe, A. Easton and D. C. Burke,JMB 166,457 (1983). 9. D. W. Leung, D. J. Capon and D. V. Goeddel, Bio/Tahnology, May, 458 (1984). 10. A. L. Hughes,J. Mol. Evol. 41,539 (1995). 11. D. J. Capon, H. M. Shepard and D. V. Goeddel, MCBioZ 5,768 (1985). 12. M. 0. Diaz, H. M. Pomykala, S. K. Bohlander, E. Maltepe, K. Malik, B. Brownstein and 0. I. Olopade, Genomics 22,540 (1994). 13. B. Velan, S . Koben, H. Grosfield, M. Lieter and A. Shafferman,JBC 260,5498 (1985). 14. P. D. Chaplin, G. Entrican, K. I. Gelder and Fi. A. Collins, J. Interferon Cyt. Res. 16, 25 (1996). 15. N. B. Finter,J. Inte?feron Res. (specialissue), 185 (1991). 16. T. Miyata and H. Hayashida, Nature (London) 295,165 (1982). 17. A. A. Branca and C. Baglioni, Nuture (London)294, 768 (1981). 18. J. A. Langer and S. Pestka, bnniunol. Today 9,393 (1988). 19. S. Pestka, J. A. Langer, K. C. Zoon and C. E. Samuel ARB 56,727 (1987). 20. I. Flores, T. M. Mariano and S. Pestka,JBC 266,19875 (1991). 21. G. UzC, G. Lutfalla and J. Gresser, Cell 60,225 (1990). 22. D. Novick, B. Cohen and M. Rubinstein, Cell 77,391 (1994). 23. P. Domanski, M. Witte, M. Kellum, M. Rubinstein, R. Hackett, P. Pitha and 0. R. Colamonici,JBC 270,21616 (1995). 24. D. Russell-Harde,H. Pu, M. Betts, R. N. Harkms, H. D. Perez andE. Croze,JBC270,26033 (1995). 25. L. C. Platanias, S. Uddin and 0. R. Colomonici,JBC 269, 17761 (1994). 26. S. Uddin, A. Chamdin and L. C. Platanias,JBC 270,24627 (1995). 27. R. Hauptmann and P. Swetly, NARes 13,4739 (1985). 28. G. Allen, M. 0. Diaz, N. B. Finter, G. R. Adolf, J. Doly, E. Lundgren, S. Pestka, R. M. Roberts, D. Testa and J. Wietzerbin,J. lnterjimon Res. 14,223 (1994). 29. D. W. Leaman and R. M. Roberts,J. interferon Res. l2,1(1992). 30. G. R. Adolf,J. Gen. Virol.68, 1669 (1987). 31. G. R. Adolf, Virology 175,410 (1990). 32. G. Aboagye-Mathiesen,F. D. Toth, C. Juhl, N. Norskov-Lauritsen,P. M. Petersen,V. Zachar and P. Ebbesen, J. Gen. Virol. 72, 1871 (199 1). 33. T. Voss, E. Ergalen, H. Aborn, V. Kubelka K. Sugiyama, I. Maurer-Fogy and J. Glossl, EJB 217,913 (1993). 34. G. Fi. Adolf, B. Fruhbeis, R. Hauptmann, I. Kalsner, I. Maurer-Fogy, E. Ostermann, E. Patzelf, R. Schwendenwein, W. Sommergruber and A. Zophel, BBA 1089,167 (1991). 35. G. R. Adolf, I. Maurer-Fogy,I. Kalsner and K. Cantell,JBC 265,9290 (1990). 36. H. Shirono, K. Kono, J. Koga, S. Hayashi, A. Matsuo and H. Hiratani, BBRC 168,16 (1990). 37. P. Kontsek, L. Borecky and M. Novak, Virology 18l, 416 (1991). 38. A. Himmler, R. Hauptmann, G. R. Adolf and P. Swetly,J. lnterferan Res. 7,173 (1987). 39. T. R. Hansen, D. W. Leaman, J. C. Cross, N. Mathialagan, J. A. Bixby and R. M. Roberts, JBC 266,3060 (1991).

