New methods for rapid detection of low-density lipoprotein receptor and apolipoprotein B gene mutations causing familial hypercholesterolemia

Clinical Biochemistry, Vol. 28, No. 3, pp. 277-284, 1995 Copyright © 1995 The Canadian Society of Clinical Chemists Printed in the USA. All rights reserved 0009-9120/95 $9.50 + .00

Pergamon 0009-9120(94)00072-7

New Methods for Rapid Detection of Low-Density Lipoprotein Receptor and Apolipoprotein B Gene Mutations, Causing Familial Hypercholesterolemia ANNE MINNICH, MADELEINE ROY, ANN CHAMBERLAND, JACQUES LAVIGNE, and JEAN DAVlGNON Department of Hyperlipidemia and Atherosclerosis, Clinical Research Institute of Montreal, 110 Pine Avenue West, Montreal, P.Q. Canada H2W 1 R7

Due to a genetic founder effect, five mutations in the low-density lipoprotein receptor gene account for approximately 83% of familial hypercholesterolemia (FH) diagnosed in FrenchCanadians. The most frequent mutation, present in 61% of heterozygotes, is a >10 kb deletiion of the 5' region of the gene that removes the promoter and the first exon, resulting in a null allele. Other less prevalent mutations include a gene deletion of approximately 5 kb, which removes exons 2 and 3 (2% of cases) and three missense mutations: Trpse-* Gly (exon 3) (12=/=), Glu2oz---~ Lys (exon 4) (3%), and Cyst6--* Tyr (exon 14) (6%). The apoB Arg3soo --~ Gin mutation was absent in 228 FrenchCanadians with the FH phenotype. Taking advantage of the availability of fluorescent DNA detection, we have substantially improved the assays for these mutations.

KEY WORDS: low-density lipoprotein (LDL) receptors; gene deletion; familial h)2~ercholesterolemia (FH); polymerase chain reaction; apolipoprotein B; DNA mutational analysis; point mutation; molecular epidemiology.

Introduction everal aspects of the French-Canadian popula-

S tion make it an ideal one in which to perform molecular genetic diagnosis. The history and demographics of Quebec, Canada, have resulted in a genetic founder effect (1), such that gene mutations causing certain inherited metabolic diseases are both more prevalent and more homogeneous. An example of such a disease is familial hypercholesterolemia (FH), a codominantly inherited disorder caused by a mutation in the gene encoding the lowdensity lipoprotein (LDL) receptor (R) that renders the receptor dysfunctional. FH is characterized by high plasma LDL cholesterol levels, xanthomas, and precocious atherosclerosis. The frequency of FH in Quebec is twice that observed in most populations Correspondence: Dr. Anne Minnich. Manuscript received June 14, 1994; revised September 29, 1994; accepted October 6, 1994. CLINICALBIOCHEMISTRY,VOLUME28, JUNE 1995

sampled, and the frequency of mutations causing the FH phenotype (1 in 270 overall and as high as 1 in 80 in some regions) (2) in Quebec is twice that in most other populations. In addition, an initial study of 100 French-Canadian FH subjects from our clinic showed that 76% of heterozygous FH can be accounted for by one of five LDL receptor gene mutations (3). The most prevalent of these, accounting for an estimated 60% of cases, is a deletion of unknown length in the 5' region of the gene that removes the promoter and first exon resulting in a null allele (4) (herein referred to as the >10 kb deletion, or A > 10 kb). Another deletion of approximately five kilobases removes exons 2 and 3 encoding the first two of seven ligand binding repeats in the receptor (herein referred to as A5 kb) (5) accounted for about 3% of FH cases. This and similar deletions in the LDL-R gene are shown to be causal for FH based on family studies (5) and in vitro mutagenesis experiments (6). Finally, three missense mutations in the LDL-R gene have been demonstrated to cause FH in French Canadians based on pulse-chase studies in fibroblasts of homozygous subjects: These are Trp86 --* Gly (exon 3), Glu2o7 ~ Lys (exon 4), and Cys646--> Tyr (exon 14) (3). These missense mutations were estimated to account for 7, 2, and 5% of FH cases from the same clinic population, respectively (3). Two additional possibilities were explored to explain those cases that could not be accounted for by any of the known French-Canadian mutations in the LDL-R gene. A mutation in the LDL receptor ligand, apolipoprotein B (apoB), apoB Arg35oo --* Gln, is known to cause FH in many Caucasian populations (7-9). Whether this mutation is present in FrenchCanadians has not been reported; therefore, the presence of this mutation was investigated in the French-Canadian FH population. In addition, the hypothesis that mutations in the regulatory region

