- Email: [email protected]
NF-κB signal in 5-8F cells
Biomedicine & Pharmacotherapy 123 (2020) 109576
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Casticin elicits inflammasome-induced pyroptosis through activating PKR/ JNK/NF-κB signal in 5-8F cells
T
Chenyan Jianga, Runjie Shia, Bin Chena, Xiaojun Yana, Guoyao Tangb,* a b
Department of Otorhinolaryngology Head and Neck Surgery, Shanghai 9th Peoples Hospital Affiliated to Shanghai Jiaotong University School of Medicine, China Department of Oral Mucosa, Shanghai 9th Peoples Hospital Affiliated to Shanghai Jiaotong University School of Medicine, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Pyroptosis Cell cycle PKR 5-8F cells GSDMD
Casticin is one of the effective ingredients of fructus viticis. Most studies have shown that casticin has a strong anti-proliferation activity against various tumor cells. However, its anti-tumor effect and molecular mechanism in nasopharyngeal carcinoma remain unclear. In this study, we demonstrated that the casticin selectively inhibited the proliferation of 5–8F cells in vitro. Further analysis revealed that casticin treatment significantly increased sub-G2 phase and incited pyroptotic process. Moreover, we demonstrated that PKR participated in in regulating the process of GSDMD-dependent pyroptotic tumor cell death. PKR knockdown alleviated the activation of JNK pathway and the expression of its downstream proteins, including cleaved caspase-1, GSDMD-N, interleukin-1β. These findings indicate that PKR/JNK/NF-κB signal is essential for casticin-induced caspase-1 inflammasome formation and inflammatory cytokines release in 5–8F cell.
1. Introduction Nasopharyngeal carcinoma (NPC) is a malignant tumor originating from the surface epithelium of the nasopharynx, which incidence is the highest among malignancies of the ear, nose, and throat [1]. And NPC is endemic in South-eastern Asia, with a poor prognosis [2]. Because of the non-specific symptoms of NPC, majorities of patients with the disease are diagnosed only when the tumor has reached an advanced stage. The kind of 5–8F cell is one of the most common types in NPC patients with cervical lymph node metastasis [3]. Clinical studies have shown that treatment of NPC patients can use cisplatin-based induction chemotherapy followed by radiation-based locoregional treatment. Unfortunately, approximately 30 % of patients will show isolated local recurrence and metastasis after treatment [4]. Therefore, to identify potential curative anticancer drugs is of great importance for advanced NPC patients. Casticin (CTC), also known as vitexicarpin, is a polymethoxylated flavonoid compound with a wide range of pharmacological activities extracted from the traditional Chinese medicine fructus viticis (CTC, Fig. 1) [5]. In recent years, CTC served as the main active ingredient of fructus viticis against tumor due to their unique structure. Some studies demonstrated that CTC caused cell cycle arrest in G2/M phase and induced apoptosis in some tumor cells through interference with spindle formation without affecting other microtubule functions during
⁎
anaphase and telephase [6–8]. Meanwhile, it also induced P21 protein expression and inhibited CDK1 activity, blocking cells to the G2/M phase transition [9]. The term pyroptosis was initially proposed by Brennan and Cookson for a novel form of inflammatory programmed cell death (PCD) and different from other types of apoptosis or necroptosis [10]. Programmed pyroptosis is now defined by its dependence on a dedicated set of inflammatory caspases, such as caspase-1,-4 and, -5 in humans, and caspase-1,and-11 in mice. Mechanistically, pyroptosis is driven by two distinct signaling pathways, either canonical pyroptosis or noncanonical pyroptosis [11–13]. Under the stimulation of various pathological stimuli, inflammsomes are assembled to activate proinflammtory caspases. The terminal cell lysis is mediated by cleavage of gasdermin D (GSDMD) by one of these caspases, then the N-terminal fragements will be translocated to the membrane and perforate [14]. Subsequently abundant damage-associated molecular pattern molecules (DAMPs), such as the matured form of interleukin-18 (IL-18) and interleukin-1β (IL-1β), are released into extracellular environment during cell dying induced by pyroptosis [15–17]. Ultimately, these cytoplasmic inflammatory content attract effector cells of the immune system to active sites during primary infection. Protein kinase R (PKR) is a serine-threonine kinase encoded by the EIF2AK2 gene, which is activated by various forms of stress signals and plays a critical role in central cellular processes, such as regulation of
Corresponding author. E-mail address: [email protected] (G. Tang).