322

R. MICHAEL ROBERTS ET AL.

40. M. Charlier, D. Hue, M. Boisnard, J. Martal and P. Gaye, Mol. Cell. Endoninol. 76, 161 (1991). 41. L. Iannuzzi, G. P. DiMeo, D. S. Gallagher, A. M. Ryan, L, Ferrara and J. E. Womack, J. Heredity 84,301 (1993). 42. D. Mege, F. Lefevre and C. LaBonnardGre,J. Znt&eron Res. 1 1 341 (1991). 43. A. Himmler, R. Hauptmann, G. R. Adolfand P. Swetly, DNA 5,345 (1986). 44. M. Charlier, R. L‘Haridon, M. Boisnard, J. Martal and P. Gaye, J. Interferon Res. 13,313 (1993). 45. J. C. Cross and R. M. Roberts, PNAS 88,3817 (1991). 46. T.Fujita, Y.Kimura, M. Miyamoto, E. C. Barsoumian and T. Taniguchi, Nature (London) 337,270 (1989). 47. P. Benoit, D. Maguire, I. Plavec, H. Kocher, M. Tovey and F. Meyer, J. Immunol. 150,707 (1993). 48. P. Eid and M. G. Tovey, 1.Znt&mon Cytokine Res. 15,205 (1995). 49. S. Y. Hwang, P. J. Hertzog, K. A. Holland, S. H. Sumarsono, M. J. Tymms, J. A. Hamilton, G. Whitty, I. Bertoncello and I. Kola, PNAS 92, 11284 (1995). 50. M. A. Meraz, J. M. White, K. C. F. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. KapIan, J. K. Riley, A. C. Greedund, D. Campbell, K. Carver-Moore,B. N. DuBois, R. Clark, M. Aguet and R. D. Schreiber, Cell 84,43 1 (1996). 51. M. Kubes, N. Fuchsberger and P. Kontshek,J. Interferon Res. 14,57 (1994). 52. N. B. Finter, Biotherupy 7,151 (1994). 53. H. M. Johnson, F. W. Bazer, B. E. Szente and M. E. Jarpe, Sci. Am. 270,68 (1994). 54. J. Martal, M. C. Lacroix, C. Loudes, M. Saunier and S. Wintenberger-Torres,J.Reprod. Fertil. 56,63 (1979). 55. J. D. Godkin, F. W. Bazer, J. Moffatt, F. Sessions and R. M. Roberts, J. Reprod. Fertil. 