277

MINNICH E T A L .

of the LDL receptor gene could explain a portion of the unexplained FH cases was addressed. With the recent rapid development of techniques in molecular biology, the technology of fluorescence detection of DNA has become available. The present report describes novel techniques that take advantage of this technology for rapid screening of the relevant LDL receptor mutations in FH FrenchCanadians. Adaptations of these techniques to detect other mutations will be useful in populations in which a genetic founder effect exists. In addition, the possible advantages and uses of these circumstances and methods are discussed. Methods

SUBJECTS

Subjects were selected from among those attending the Lipid Clinic at the Clinical Research Institute of Montreal (IRCM). All protocols were approved by the IRCM ethics committee. Individuals referred to the clinic for hypercholesterolemia were screened for the five LDL-R mutations. Subjects carrying one of the five French-Canadian LDL receptor gene mutations were automatically classified as FH. Among hypercholesterolemic (>95th percentile for corresponding age and sex) subjects not carrying one of these mutations, only subjects with tendon xanthomas or those having a first degree relative with tendon xanthomas, or individuals with an offspring displaying severe childhood hypercholesterolemia and a family history of premature coronary artery disease, were classified as FH. PLASMA LIPOPROTEINLIPID MEASUREMENT

Plasma was isolated from venous blood of fasting subjects. Lip®proteins were isolated by ultracentrifugation at d = 1.006 g/mL to obtain VLDL and precipitation of apoB-containing lip®proteins in the d > 1.006 g/mL fraction to separate LDL from HDL (10).

Plasma and lip®protein cholesterol concentrations were determined enzymatically on an automated analyzer (Abbott Biochromatic Analyzer model 100, Abbott Laboratories, Pasadena, CA). DNA ANALYSIS DNA was extracted from white blood cells with an Applied Biosystems 340A extractor. Oligonucleotides were synthesized by the solid-phase triester method on a Pharmacia LKB Gene Assembler Plus DNA synthesizer. Fluorescent dye-labeled primers were obtained from Applied Biosystems (Foster City, CA) or from Regional Synthesis Laboratories (Calgary, Alberta). One microgram of genomic DNA was amplified by polymerase chain reaction (11). The DNA sequence of all oligonucleotide primers used for PCR are shown in Table 1. The T -* G nucleotide substitution resulting in the mutation Trpe6 -* Gly (exon 3) was determined by PCR amplification of exon 3 as above and digestion of the PCR fragment with BslI (New England Biolabs). Digestion products were electrophoresed on 2%-3% Metaphor ®(FMC BioProducts, Rockland, ME) agarose gels. The C --* T substitution resulting in the mutation Glu2o7 --* Lys (exon 4) was similarly determined by digestion of exon 4 with MnlI (New England Biolabs). The G -* A substitution causing the mutation C y s t s --~ Tyr (exon 14) was determined by competitive oligonucleotide priming (12) by amplification of exon 14 at 95°C, 1 min, 68°C, 1 min for 28 cycles. Two 5' oligos were used, one each corresponding to the mutant and wild-type sequence, labeled with FAM ® (blue) and JOE® (green) fluorescent dyes (Applied Biosystems), respectively. The amplified DNA fragments (185 bp) were subjected to 6% polyacrylamide gel electrophoresis and fluorescence detection and quantification on a model 373A Automated DNA Sequencer® (Applied Biosystems). Fluorescence peaks corresponding to DNA fragments were integrated with 672 GeneScanner® software. Relative quantities of DNA fragments corre-

TABLE 1 Oligonucleotides for Amplification of the LDL Receptor Gene LDL-R Gene Region

5' oligo 5' --* 3' (sense)

3' oligo 5' --* 3' (antisense)

Promoter-374-+33 (31)

tcaggaggatctttcagaagatgca tgacagttcaatcctgtctcttctg ccccaagacgtgctcccaggacga tgccccaggagtgaactggt~c gccccaggagtgaactggtaQ cttacttgaattccaagagcacccd

ggtccagcgcaatttccagcccca atagcaaaggcagggccacacttacb acgccccgcccccaccctgccccgc cgcagaaacaaggcgtgtgccacc

Exon 3 (32) Exon 4 Exon 14

ApoB (exon 26) (14)

ggtaggatgatatttttgaggaace

LDL-R, low-density lip®protein receptor.