https://doi.org/10.1016/j.biopha.2019.109576 Received 26 August 2019; Received in revised form 15 October 2019; Accepted 21 October 2019 0753-3322/ © 2020 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
were procured from Sigma Aldrich. Specific antibodies for PKR (12297, 1:1000), JNK (9252, 1:1000), P-JNK (4668, 1:1000), CDK4 (12790, 1:1000), CDK6 (13331, 1:1000), Cyclin D1 (2978, 1:1000), Cyclin B1 (12231, 1:1000), CDC25A (3652, 1:1000), IL-1β (12703, 1:1000), GSDMD (93709, 1:1000), ERK1/2 (4695, 1:1000), P-ERK1/2 (9101, 1:1000), P38/MAPK (8690, 1:1000), P-P38/MAPK (4511, 1:1000) were obtained from (CST, Danvers, MA, USA), antibodies for caspase-1 (ab207802, 1:1000), P21 (ab109520, 1:5000), P27 (ab32034, 1:5000), P53 (ab32389, 1:1000), NF‐kB/P65 (ab16502, 1:1000), P-NF‐kB/P65 (ab86299, 1:2000) and all the secondary antibodies were purchased from (Abcam, Cambridge, UK). UltraSYBR Green Mixture (CW0659) and HiFiScript cDNA Synthesis Kit (CW2569) were obtained from cwbiotech (Beijing, China). LDH detection Kit (C0016) purchased from Beyotime (Shanghai, China). Primers and shRNA PKR were prepared by Invitrogen (Shanghai, China).
Fig. 1. Chemical structure of CTC.
2.2. Cell culture
Table 1 Primer sequences used in this study. Genes
Primer
Primer Sequence (5′→3′)
PKR
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CGGAAGGACACGGCATCAAGAT GAGCCAGGAAAACCTTCTCTGC AGCTCACCGCTAACGTGCTGC GCTTGGCTGCCGACTGAGGAG CCATCAGCACAGTTCGTGAGGT TCAGTTCGGGATGTGGCACAGA GGATAAAGTTCCAGAGCCTGGAG GCGATGCACTACTCGGTGTGAA TCTACACCGACAACTCCATCCG TCTGGCATTTTGGAGAGGAAGTG GACCTGTGTCAGGCTTTCTCTG GGTATTTTGGTCTGACTGCTTGC GGACTGAAGCACCTGTTGTGCA TCCTGAGTCTCCCAAGGCATTC CCCTGAGGCATTTAGGCAGCTA AGGTAGAGAGGTGGCTTAGGCT AGACAGCCACTCACCTCTTCAG TTCTGCCAGTGCCTCTTTGCTG CCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG ATGAGGTGCCTCCACAACTTCC CCAGTTCCTTGGAGATGGTCTC GCTGAGGTTGACATCACAGGCA TGCTGTCAGAGGTCTTGTGCTC GCCAACACAGTGCTGTCT AGGAGCAATGATCTTGATCTT
ASC CDK 4 CDK 6 Cyclin D1 Cyclin B1 NLRP3 TLR4 IL-6 IL-1β GSDMD Caspase-1 β-actin
Human normal nasopharyngeal epithelial cell line NP69, human NPC cell lines 6–10B and 5–8F were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM medium, supplemented with 10 % fetal bovine serum (Sijiqing, Hangzhou, China) at 37 ℃ in a CO2 incubator (5 % CO2 and 95 % air, 95 % humidity). 2.3. Cell proliferation assay Cells (8 × 103) were seeded into 96-well plate and incubated at 37 ℃ for 24 h, then treated with various concentrations of CTC (2, 4, 6, 8, 10, 12, 14 μM) for the indicated time (24, 48 h). 20 μL MTT (5 mg/mL) solution was added to each well and incubated for 4 h. Formazan crystals were dissolved in DMSO and measured using a multiwell sepctrophotometer (BioTek, Winooski, VT, USA) at 490 nm. 2.4. Cell cycle assay 5–8F cells (2 × 105) were seeded in 6-wells and then treated with CTC for 24, 48 h. Then cells were trypsinized and washed twice with cold PBS. For cell cycle analysis, cells were fixed by cold 75 % ethanol overnight at −20 ℃. After centrifuged at 1000 rpm for 5 min, cells were digested with RNaseA and stained with PI in the dark room for 30 min at 37 ℃, then analyzed by flow cytometer (Becton Dickinson, Franklin Lakes, USA).
Table 2 The sequence of PKR shRNA.