65, 141 (1982). 56. F. F. Bartol, R. M. Roberts, F. W. Bazer, G. S. Lewis, J. D. Godkin and W. W. Thatcher, B i d . Reprod. 32,681 (1985). 57. S. D. Helmer, P. J. Hansen, R. V. Anthony, W. W. Thatcher, F. W. Bazer and R. M. Roberts, J. Reprod. Fertil. 79, 83 (1987). 58. R. M. Roberts, J. C. Cross and D. W. Leaman, Endocrine R m . 13,432 (1992). 59. J. P. Hearn, G. E. Webley and A. A. Gidley-BairdJ. Reprod. Fertil. 92,497 (1991). 60. W. W. Thatcher, M. D. Meyer and G. Danet-Desnoyers,J. Reprod. Fertil. Suppl. 49, 15 (1995). 61. J. D. Godkii, F, W. Bazer, W. W. Thacher and R. M. Roberts,J. Reprod. Fertil. 7 I, 57 (1984). 62. R. V. Anthony, S. D. Helmer, S. E Sharif, R. M. Roberts, P. J. Hansen, W. W. Thatcher and F. W. Bazer, Endocrinology 123,1274 (1988). 63. K. Imakawa, R. V. Anthony, M. Kazemi, K. R. Marotti, H. G. Polites and R. M. Roberts, Nutwe (London)330,337 (1987). 64. K. Imakawa, T. R. Hansen, P.-V. Malathy, R. V. Anthony, H. G. Polites, K. R. Marotii and R. M. Roberts, Mol. Endocrinol. 3,127 (1989). 65. M. Charlier, D. Hue, J. Martaland P. Gaye, Gene 77,341 (1989). 66. H. J. Stewart, S. H. E. McCann, A. J. Northrop, G. E. Lamming and A. P. F. Flint, J. Mol. Endocrinol. 2,65 (1989). 67. S. W. Klemann, K. Imakawa and R. M. Roberts, NARes 18,6724 (1990). 68. R. M. Roberts, C. E. Farin and J. C. Cross, in “Oxford Reviews of Reproductive Biology” (S. R. Milligan ed.), Vol. 12, p. 147. Oxford University Press, London, 1977. 69. A. Assal-Meliani, G. Charpigny, P. Reinaud, J. Martal and G. Chaoat, J. Reprod. Zmmunol. 25,149 (1993). 70. W. Tuo, T. I. Ott and F. W. Bazer, Am]. Reprod. Zmmunnol. 29,26 (1993).