Underlined bases represent differences from the normal sequence. a Labeled with HEX®fluorescent dye. b Labeled with JOE ®fluorescent dye. c Normal sequence; labeled with JOE ®fluorescent dye. d Mutant sequence; labeled with FAM® fluorescent dye. e Labeled with FAM®fluorescent dye.

278

CLINICAL BIOCHEMISTRY, VOLUME 28, JUNE 1995

FH M O L E C U L A R DIAGNOSIS

sponding to the mutant or wild-type sequence were calculated as the percent of total peak area contributed by blue and green, respectively. Initially,this assay was confirmed by allele-specifichybridization with [~/S2p]-ATP-labelod oligonucleotide probes corresponding to mutant and wild-type sequences as described (3). The presence of the French-Canadian LDL-R > 10- and 5-kb gene deletions was determined by Southern blotting as described (5). Alternatively, a semiquantitative P C R assay was used as follows: 200-500 ng of genomJic D N A was PCR-amplified with primers, one of each set of which was fluorescently labeled, corresponding to the promoter and exon 3 of the L D L receptor (see Table 1), for I rain, 95°C and 2 rain, 66°C, :for25 cycles, followed by an additional cycle of 72°C, 2 rain. The relative quantities of amplified D N A corresponding to the promoter and to exon 3 were determined after electrophoresis as above. The ratio of the peak area corresponding to D N A amplified from the promoter (which is deleted from one L D L receptor allelein/~ > 10 kb heterozygotes) to that from exon 3 (deleted in one allelein A5 kb heterozygotes) was calculated and compared with the mean of that in three subjects known not to carry either of these mutations (see Results). The presence of the mutation apoB Args5oo--* Gin was detected by allele-specifichybridization as described (13), or with a PCR-site-directed mutagenesis assay essentially as described (14), (96°C, i rain, 54°C, 1 rain, 70°C, 1 rain, 30 cycles) but with fluorescently labeled P C R primers. After digestion with Mspl, the D N A fragments were electrophoresed, visualized, and quantified by fluorescence detection as above. Single-strand conformation polymorphism (SSCP) was performed essentially as described (15). A 396bp fragment of the LDL receptor promoter was amplified as above in the presence of 2 ~Ci of [c~32P]dCTP (Amersham). Aliquots of the PCR reactions were diluted 1:20, denatured in 20 m M N a O H for 2 m i n at 90°C, a n d e l e c t r o p h o r e s e d in 6 % - 8 % LongRanger ® (J.T. Baker, Phillipsburg, NJ) gels c o n t a i n i n g 10% g l y c e r o l o v e r n i g h t at r o o m temperature.

Results SCREENING FOR POINT MUTATIONS IN THE L D L RECEPTOR GENE IN FRENCH=CANADIAN FH PATIENTS

The plasma lipoprotein lipidprofiles (Table 2) and other clinical characteristics of F H patients attending the I R C M are similar to those in F H patients from other populations. The mutations Trp6 s --, Gly (exon 3) and Glu2o7 --> Lys (exon 4) can be easily detected after restriction digestion of the amplified exons (see methods) (Figure 1). Since the G to A base substitution resulting in the mutation Cys646 -~ Tyr (exon 14) does not create or destroy a site for any restriction enzyme of which we were aware, the presence of this mutation was screened with competitive oligonucleotide priming (see Methods). Among five F H subjects in whom heterozygosity for the exon 14 mutation had been previously ascertained by allele-specifichybridization and seven in w h o m the mutation was expected based on its presence in a relative,the mean ratio of signal from the mutant primer was 63.8 -+ 2 % (range 44-76) of the total. In subjects known not to carry this mutation, this ratio ranged from 0 % to 11%. Thus, this screening method yields unequivocal results. DETECTION OF A > 10 KB BY QUANTITATIVE P C R

Neither the exact length nor the D N A sequence of the deletion joints of the French-Canadian > 10-kb deletion are known. Normally, major gene deletions, insertions, and rearrangements are detected by Southern blotting. This method, with multiple overnight steps, requires approximately 2 weeks to generate results.The PCR-based method for detection of the/~ > 10 kb (see Methods) relieson quantitation of the relative amounts of D N A amplified from two regions in the LDL-R gene, as opposed to the qualitative presence or absence of bands on a Southern blot. However, the benefits of this technique compared with the Southern-blotting approach potentially outweigh this disadvantage, since (a) the result is generated in only 2 days, an advantage if processing of small numbers of samples is needed;