2.5. RNA extraction and sequencing
Gene
Sequence
Species
PKR PKR PKR PKR
GTGACTTGCGGTCACAGTGGCATTCAGCT TAGTGACCAGCACACTCGCTTCTGAATCA CTGAAGGTGACTTCTCAGCAGATACATCA ATACTAAGGACCTTGACTGTGTGGAAGAA
Human Human Human Human
shRNA-1 shRNA-2 shRNA-3 shRNA-4
The 5–8F cells were treated with CTC (6 μM) for 24 h and used for RNA sequencing detection. Total RNA was extracted with TRIzol® reagent (Invitrogen, USA) based on the manufacturer's instruction. cDNA library preparation and sequencing were carried out by BGI (shenzhen, China) Co., Ltd. Briefly, libraries for RNA-seq were constructed using TruSeq® RNA LT/HT Sample Prep Kit (Illumina, USA) following the manufacturer’s protocol. The purified libraries were assessed using the Agilent 2200 TapeStation and Qubit® 2.0 (Life Technologies, USA), and subsequently sequenced on an Illumina HiSeq 2500 with 2 × 100-bp paired-end reads. The gene expression abundance was normalized by FPKM (fragments per kilobase of exon per million fragments mapped) using Cufinks (v2.2.1). Differentially expressed genes (DEGs) were screened based on multiple differences |fold change| > 2 and significant difference in expression P-value < 0.05. Meanwhile, enrichment of KEGG pathways were analyzed based on the DEGs.
inflammation, mRNA translation and apoptosis [18,19]. In recent studies, PKR is also involved in the activation of several signal transduction pathways, such as mitogen-activated protein kinase (MAPK) [20], eIF2α, and nuclear factor of κB (NF-κB) pathway [21]. In the present study, we explored the effect of CTC on cell cell cycle and pyroptosis in 5–8F cells. Furthermore, we also investigated the effect of CTC on pyroptotic tumor cell death through activating the PKR/JNK signal. 2. Materials and methods
2.6. Quantitative real-time RT-PCR 2.1. Reagents To verify the expression of selected DEGs detected by RNA-seq, quantitative real-time PCR (qRT-PCR) amplification was performed.
Casticin, JNK inhibitor (SP600125) and NF‐kB inhibitor (JSH-23) 2
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 2. CTC inhibits the viability of NPC cells. (A) NP69, 6–10B and 5–8F cells were incubated with indicated concentrations of CTC (0–14 μM) for 24, 48 h. Cell viability was determined using MTT assay. Per condition, three independent experiments were performed. Data were shown as mean ± SD, *P < 0.05, **P < 0.01 vs. the control group.
synthesizing PKR shRNA and cloning into pGFP-C-shLenti plasmid (OriGene Technologies, Beijing,China). The sequence of PKR shRNA is shown in Table 2. Briefly, lentiviral particles carrying PKR shRNA were obtained. Then 5–8F cells were infected with PKR shRNA lentiviral particles according to the manufacturer’sprotocol. After 72 h infection, we used puromycin (Solarbio, Beijing, China) to select and produce a stable PKR-knockdown 5–8F cells. Down-regulation of PKR was validated by quantitative RT-PCR.
Table 3 IC50 values (μM) of Casticin on three cell lines for different treatment periods. Cell line
NP69 6–10B 5–8F
IC50 (μM) 24 h
48 h
9.84 ± 0.65 8.12 ± 0.54** 6.84 ± 0.43**
8.11 ± 0.61## 6.01 ± 0.55**## 5.11 ± 0.38**##
Note: **P < 0.01, vs NP69;
##
P < 0.01, vs 24 h.
2.8. Western blotting
After treatment with CTC (6 μM) for 24 h, cells were collected and total RNA was extracted using TRIzol® reagent (Invitrogen, USA). Equal amount of RNA was reverse transcribed to cDNA using HiFiScript cDNA synthesis kit and amplified using UltraSYBR Green qPCR Mixture (with ROX) reagent in a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) according to the following protocol: 10 min at 95 ℃ for the initial denaturation, followed by 95 ℃ for 15 s for 40 cycles, 60 ℃ for 1 min at the cycling stage, and 95 ℃ for 15 s, 60 ℃ for 1 min, 95 ℃ for 15 s at the melt curve stage. β-actin served as an endogenous control, and the 2−△△C method was used to calculate T relative expression levels. Primer sequences are shown in Table 1.