NOVEL TYPE I INTERFERONS

323

71. H. J. Stewart, F. M. Guesdon, J. H. Payne, B. Charleston, J. L. Vallet and A. P. Flint, J. Reprod. Fertil. Suppl. 45,59 (1992). 72. B. Charleston and H. J. Stewart, Gene 137, 327 (1993). 73. H. J. Stewart, S. H. E. McCann, P. J. Barker, K. E. Lee, G. E. Lamming and A. P. F. Flint,J. Endorrinol. 115, R13 (1987). 74. T. R. Hansen, M. Kazemi, D. H. Keisler, P. V. Malathy, K. Imakawa and R. M. Roberts,J. Inte7feron Res. 9,215 (1989). 75. J. Li and R. M. Roberts,JBC 269,13544 (1994). 76. P. S. Subramaniam,S. A. Khan, C. H. Pontzer and H. M. Johnson, PNAS 92,12270 (1995). 77. J. Li, Ph.D. Thesis, University of Missour-Columbia (1994). 78. E. Mouchel-Vielh, G. Lutfalla, K. E. Mogensen and G . UzB, FEBS Lett. 313,255 (1992). 79. 0.R. Colamonici, L. M. Pfeffer, F. D’Alessandro, L. C. Platanias, S. A. Gregory,A. Rosolen, R. Nordan, R. A. Cruciani and M. 0. Diaz,J. Immunol. 148,2126 (1992). 80. L. C. Platanias, L. M. Pfeffer, R. Cruciani and 0. R. Colamonici,J. Immunol. 150, 3382 (1993). 81. C. E. Farin, K. Imakawa and R. M. Roberts, Mol. Endocrinol. 3,1099 (1989). 82. R. M. Roberts, BioEssays 13,121 (1991). 83. F. B. F. Wooding, Placenta 4,527 (1983). 84. J. J. Hernandez-Ledezma, N. Mathialagan, C. Villanueva, J. D. Sikes and R. M. Roberts, Mol. Reprod. Dev. 36, 1 (1993). 85. J. J. Hernandez-Ledezma,J. D. Sikes, C. N. Murphy, A. J. Watson, G. A. Schultz and R. M. Roberts, Biol. Reprod. 47,374 (1992). 86. C. E. Farin, K. Imakawa, T.R. Hansen, J. J. McDonneU, C. N. Murphy, P. W. Farin and R. M. Roberts, Biol. Reprod. 43,210 (1990). 87. K. Imakawa, S. D. Helmer, K. P. Nephew, C. S. R. Meka and R. K. Christenson, Endocrinology 132,1869 (1993). 88. K. Imakawa, K. Tamura, W. J. McGuire, S. Khan, L. A. Harbison,J. P. Stanga, S. D. Helmer and R. K. Christenson, Endocrine 3,511- (1995). 89. Y. KO, C. Y. Lee, T. L. Ott, M. A. Davis, R. C. M. Simmen, E W. Bazer and F. A. Simmen, Biol. Reprod. 45, 135 (1991). 90. M. Guillomot, C. Michel, P. Gaye, N. Charlier, J. Trojan and J. Martal, Bid. Cell 68, 205 (1990). 91. C. J. Ashworth and F. W. Bazer, B i d . Reprod. 40,425 (1989). 92. H. R a g and C. Weissman, Nuture 303,439 (1983). 93. N. J. MacDonald, D. Kuhl, D. Maguire, D. Naf, P. Gallant, A. Goswamy, H. Hug, H. Bueler, M. Chaturvedi, J. de la Fuente, H. Ruffner, F. Meyer and C. Weissman, Cell 60, 767 (1990). 94. W. Du, D. Thanos and T. Maniatis, Cell 74, 887 (1993). 95. M. Miyamoto, T. Fujita, Y. Kimura, M. Maruyama, H. Harada, Y. Sudo, T. Miyata and T. Taniguchi, Cell 54,903 (1988). 96. H. Harada, T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata and T. Taniguchi, Cell 58,729 (1989). 97. M. J. Lenardo, C.-M. Fan, T. Maniatis and D. Baltimore, Cell 57,287 (1989). 98. N. B. Raj, W. C. Au and P. M. Pitha,JBC 266,11360 (1991). 99. D. Thanos and T. Maniatis, Cell 83, 1091 (1995). 100. R. M. Roberts, D. W. Leaman, J. J. Hernandez-Ledezma and N. C. Cosby, in “Trophoblast Cells: Pathways for Matemd-Embryonic Communication,” (M. J. Soares, S. Handwerger and F. Tdamantes, eds.), Chap. 14, p. 206. Springer-Verlag, Berlin and New York, 1993. 101. J. C. Cross and R. M. Roberts, PNAS 88,3817 (1991). 102. D. W. Leaman, J. C. Cross and R. M. Roberts, Mol. Endocrinol. 8,456 (1994).