TABLE 2 P l a s m a Lipoprotein Lipids in F r e n c h - C a n a d i a n F H P r o b a n d s W i t h K n o w n M u t a t i o n s in the LDL-R Gene Women

Age (years) Cholesterol (c) LDL-C HDL-C TG

39.1 9.31 7.31 1.10 1.57

-+ 12.6 (191) -+ 1.91 (189) -+ 1.61 (157) -+ 0.3 (173) -+ 1.57 (189)

Men

36.1 9.36 7.33 0.87 1.79

-+ 9.8 (147) -+ 1.85 (146) -+ 1.81 (127) -+ 0.22 (131) -+ 1.12 (145)

FH, f~milialhypercholesterolema; LDL-R, low-density lipoproteinreceptor. Plasma lipoproteinlipidconcentrations are in mmol/L. The number of subjects for whom ir~Formationwas availableis shown in parentheses.Mean lipidvalues represent baseline levelsin untreated subjects.

CLINICAL BIOCHEMISTRY', VOLUME 28, JUNE 1995

279

A

bp 162 - -

84C

~oo,

,4oo, ,5oo. ,6oo, Too,

,9o0. ?oo.

,~ooo. ,~oq

3200

,huff ,~Joo. Mutant

2800

Mutant

2400 2000

1600 1200 800 400-"

•

B

Lane2: RC 25 //14

,oo.

•

4oo,

~oo

,~oo, ?oo,

Lane2: RC 25

,8oo, ?oo,

,~ooo /~oo

~2oo

,noo

Mutant 2800 Normal 2400

2000 1600-. 1200~

__~

800400-. oJ

431

•

•

.............

~ne5: RC 101 #14

,4oo

•

Ooo,

,.oo, ?oo,

~neS: ~ 101

,8oo, ?oo.

,~ooo ,~oo

312 242

,~aoo ,x~oo Normal Normal

'

98 70 m Lane 10: CB 219 #14

I

Lane 1~. (:821(I

Figure 1. - - Detection of point mutations in the LDL receptor. (A) and (B) Trpee --> Gly (exon 3) and Glu2o 7 ---> Lys (exon 4), respectively. LDL-R exons 3 (A) and 4 (B) were amplified from genomic DNA, digested with BslI and MnlI, respectively, and electrophoresed on agarose as in Table 1 and "Methods". ND, nondigested PCR fragment; D N A was from: N, normal subject; HTZ, HMZ a subject heterozygous and homozygous, respectively, for the mutation. M.W., molecular weight markers (HaeIII-digested &X174 DNA). Numbers to the left of the figures indicate the molecular weights of the fragments in base pairs. (C) Assay of Cys646 --~ Tyr (exon 14) mutation. LDL-R exon 14 was amplified from genomic D N A by competitive oligonucleotide priming as in "Methods" and Table 1. Shown is the output from the Automated DNA Sequencer. The peak to the right represents the 185 bp amplified exon 14 fragment, blue and green corresponding to DNA amplified from the mutant and normal sequence, respectively (see Table 1). DNA was from subjects known to be homozygous (top) and heterozygous (middle) for the exon 14 mutation, and from a normal subject (bottom panel). The peak to the left represents unincorporated oligonucleotides.

F H M O L E C U L A R DIAGNOSIS

(b) no radioisotopes are necessary; and (c) very small amounts of DNA are needed. In each assay, the ratio of the promoter to exon 3 DNA fragment peak area is calculated. On the/~ > 10-kb allele, the promoter is deleted, but exon 3 remains intact. Therefore, the results were corrected for interassay variability in PCR efficiency or in the amount of starting genomic DNA by expressing the amount of DNA amplified from the promoter as a ratio to that for exon 3. For a/~ > 10-kb heterozygote, one would expect half of the quantity of DNA amplified from the promoter, by exon 3, of that in a normal subject. In each assay, results were calculated as a ratio to the mean of three normal subjects z~n in the same assay. In 12 subjects for whom heterozygosity for the/~ > 10 kb had been ascertained by Southern blotting, the promoter:exon 3 ratio was 0.50 -+ 0.08 (range 0.150.70) that of the mean of the normal subjects. In 16 subjects known to be negative for these deletions, other than the 3 used in each assay to calculate ratios, this ratio was 0.93 -+ 0.03 (range 0.75-1.21). Amplification of genomic DNA from a subject homozygous for the /~ > 10 kb resulted in no signal corresponding to the promoter, but in a normal fragment corresponding to exon 3. These data establish the accuracy of this PCR method for determining the presence or absence of the French-Canadian A > 10kb. PREVALENCE OF FRENCH-CANADIAN LDL RECEPTOR MUTATIONS IN HETEROZYGOUS FH PATIENTS FROM OUR CLINIC