5–8F cells were treated with various concentrations of CTC. CTCtreated cells were incubated with different inhibitors including JNK inhibitor (SP600125) (20 μM) and NF‐kB inhibitor (JSH-23) (20 μM) for 24 h, and then harvested and lysed in RIPA buffer containing 1 % protease inhibitor PMSF for 30 min. Proteins were separated by 10 % SDS-PAGE and transferred on the PVDF membranes. After blocked by 5 % BSA, the membranes were incubated with appropriate antibodies. Immunoreactive proteins were visualized using Odyssey Platform (LICOR, Biosciences, Lincoln, NE, USA). The experiments were performed three times and densitometric analysis was performed using ImageJ software. β-actin was used as an internal control. 2.9. Statistical analysis
2.7. Knockdown of PKR expression in 5–8F cells
All experiments were conducted at least three times and expressed
The PKR shRNA construct (PKR shRNA) was generated by 3
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 3. CTC induces inflammasome activation in 5–8F cells. (A) Heatmap of genes upregulated or downregulated with CTC treatment in 5–8F cells. (B) KEGG enrichment analysis indicates the underlying pathway affected by CTC treatment in 5–8F cells. (C) Genes related to inflammation and cell cycle pathways were screened from all the raw data and compiled into a new list shown as a Heatmap. (D) mRNA level of screened genes were assessed by qRT-PCR. Each experiment was performed in triplicate. *P < 0.05, **P < 0.01 vs. the control group.
3.2. CTC induces inflammasome activation in 5–8F cells
as mean ± SD. All statistical analysis was performed using a Student’s t-test and P-values. One Way ANOVA was used and P < 0.05 was considered statistically significant. *P < 0.05, **P < 0.01.
To explore the effects of CTC on inflammation, we compared 5–8F cells transcriptomes from vehicle- and CTC- treatment. CTC treatment resulted in anti-proliferation transcriptional signature defined by 289 DEGs, involving 123 down-regulated and 166 up-regulated DEGs. The dysregulated genes were grouped and visualized as a Heatmap (Fig. 3). And further analysis revealed that CTC elicited canonical pyroptosis activation and cell cycle arrest, especially IL-6, IL-1β, ASC and Cyclins remarkably changed. The subsequent KEGG enrichment analysis revealed that the distinct difference genes were enriched in NF-κB signal, ILs signal and cell cycle (Fig. 3B). The change in expression of mRNA level should be investigated by qRT-PCR after CTC treatment (Fig. 3D). Consistently, CTC treatment significantly decreased the expression of CDKs and Cyclins, whereas the inflammatory cytokines IL-6, IL-1β, TLR4, and ASC were remarkably increased. These findings demonstrate CTC affects the cell cycle and inflammasome activation in 5–8F cells.
3. Results 3.1. CTC inhibits cell viability and proliferation of NPC cells The effect of CTC on cell viability of NP69, 6–10B and 5–8F cells was evaluated by MTT assay. These cell lines were treated with vehicle control (0.1 % DMSO) and elevated concentrations of CTC (0–14 μM) for 24, 48 h. As shown in Fig. 2, the results demonstrate that the cell viability remarkably decreased in a dose- and time-dependent manner in CTC treated cells. The IC50 values of CTC on these cell lines were also summarized (Table 3). Interestingly, 5–8F cells (IC50:6.84 ± 0.43 μM for 24 h, 5.11 ± 0.38 μM for 48 h respectively) were more sensitive to CTC treatment than NP69 and 6-10B cells at different time points. 4
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 4. CTC induces G2/M phase cell cycle arrest of 5–8F cells. (A) 5–8F cells were treated with CTC (3, 6 or 9 μM) for 24 and 48 h respectively. Cells were stained with PI and then the percentage of cell cycle distribution was determined by flow cytometry. (B) The regulation of Cyclin B1, Cyclin D1, CDK4, CDK6 and CDC25A in CTC-treated cells was detected by western blot. (D) Western blot results showed the expression of P53, P27, P21. Each experiment was repeated in triplicate. *P < 0.05, **P < 0.01 vs. the control group.
cells were determined by PI staining using flow cytometry. As shown in Fig. 4A, there was a significant amount of cell accumulation at G2/M phase in a dose- and time-dependent manner. To understand the potential molecular events associated with CTC-induced growth arrest in 5–8F cells, a variety of cell cycle regulatory cytokines were examined.
3.3. CTC induces G2/M phase cell cycle arrest of 5–8F cells Since CTC inhibited 5–8F cells proliferation, we further clarified whether CTC induced cell cycle arrest. 5–8F cells were treated with CTC of 3, 6 or 9 μM for 24 and 48 h respectively, then the DNA content in 5
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 5. CTC elicits pyroptotic event in 5–8F cells. (A) Western blot results showed the expression of PKR, IL-1β, Caspase-1, Cleaved Caspase-1, GSDMD-F, GSDMDN, P-NF-κB, NF-κB by the indicated antibodies after CTC treatment in 5–8F cells for 24 h. (B) The expression of P38/MAPK, P-P38/MAPK, ERK 1/2, P-ERK 1/2, JNK and P-JNK was detected by western blot. β-actin was used as a loading control. Each experiment was performed in triplicate. Data were shown as means ± SD. *P < 0.05, **P < 0.01.
cell lysis [14]. To investigate whether CTC treatment induce pyroptosis in 5–8F cells, the core proteins involved in pyroptotic event were examined. As shown in Fig. 5A, the expression of initiator Caspase-1 was down-regulated, whereas activation of capase-1 and phosphorylation of NF-κB/P65 were significantly increased, which further led to the cleavage of GSDMD. In addition, we further investigated the effect of CTC on MAPK signaling pathway as shown in Fig. 5B, the expression of level of P-JNK was considerably up-regulated in a dose-manner, whereas the expression of P-ERK and P-P38/MAPK did not change obviously.