3 24

R. MICHAEL ROBERTS ET AL.

103. S. W. Klemann, J. Li, K. lmakawa, J. C. Cross, H. Francis and R. M. Roberts, Mol. Endocrinnol. 4, 1506 (1990). 104. J. Li, A. P. Alexenko and R. M. Roberts, Protein Expression Pu& 6,401 (1995). 105. J. Martal, E. Degryse, G. Charpigny, N. Assal, P. Reinaud, M. Charlier, P. Gaye and J. P. Lecocq, J, Endocrinol. 127, R5 (1990). 106. T. L. Ott, G . Vanheeke, H. M. Johnson and F. W. Bazer, J . Interferon Res. ll, 357 (1991). 107. K. D. Niswender, J. Li, K. R. Loos, M. R. Powell, R. M. Roberts, D. H. Keisler and M. F. Smith, Biol. Reprod. Suppl. 50,89 (1994)(abstract). 108. K. P. Nephew, K. E. McLure, M. L. Day, S. Xie, R. M. Roberts and W. F. Pope,]. Anim. Sci. 68,2766 (1990). 109. T. K. Schalue-Francis,P. W. Farin, J. C. Cross, D. Keisler and R. M. Roberts,]. Rqrrod. Fertil. 91,347 (1991). 110. C. M. Barros, J. G. Betts, W. W. Thatcher and P. J. Hansen,]. Endorrinol. 133,175 (1992). 111. G. R. Newton, S. Martinod, P. J. Hansen, W. W. Thatcher, B. Siegenthaler, C. Gerber and M.-J. Voir01,J. Dairy Sci. 73,3439 (1990). 112. M. D. Meyer, P. J. Hansen, W. W. Thatcher, M. Drost and R. M. Roberts,J. Dairy Sci. 78, 1470 (1995). 113. C. H. Pontzer, F. W. Bazer and H. M. Johnson, Cancer Res. 51,5304 (1991). 114. F. W. Bazer and H. M. Johnson, Am. ]. Reprod. Immunol. 26,19 (1991). 115. J. M. Soos, P. S. Subramaniam, A. C. Hobeika, J. Schiffenbauer and H. M. Johnson, J. Immuno.?.155,2747 (1995). 116. A. E. Whaley, C. S. R. Meka, L. A. Harbison,J. S. Hunt and K. Imakawa,JBC 269,10864 (1994). 117. B. R. Rueda, K. A. Naivar, E. M. George, K. J. Austin, H. Francis and T. R. Hansen,]. Interferon Res. 13,303 (1993). 118. K. A. Naivar, S. K. Ward, K. J. Austin, D. W. Moore and T. R. Hansen, Biol. Reprod. 52, 848 (1995). 119. J. R. Ortaldo, R. B. Herberman, C. Harvey, P. Osheroff, Y. C. E. Pan, B. Kelder and S. Pestka, PNAS Sl, 4926 (1984). 120. R. Hu, Y. Gan, J. Liu, D. Miller and K. C. Zoon,JBC 268,12591 (1993). 121. L. Velazquez, M. Follous, G. R. Stark and S. Pellegrini, Cell 70,313 (1992). 122. C. Abramovich, L. M. Shulman, E. Ratovitski, S . Harroch, M. Tovey, P. Eid and M. Revel, EMBOJ. 13,5871 (1994). 123. T. Senda, T. Shimazu, S. Matsuda, G . Kawano, H. Shimizu, K. T. Nakamura and Y. Mitsui, E M B O ] . ll, 3193 (1992). 124. T. Senda, S.-I. Saitoh and Y. Mitsui,JMB 253,187 (1995). 125. T. Senda, S . 4 . Saitoh,Y. Mitsui,J. Li and R. M. Roberts,]. Interferon Cytokine Res. 15,1053 (1995). 126. R. Wetzel, Nature (London)289,606 (1981). 127. N. B. Lydon, C. Fawe, S. Bove, 0. Neyret, S. Benureau, A. M. Levine, G. F. Seelig, T. L. Nagabhushan and P. P. Trotta, Bchem 4,4131 (1985). 128. H. Morehead, P. D. Johnston and R. Wetzel, Bchem. 23,2500 (1984). 129. G. J. Waine, M. J. Tymms, E. R. Brandt, B. F.Cheetham and A. W. Linnane, J. Intaferon Res. E , 4 3 (1992). 130. M. W. Beilhartz, 1. T. Nisbet, M. J. Tymms, P. J. Hertzog and A. W. Linanne,]. Interferon Res. 6,677 (1986). 131. I. T. Nisbet, M. W. Beilharz, P. J. Hertzog, M. J. Tymms and A. W. Linnane, Biochem. Int. 11,301 (1985). 132. C. Day, B. Schwartz, B.-L. Li and S. Pestki+J. Intmjieron Iies. 12,139 (1992).