The prevalence of each of the above LDL-R gene mutations in French-Canadian FH patients attending the IRCM is reported in Table 3. The 17% of FH subjects with none of these mutations may be an underestimate, since in the absence of a molecular diagnosis, strict criteria were applied to the diagnosis of FH. For example, hypercholesterolemic subjects without tendon xanthomas and for whom no family history was available were not considered as FH in these calculations.

SCREENING FOR THE apoB ARG3500 ---> GLN MUTATION IN FRENCH-CANADIAN FH PATIENTS

To investigate the possible molcular basis of FH in the remaining 17% of subjects, the presence of a mutation common to European populations (7) in the LDL receptor ligand was investigated. This assay, for the mutation apoB Argssoo --* Gln was also adapted to fluorescence DNA detection (see Methods). The advantages of this adaptation are that it simplifies the otherwise complicated digestion pattern commonly produced with frequently cutting restriction enzymes such as Mspl, since only the labeled fragments are visible on the gel. Thus, Mspl digestion of amplified DNA from a subject with various combinations of apoB alleles encoding 3500 Arg or Gln, and 3611 Arg or Gln, produces 477,454, 356, 333, 121, and 23 base pair fragments (14), while the fluorescence-based technique eliminates the 333-bp fragment, which is not necessary for interpretation of the result. In addition, by quantitating each fragment, this technique allows distinction between the true absence of an Mspl site in an allele and incomplete digestion of the PCR fragment, thus avoiding mistyping. The fidelity of the assay was confirmed by perfect agreement with the results from a 12member kindred among whom the presence or absence of this mutation had been previously ascertained with allele-specific hybridization (see Methods). Four groups of subjects were examined: (a) French-Canadian FH patients negative for the five LDL receptor mutations (n = 87; 53 probands from Table 3 and family members), (b) a sample of French-Canadian FH patients with one of the known LDL receptor mutations (n = 71), (c) hyperlipidemic French-Canadian subjects in whom FH was suspected but could not be diagnosed according to our clinical or molecular criteria (n = 70), and (d) 43 unrelated non-French-Canadian FH clinic patients. The prevalence of the apoB Arg35oo --* Gln mutation in all three groups of French-Canadian subjects was 0 of 228. Among group (d), three carriers were detected. SCREENING OF THE LDL-R GENE PROMOTER

TABLE 3 P r e v a l e n c e of LDL Receptor Gene M u t a t i o n s in

French-Canadian FH Probands LDL-R Mutation

No. Subjects

% Total

h > 1 0 kb deletion Trp66 --* Gly (exon 3) Cyse46 --->T y r (exon 14) Glu2ov --* Lys (exon 4) A5 kb deletion apoB Argssoo --* Gln a None Total

227 44 24 11 7 0 63 376

60.5 11.7 6.4 2.9 1.6 0 16.8 100

LDL, low-density lipoprotein; FH, f a m i l i a l hypercholesterolemia. a 228 F r e n c h - C a n a d i a n subjects screened. CLINICAL BIOCHEMISTRY, VOLUME 28, JUNE 1995

To investigate the interesting possibility that the molecular defect(s) in the remaining 17% might be regulatory in nature, SSCP was used to screen for promoter mutations. Figure 2 shows that under the conditions used, the method was sensitive to single base differences in a DNA fragment of approximately 400 base pairs. Among 56 French-Canadian FH subjects with none of the founder mutations, no differences were found. Among an additional 158 hypercholesterolemic subjects that could not be definitively diagnosed as FH according to our strict medical or molecular criteria, only one subject with a reproducible base difference was found. Unfortunately the family of this subject was unavailable for the study of segregation of this mutation on cholesterol levels. Thus, the immediate LDL-R promoter 281

MINNICH E T

1

234

5

6

AL.