Western blot demonstrated that the expression of CDK4, CDK6, cyclin D1, cyclin B1 and CDC25A protein were substantially decreased in a dose-dependent manner, as shown in Fig. 4B. Meanwhile, the proteins of P53, P21 and P27 were significantly increased, especially at high concentrations Fig. 4C. Taken together, CTC causes proliferation arrest in the G2/M phase in 5–8F cells probably through up-regulating P53, P27 and P21, following by inhibiting the expression of CDKs and Cyclins. 3.4. CTC triggers pyroptotic event in 5–8F cells through cleaving GSDMD
3.5. Inhibition of PKR protects CTC-induced pyroptosis through PKR/JNK axis in 5–8F cells
Pyroptosis is a form of programmed cell death, accompanied by inflammatory cytokines release. Pyroptosis occurs when GSDMD, the effector molecular, is cleaved to generate C-terminal and N-terminal fragments after Asp275. The N-terminal GSDMD can assemble to form pores in the plasma membrane. Then the active mature cytokines, IL-18 and IL-1β, can be released through GSDMD pores, and eventually cause
In human 5–8F cells, transduced with a PKR shRNA or control scramble lentivirus Fig. 6A and Supplemental Fig. 1, PKR downregulation resulted in a significant promotion of cell growth. We further checked whether CTC was able to activate PKR/JNK axis and induced 6
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 6. CTC elicits inflammasome-induced pyroptosis through activating PKR/JNK/NF-κB signal in 5–8F cells. (A) Photograph of 5–8F cells transduced with scramble shRNA or PKR shRNA (magnification × 200, scale bar: 100 μm). (B,C) To determine whether PKR is upstream factor of pyroptotic pathway, 5–8F cells were incubated with CTC in the presence of different inhibitors shRNA PKR, JNK inhibitor (SP600125, 20 μM) and NF-κB inhibitor (JSH-23, 20 μM) for 24 h, cell growth was determined at different periods. LDH enzyme activity was measured in supernatant, **P < 0.01 versus Scramble shRNA group. #P < 0.01, $P < 0.01, and @ P < 0.01 versus CTC group. (C,D) Cultured 5–8 F cells were incubated with CTC in the presence of shRNA PKR, JNK inhibitor or NF-κB inhibitor, the protein level of P-JNK, JNK, IL-1β, Caspase-1, Cleaved Caspase-1, GSDMD-F, GSDMD-N, P-NF-κB, NF-κB was examined. β-actin was used as a loading control. Experiments were performed in triplicate. Each experiment was performed in triplicate. Data were shown as means ± SD. *P < 0.05, **P < 0.01.
pyroptotic event through inhibiting the Cleaved Caspase-1, p-NF-κB and p-JNK, IL-1β activation, as well as the GSDMD-N also decreased. Together, CTC exerts inflammasome-induced pyroptosis through activating PKR/JNK signal in 5–8F cells.
programmed cell death. The group which treated with CTC along showed significant decrease in cell growth compared with CTC co-incubated with different inhibitors such as shPKR, JNK inhibitor (SP600125) and NF-κB inhibitor (JSH-23) Fig. 6B. Interestingly, neither JNK inhibitor (SP600125) or NF-κB inhibitor (JSH-23) could alleviate the expression of PKR after treated with CTC for 24 h, except for shPKR group. We also investigated the level of LDH from cell supernatants after incubation with CTC and different inhibitors Fig. 6C. The activity of LDH was remarkably increased in CTC treatment group, whereas a significant attenuation was assessed in CTC co-incubated with different inhibitors group. These data indicate that CTC treatment induces pyroptotic tumor cell death via activating PKR/JNK signal. To estimate the effects of CTC on canonical inflammasome pathway in 5–8F cells, we examined the core inflammtory cytokines including IL-1β, p-NF-κB, pJNK, Caspase-1 and GSDMD at protein level as shown in Fig. 6D,E. These different inhibitors substantially attenuated CTC induced
4. Discussion Traditional Chinese medicine has been widely used for the prevention, treatment, and cure of disorders or diseases for thousands years [22]. In addition to being used as therapeutic agents, herbal medicine are also an crucial sources for new drug discoveries and pharmacological drug researches. Increasing evidence indicate that natural products, especially casticin, exhibit diverse biological activities, including anti-oxdidant, anti-inflammatory, anti-tumor effects [23–25]. At present, many studies have shown that casticin has a unique advantage in anti-tumor effect, which could inhibit the 7
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 7. Schematic diagram depicts signaling pathway responsible for CTC-induced pyroptosis in 5–8F cells.