NOVEL TYPE I INTERFERONS

325

133. K. C. Zoon, D. Miller, J. Bekisz, D. zur Nidden, J. C. Enterline, N. Y. Nguyen and R. Hu JBC 267,15210 (1992). 134. G. R. Adolf, I. Kalsner, H. Ahorn, I. Maurer-Fogy and K. Cantell, BJ 276, 511 (1991). 135. D. L. Miller, H. Kung and S. Pestka, Science 215,689 (1982). 136. S. Matsuda, G. Kawano, S. Itoh, Y. Mitsui and Y. Iitaka,JBC 26%16207 (1986). 137. N. J. Murgolo, W. T. Windsor, A. Hruza, P. Reichert, A. Tsarbopoulos, S. Baldwin, E. Huang, B. Pram&, S. Ealick and P. P. Trotta, Proteins, Struct. Funct. Genet. 17, 62 (1993). 138. A. P. Kom, D. R. Rose and E. N. Fish,J. Interferon Res. 1 4 , l (1994). 139. M. H. Seto, R. N. Harkins, M. Adler, M. Whitlow, W. B. Church and E. Croze, Protein Sci. 4, 655 (1995). 140. M. A. Jarpe, H. M. Johnson, F. W. Bazer, T. L. Ott, E. Curto, N. R. Knshna and C. H. Pontzer, Protein Eng. 7, 863 (1994). 141. Y. Mitsui, T. Senda, T. Shimazu, S. Matsuda and J. Utsumi, Pharmacol. Therap. 58, 93 (1993). 142. P. Kontsek, Acta Virol. 38,345 (1994). 143. G. UzB, G. Lutf da and K. E. Mogensen,!. Znterferon Cyt. Res. 15,3 (1995). 144. J. Li and R. M. Roberts, JBC 269,24826 (1994). 145. D. H. Pontzer, T. L. Ott, E W. Bazer and H. M. Johnson, PNAS 87,5945 (1990). 146. C. H. Pontzer, T. L. Ott, F. W. Bazer and H. M. Johnson, J. Znte7feron Res. 14,133 (1994). 147. D. Gillespie, E. Pequignot and W. E. Carter, in “Handbook of Experimental Pharmacology” (P. E. Came and W. A. Carter, eds.), Vol. 71, p. 45. Springer-Verlag,New York, 1984. 148. D. Gillespie and W. Carter,!. Znterferon Res. 3,83 (1983). 149. K. P. Nephew, A. E. Whaley, R. K. Christenson and K. Imakawa, Biol. Reprod. 48, 768 (1993). 150. M. Kimura,J. Mol. E d . 16, 111 (1980). 151. M. M. Miyamoto, F. Kraus, P. J. Laipis, S. M. Tanhauser and S. D. Webb, in “Mammal Phylogeny” (F. S. Szalay, M. J. Novacek and M. C. McKenna, eds.), p. 268. Springer-Verlag, Berlin and New York, 1993. 152. A. M. Ryan, D. S. Gallagher and J. E. Womak, Cytogenet. Cell Genet. 6 3 , 6 (1993). 153. L. Iannuzzi, D. S. Gallagher, A. M. Ryan, 6 .P. DiMeo and J. E. Womack, Cytogenet. Cell Genet. 62,224 (1993). 154. A. M. Ryan and J. E. Womack, Aninul Genet. 2 4 , 9 (1993). 155. A. E. Whaley, R. S. Carroll and K. Imakawa, Gene 106,281 (1991). 156. L. Liu, D. W. Leaman, J. A. Bixby and R. M. Roberts, BBA 1294,55 (1996). 157. J. C. Cross and R. M. Roberts, Biol. Reprod. 40, 1109 (1989). 158. M. A. Mirando, J. P. Hamey, S. Beers, C. H. Pontzer, B. A. Torres, H. M. Johnson and F, W. Bazer,!. Reprod. Fertil. 88, 197 (1990). 159. F. Lefkvre, F. Martinat-Botte, M. Guillomot, K. Zouari, B. Charley and C. LaBonnardiBre, EurJ.hnmunol. 20,2485 (1990). 160. C. LaBonnardiBre, F. Martinat-Botte, M. Terqui, F. Lefkvre, K. Zowari, J. Martal and E W. Bazer,!. Reprod. Fertil. 91,469 (1991). 161. F. Lefkvre andV. Boulay,JBC268,19760 (1993). 162. P. D. Niu, F. LefBvre and C. LaBonnardikre, J. Interferon Cyt. Res. 15,769 (1995). 163. N. DereuddreBosquet, P. Clayette, M. Martin, A. Mabondzo, P. Fretier, G. Gras, J. Martal and D. Dormont, J. Ac9. Zmmune Defic. Syndromes Human Retrouirol. 11,241 (1996). 164. P. H. A. Sneath and R. R. Sokal, in “Numerical Taxonomy,” p. 230. W. H. Freeman, San Francisco, 1973.