7891011

Figure 2. - - SSCP to detect single-nucleotide differences in DNA fragments. Autoradiograph of a 400 base-pair fragment of the LDL-R promoter amplified from genomic DNA and electrophoresed as in Table 1 and methods. DNA was from: LDL-R exon 4 of subjects heterozygous for Glu2o7 ~ Lys (lanes 8 and 9); exon 4 from normal subjects (lanes 10 and 11); LDL-R promoter of seven subjects without any of the five known French-Canadian LDL-R mutations (lanes 1-7). does not appear to contain mutations that may explain F H or hypercholesterolemia in this group of subjects. Discussion Molecular genetic evidence for a genetic founder effect accounting for the frequency of LDL receptor mutations in French-Canadians (16) has been reported, and the historical circumstances leading to these circumstances in the French-Canadian population have been described (1). The present report describes several relatively novel techniques used in screening for these mutations, which are known to cause familial hypercholesterolemia. These techniques are based on state-of-the-art technologies and offer several advantages for the purpose of genetic screening. First, these methods obviate the use of radioactive isotopes, improving safety and speed in the handling of reagents. Second, these methods

282

obviate the need for transfer or application of DNA onto filters and probe hybridization, making them amenable to the analysis of a single sample and rapid confirmation of the result, if necessary. Finally, in some assays the use of restriction enzymes can even be eliminated, avoiding both the cost and problems in interpretation due to incomplete enzymatic digestion. With these methods, we determined that among heterozygous F H probands attending our clinic, 83% of subjects carried one of t h e F r e n c h - C a n a d i a n LDL-R mutations:/~ > 10 kb (4) (60.5%), A5 kb (5) (1.6%), or the point m u t a t i o n s (3) Trp6e --* Gly (11.7%), Glu2o7 --* Lys (2.5%), or Cys64s -* Tyr (6.4%). These numbers correspond fairly well to a p r e l i m i n a r y e s t i m a t e of t h e i r f r e q u e n c i e s in a smaller sample consisting of 100 subjects (3) (59,3, 7,2,5%, respectively). The molecular basis or bases for the remaining cases is (are) not known. The possibility that the

CLINICAL BIOCHEMISTRY, VOLUME 28, JUNE 1995

FH MOLECULARDIAGNOSIS apoB Arg35oo ---> Gin mutation (13) accounted for some portion of these cases was explored, since this mutation is associated 'with FH in every Caucasian population in Europe, including the French (17) and North Americans (7-19) with a frequency of 1% among FH individuals (18). Surprisingly, the apoB Arg35ooo--* Gln mutation appears to be absent in the French-Canadian population, since it was not found in 228 hypercholesterolemic individuals including those with no known LDL-R mutation. Although most subjects with LDL-R gene mutations were not screened for the apoB Arg35oo--> Gln mutation, they are presumed to be negative, since the phenotype of compound heterozygotes for this mutation and an LDL-R mutation is clearly distinguishable from that of an ordinary heterozygote for either mutation (19). Thus, the absence of the apoB Arg~5oo--* Gln mutation in French-Canadian FH individuals may reflect its absence in the few thousand original settlers of Quebec. Therefore, a second possibility to account for the FH cases in which the five French-Canadian LDL-R mutations were absent was explored. The structurefunction of the coding region of the LDL-R gene is well understood, and numerous mutations causing FH have been documented confirming in vitro structure-function studies C20). However, little such information exists regarding the regulatory regions of the gene. Based on in vitro LDL-R gene promoter analyses, all of the DNA sequences necessary to confer basal transcription and sterol-responsiveness are located within 100 bases of the transcription start site (21). To address the question of whether regulatory mutations might cause FH in these patients, a 400 base-pair region of the LDL-R gene promoters were screened with SSCP. No evidence for mutations in this region was found in this group of subjects. A similar negative result was obtained by Top et al. (22) in 350 FH heterozygotes with denaturing gradient gel electrophoresis. Thus, although the molecular basis of the group of FH subjects with unidentified mutation(s) remains unclear, it is likely that this group carries several LDL-R alleles of low frequencies, since higher frequencies would presumably result in the detection of the mutation in homozygotes. In fact, all of the LDL receptor alleles in all known FH homozygotes in Quebec encode the A > 10 kb or one of the French-Canadian point mutations (manuscript in preparation). One potential application of molecular screening is more accurate diagrmsis of FH than is otherwise possible. This is particularly advantageous in the absence of pathognomonic clinical information confirming the diagnosis of FH. As previously indicated (23), due to a high level of interindividual phenotypic variability in FH expression (unpublished data from our laboratory), plasma LDL cholesterol levels do not always accurately distinguish FH from other milder forms of hyperlipidemia for which aggressive treatment may not be indicated, especially in children. Because LDL-C levels in individuals who are CLINICALBIOCHEMISTRY,VOLUME28, JUNE 1995