identify whether PKR is an upstream factor in regulating the process of GSDMD-dependent pyroptotic tumor cell death, 5–8F cells were incubated with CTC in presence of different inhibitors. Interestingly, we observed that inhibition of PKR or co-incubated with JNK inhibitor, NFκB inhibitor remarkably decreased the activity of enzyme lactate dehydrogenase (LDH) in 5–8F cells compared with CTC-treatment along Fig. 6C. Davis MA [30] has reported that LDH usually released from cytosol in pathological state due to loss of cell membrane, which further validated the relationship among PKR and JNK, NF-κB, GSDMD. In our study, inhibition of PKR can suppress JNK and NF-κB phosphorylation, attenuates GSDMD-dependent pyroptosis and downstream cytokines expression, which suggests that CTC elicits inflammasome-induced pyroptosis through activating PKR/JNK signal. In summary, our present study demonstrates that CTC inhibits 5–8F cell proliferation through inducing cell cycle arrest and pyroptotic process (summarized in Fig. 7). Moreover, PKR/JNK axis is essential for CTC eliciting caspase-1 inflammasome formation and inflammatory cytokines release in 5–8F cell.
proliferation of a variety of tumor cells, and thus become a plant-derived natural product for anti-tumor candidate drug [26]. However, the underlying mechanisms of CTC inhibiting the proliferation and inducing pyroptosis of NPC cells remain largely unknown. In this study, we focused on investigating the ability of CTC on inhibiting NPC cell progression and demonstrated the underlying molecular mechanism responsible for NPC cell death in vitro. The results of cell viability showed that CTC significantly inhibited 5–8F cell proliferation in a dose- and time-dependent manner with IC50 = 6.84 ± 0.43 μM at 24 h and 5.11 ± 0.38 μM at 48 h. Meanwhile, we next investigated the RNA-Seq analysis of overall transcriptomic changes in 5–8F cells. We found that CTC induced cell cycle arrest and pyroptotic event through modulating CDK4, Cyclin D1, IL-1β and ASC etc, which significantly enriched in NF-κB signal, ILs signal and cell cycle. Furthermore, the flow cytometer assasy showed that CTC increased the percentage of G2/M phase and then the core proteins involved in cell cycle were detected, which consistent with the RNA-seq results. Research groups led by Vishva M Dixit [27] and Feng shao [12] independently found that GSDMD was the core executor for pyroptotic cell death, which could be cleaved by inflammatory caspase-1,4,5 at conserved residue D276 and generated N-terminal fragments to perforate in the membrane. During the pyroptosis with plasma membrane rupture, several inflammatory factors, including IL-18 and IL-1β, released into extracellular [28]. Western blot demonstrated that CTC induced pyroptosis through activating the caspase-1 and GSDMD, the proinflammatory cytokines IL-1β was also up-regulated in a dosemanner Fig. 5A. Taken the RNA-seq results into consideration, the increased level of PKR mRNA and proinflammatory cytokines induced by CTC led us to hypothesize that PKR seemed to exert as upstream factor in regulating MAPK signal and inflammatory infiltration. PKR is known to regulate cell inflammation, proliferation and apoptosis in uninfected cell types. Many studies concluded that PKR could be activated by various stimuli and autophosphorylation, it could cause NF-κB and MAPK signaling pathway activation and ultimately the canonical inflammasome activation [29]. Interestingly, we observed that CTC only induced the phosphoryaltion of JNK, whereas the P38 MAPK/JNK and ERK phosphorylation has not changed obviously. To
Declaration of ethics The authors declare that there is no ethical issue to declare. Declaration of Competing Interest The authors declare that there is no conflict of interest regarding the publication of this paper. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109576. References [1] G. Carioli, E. Negri, D. Kawakita, W. Garavello, C. La Vecchia, M. Malvezzi, Global trends in nasopharyngeal cancer mortality since 1970 and predictions for 2020: focus on low-risk areas, Int. J. Cancer 140 (May (10)) (2017) 2256–2264. [2] M.L. He, M.X. Luo, M.C. Lin, H.F. Kung, MicroRNAs: potential diagnostic markers
8
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10] [11] [12]
[13]
[14]
[15]
[16] W.T. He, H. Wan, L. Hu, P. Chen, X. Wang, Z. Huang, Z.H. Yang, C.Q. Zhong, J. Han, Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion, Cell Res. 25 (December (12)) (2015) 1285–1298. [17] J. Yuan, A. Najafov, B.F. Py, Roles of caspases in necrotic cell death, Cell 167 (December (7)) (2016) 1693–1704. [18] F. Borghese, F. Sorgeloos, T. Cesaro, T. Michiels, The leader protein of Theiler’s virus prevents the activation of PKR by dsRNA, J. Virol. (July) (2019) pii: JVI.01010-19. [19] Z.M. Zheng, Circular RNAs and RNase L in PKR activation and virus infection, Cell Biosci. 9 (May) (2019) 43. [20] T. Watanabe, T. Lmamura, Y. Hiasa, Roles of protein kinase R in cancer: potential as a therapeutic target, Cancer Sci. 109 (April (4)) (2018) 919–925. [21] H.W. Chiu, L.H. Li, C.Y. Hsieh, Y.K. Rao, F.H. Chen, A. Chen, S.M. Ka, K.F. Hua, Glucosamine inhibits IL-1β expression by preserving mitochondrial integrity and disrupting assembly of the NLRP3 inflammasome, Sci. Rep. 9 (April (1)) (2019) 5603. [22] D. Cyranoski, Why Chinese medicine is heading for clinics around the world, Nature 561 (September (7724)) (2018) 448–450. [23] S.M. Lee, Y.J. Lee, Y.C. Kim, J.S. Kim, D.G. Kang, H.S. Lee, Vascular protective role of vitexicarpin isolated from Vitex rotundifolia in human umbilical vein endothelial cells, Inflammation 35 (April (2)) (2012) 584–593. [24] Y.Q. Zhang, Z.H. Wen, K. Wan, D. Yuan, X. Zeng, G. Liang, J. Zhu, B. Xu, H. Luo, A novel synthesized 3′, 5′-diprenylated chalcone mediates the proliferation of human leukemia cells by regulating apoptosis and autophagy pathways, Biomed. Pharmacother. 106 (October) (2018) 794–804. [25] C.J. Liou, C.Y. Cheng, K.W. Yeh, Y.H. Wu, W.C. Huang, Protective effects of casticin from Vitex trifolia alleviate eosinophilic airway inflammation and oxidative stress in a murine asthma model, Front. Pharmacol. 9 (June) (2018) 635. [26] K. Haïdara, L. Zamir, Q.W. Shi, G. Batist, The flavonoid Casticin has multiple mechanisms of tumor cytotoxicity action, Cancer Lett. 242 (October (2)) (2006) 180–190. [27] M. Lamkanfi, V.M. Dixit, A new lead to NLRP3 inhibition, J. Exp. Med. 214 (November (11)) (2017) 3147–3149. [28] N. Miao, F. Yin, H. Xie, Y. Wang, Y. Xu, Y. Shen, D. Xu, J. Yin, B. Wang, Z. Zhou, Q. Cheng, P. Chen, H. Xue, L. Zhou, J. Liu, X. Wang, W. Zhang, L. Lu, The cleavage of gasdermin D by caspase-11 promotes tubular epithelial cell pyroptosis and urinary IL-18 excretion in acute kidney injury, Kidney Int. (May) (2019) pii: S00852538(19)30517-4. [29] S. Mangali, A. Bhat, M.P. Udumula, I. Dhar, D. Sriram, A. Dhar, Inhibition of protein kinase R protects against palmitic acid-induced inflammation, oxidative stress, and apoptosis through the JNK/NF-kB/NLRP3 pathway in cultured H9C2 cardiomyocytes, J. Cell. Biochem. 120 (March (3)) (2019) 3651–3663. [30] M.A. Davis, M.R. Fairgrieve, A. Den Hartigh, O. Yakovenko, B. Duvvuri, C. Lood, W.E. Thomas, S.L. Fink, M. Gale Jr., Calpain drives pyroptotic vimentin cleavage, intermediate filament loss, and cell rupture that mediates immunostimulation, Proc. Natl. Acad. Sci. U. S. A. 116 (March (11)) (2019) 5061–5070..