eventually diagnosed as FH may be within the normal range in early childhood but tend to rise faster with age than those of non-FH children (24), it may be difficult to diagnose FH in young children. Thus, early molecular diagnosis offers the opportunity to test the efficacy of early treatment of FH in lowering risk for CAD. Such intervention is applicable to more genetically heterogeneous populations with the use of segregation analyses to identify affected and nonaffected subjects in FH families, with DNA markers such as dinucleotide repeats or RFLPs in the LDL receptor gene. For research purposes, there are additional advantages of detecting large numbers of subjects with identical mutations. In the case of the LDL-R, different mutations in the LDL-R gene result in various biochemical phenotypes that have been characterized and classified (20). Among these are the French-Canadian mutations (23). Limited information suggests that the differences in the severity of the FH phenotype are consistent with differences in the biochemical consequences of the mutant receptor (25). The ability to screen large numbers of subjects for known LDL-R mutations allows the study of sources of variability in phenotypic expression of FH in groups of subjects with the same molecular defect. The molecular screening methods described herein are currently applicable to a population in whom a genetic founder effect is present, since they rely on the precise knowledge of the m u t a t i o n being screened. Other populations in which such a genetic founder effect for FH has been observed include the Christian Lebanese (26), the Afrikaner population of South Africa (27), Norwegians (28), Finnish (29), and the Ashkenazi Jews in Israel (30). Although the clinical advantage of these molecular screening techniques is relevant only to such populations, their application may have broader implications. Acknowledgements We thank Dr. Elaine Mansfield for providing oligonucleotide primers and valuable advice pertaining to the apoB Argssoo--* Gin assay. This work was supported by grants from the MRC/Ciba-Geigy/IRCMUniversity Industry program (UI-11407), the J.A. DeS~ve Foundation, and FRSQ-Hydro-Quebecno. 921369. References

1. Davignon J. Familial hypercholesterolemia in FrenchCanadians: Taking advantage of the presence of a founder effect. A m J Cardiol 1993; 72: 6D-10D. 2. Moorjani S, Roy M, Gagne C, et al. Homozygous familial hypercholesterolemia among French Canadians in Quebe~c Province. Arteriosclerosis 1989; 9: 211-6. 3. LeitersdorfE, Tobin EJ, Davignon J, Hobbs HH. Common low-density lipoprotein receptor mutations in the French Canadian population. J Clin Invest 1990; 85: 1014-23. 4. Hobbs HH, Brown MS, Russell DW, Davignon J, Gold-

283

MINNICH ET AL.

5.

6.

7.

8.

9.

10. 11. 12.

13.

14.

15.

16.

17.

18. 19.

284

stein JL. Deletion in the gene for the LDL receptor in majority of French Canadians with familial hypercholesterolemia. N Engl J Med 1987; 317: 734-7. Ma Y, Betard C, Roy M, Davignon J, Kessling AM. Identification of a second "French Canadian" LDL receptor gene deletion and development of a rapid method to detect both deletions. Clinical Genetics 1989; 36: 219-28. van Driel IR, Goldstein JL, Sudhof TC, Brown MS. First cysteine-rich repeat in ligand-binding domain of low density lipoprotein receptor binds Ca and monoclonal antibodies, but not lipoproteins. J Biol Chem 1987; 262: 17443-9. Tybj~erg-Hansen A, Humphries SE. Familial defective apolipoprotein B-100: A single mutation that causes hypercholesterolemia and premature coronary artery disease. Atherosclerosis 1992; 96: 91-107. Rauh G, Keller C, Schuster H, Wolfram G, Zollner N. Familial defective apolipoprotein B-100: A common cause of primary hypercholesterolemia. Clin Invest 1992; 70: 77-84. Innerarity TL, Mahley RW, Weisgraber KH, et al. Familial defective apolipoprotein B-100: A mutation of apolipoprotein B that causes hypercholesterolemia. J Lipid Res 1990; 31: 1337-49. Lipid Research Clinics Program. Manual of Laboratory Operations, Vol. 1. Washington, DC: US Government Printing Office, 1974. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988; 239: 487-91. Chehab FF, Kan YW. Detection of specific DNA sequences by fluoresence amplification: a color complementation assay. Proc Natl Acad Sci USA 1989; 86: 9178-82. Soria LF, Ludwig EH, Clarke HG, Vega GL, Grundy SM, McCarthy BJ. Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100. Proc Natl Acad Sci USA 1989; 86: 587-91. Motti C, Funke H, Rust S, Dergunov A, Assmann G. Using mutageneic polymerase chain reaction primers to detect carriers of familial defective apolipoprotein B-100. Clin Chem 1991; 37: 1762-6. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989; 5: 874-9. Betard C, Kessling A, Roy M, Chamberland A, LussierCacan S, Davignon J. Molecular genetic evidence for a founder effect in familial hypercholesterolemia among French-Canadians. H u m Genet 1992; 88: 52936. Loux N, Saint-Jore B, Collod G, et al. Identification of the haplotype associated with the apoB-3500 mutation in a French hypercholesterolemic subject: Further support for a unique European ancestral mutation. H u m Mutat 1993; 2: 145-57. Rauh G, Keller C, Kormann B, et al. Familial defective apolipoprotein B loo: Clinical characteristics of 54 cases. Atherosclerosis 1992; 92: 233-41. Rubinsztein DC, Raal RJ, Seftel HC, Pilcher G, Coetzee GA, van der Westhuyzen DR. Characterization of

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31. 32.

six patients who are double heterozygotes for familial hypercholesterolemia and familial defective Ape B-100. Arterioscler Thromb 1993; 13: 1076-81. Hobbs HH, Russell DW, Brown MS, Goldstein JL. The LDL receptor locus in familial hypercholesterolemia: Mutational analysis of a membrane protein. A n n u Rev Genet 1990; 24: 133-70. Sudhof TC, van der Westhuyzen DR. Goldstein JL, Brown MS, Russell DW. Three direct repeats and a TATA-like sequence are required for regulated expression of the human low density lipoprotein receptor gene. J Biol Chem 1987; 262: 10773-9. Top B, Uitterlinden AG, Van der Zee, A, etal. Absence of mutations in the promoter region of the low density lipoprotein receptor gene in a large number of familial hypercholesterolaemia patients as revealed by denaturing gradient gel electrophoresis. H u m Genet 1992; 89: 561-5. Kotze MJ, Langerhoven E, Kriek JA, Oosthuizen CJJ, Retief AE. DNA screening of hyperlipidemic Afrikaners for familial hypercholesterolemia. Clin Genet 1992; 42: 43-6. Kessling AM, Seed M, Taylor R, Wynn V, Humphries SE. Rising cholesterol levels in children with familial hypercholesterolaemia. Biomed Pharmacother 1990; 44: 373-9. Moorjani S, Roy M, Torres A, et al. Mutations of lowdensity lipoprotein receptor gene, variation in plasma cholesterol, and expression of coronary heart disease in homozgous familial hypercholesterolemia. Lancet 1993; 341: 1303-6. L e h m a n MA, Schneider WJ, Brown MS, et al. The Lebanese allele at the low density lipoprotein receptor locus: Nonsense mutation produces truncated receptor that is retained in the endoplasmic reticulum. J Biol Chem 1987; 262: 401-10. Van Roggen FG, van der Westhuyzen DR, Marais AD, Gevers W, Coetzee GA. Low density lipoprotein receptor founder mutations in Afrikaner familial hypercholesterolaemic patients: A comparison of two geographical areas. H u m Genet 1991; 88: 204-8. Rodningen OK, Leren TP, Rosby O, Tonstad O, Ose L, Berg K. Haplotype analysis at the low density lipoprotein receptor locus in normal and familial hyper cholesterolemia Norwegian subjects. Clin Genet 1993; 44: 214-20. Aalto-Set~il~i K, Helve E, Kovanen PT, Kontula K. Finnish type of low density lipoprotein receptor gene mutation (FH-Helsinki) deletes exons encoding the carboxy-terminal part of the receptor and creates an internalization-defective phenotype. J Clin Invest 1989; 84: 499-505. Meiner V, Landsberger D, Berkman N, et al. A common Lithuanian mutation causing familial hypercholesterolemia in Ashkenazi Jews. A m J H u m Genet 1991; 49: 443-9. SudhofTC, Goldstein JL, Brown MS, Russell DW. The LDL receptor gene: A mosaic of exons shared with different proteins. Science 1985; 228: 815-22. Hobbs HH, Brown MS, Goldstein JL. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. H u m Mut 1992; 1: 445-66.

CLINICAL BIOCHEMISTRY,VOLUME 28, JUNE 1995