and therapeutic targets for EBV-associated nasopharyngeal carcinoma, Biochim. Biophys. Acta 1825 (January (1)) (2012) 1–10. X.Y. Kong, J.X. Lu, Zhang J. Yu XW, Q.L. Xu, R.J. Zhang, J.L. Mi, S.F. Liao, J.F. Fan, X.L. Qin, D.C. Yao, H.Y. Tang, W. Jiang, Gemcitabine plus cisplatin versus fluorouracil plus cisplatin as a first-line concurrent chemotherapy regimen in nasopharyngeal carcinoma: a prospective, multi-institution, randomized controlled phase II study, Cancer Chemother. Pharmacol. 84 (July (1)) (2019) 155–161. L.R. Ke, W.X. Xia, W.Z. Qiu, X.J. Huang, Liang H. Yu YH, G.Y. Liu, Y.Q. Xiang, X. Guo, X. Lv, A phase II trial of induction NAB-paclitaxel and cisplatin followed by concurrent chemoradiotherapy in patients with locally advanced nasopharyngeal carcinoma, Oral Oncol. 70 (July) (2017) 7–13. J. Kobayakawa, F. Sato-Nishimori, M. Moriyasu, Y. Matsukawa, G2-M arrest and antimitotic activity mediated by casticin, a flavonoid isolated from Viticis Fructus (Vitex rotundifolia Linne fil.), Cancer Lett. 208 (May (1)) (2004) 59–64. J.H. Lee, C. Kim, J.Y. Um, G. Sethi, K.S. Ahn, Casticin-induced inhibition of cell growth and survival are mediated through the dual modulation of Akt/mTOR signaling cascade, Cancers (Basel) 11 (February (2)) (2019) pii: E254. A.C. Huang, Y.D. Cheng, L.H. Huang, Y.T. Hsiao, S.F. Peng, K.W. Lu, J.C. Lien, J.L. Yang, T.S. Lin, J.G. Chung, Casticin induces DNA damage and impairs DNA repair in human bladder cancer TSGH-8301 cells, Anticancer Res. 39 (April (4)) (2019) 1839–1847. X.L. Song, Y.J. Zhang, X.F. Wang, W.J. Zhang, Z. Wang, F. Zhang, Y.J. Zhang, J.H. Lu, J.W. Mei, Y.P. Hu, L. Chen, H.F. Li, Y.Y. Ye, Y.B. Liu, J. Gu, Casticin induces apoptosis and G0/G1 cell cycle arrest in gallbladder cancer cells, Cancer Cell Int. 17 (January) (2017) 9. G.L. Chou, S.F. Peng, C.L. Liao, H.C. Ho, K.W. Lu, J.C. Lien, M.J. Fan, K.C. La, J.G. Chung, Casticin impairs cell growth and induces cell apoptosis via cell cycle arrest in human oral cancer SCC-4 cells, Environ. Toxicol. 33 (February (2)) (2018) 127–141. S. Nagata, M. Tanaka, Programmed cell death and the immune system, Nat. Rev. Immunol. 17 (May (5)) (2017) 333–340. D.R. Green, The coming decade of cell death research: five riddles, Cell 177 (May (5)) (2019) 1094–1107. Y. Wang, W. Gao, X. Shi, J. Ding, W. Liu, H. He, K. Wang, F. Shao, Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin, Nature 547 (July (7661)) (2017) 99–103. C. Rogers, D.A. Erkes, A. Nardone, A.E. Aplin, T. Fernandes-Alnemri, E.S. Alnemri, Gasdermin pores permeabilize mitochondria to augment caspase-3 activation during apoptosis and inflammasome activation, Nat. Commun. 10 (April (1)) (2019) 1689. J. Shi, Y. Zhao, K. Wang, X. Shi, Y. Wang, H. Huang, Y. zhuang, T. Cai, F. Wang, F. Shao, Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death, Nature 526 (October (7575)) (2015) 660–665. K. Tsuchiya, S. Nakajima, S. Hosojima, D. Thi Nguyen, T. Hattori, T. Manh Le, O. Hori, M.R. Mahib, Y. Yamaguchi, M. Miura, T. Kinoshita, H. Kushiyama, M. Sakurai, T. Shiroishi, T. Suda, Caspase-1 initiates apoptosis in the absence of gasdermin D, Nat. Commun. 10 (May (1)) (2019) 2091.
9
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Casticin elicits inflammasome-induced pyroptosis through activating PKR/ JNK/NF-κB signal in 5-8F cells
T
Chenyan Jianga, Runjie Shia, Bin Chena, Xiaojun Yana, Guoyao Tangb,* a b
Department of Otorhinolaryngology Head and Neck Surgery, Shanghai 9th Peoples Hospital Affiliated to Shanghai Jiaotong University School of Medicine, China Department of Oral Mucosa, Shanghai 9th Peoples Hospital Affiliated to Shanghai Jiaotong University School of Medicine, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Pyroptosis Cell cycle PKR 5-8F cells GSDMD
Casticin is one of the effective ingredients of fructus viticis. Most studies have shown that casticin has a strong anti-proliferation activity against various tumor cells. However, its anti-tumor effect and molecular mechanism in nasopharyngeal carcinoma remain unclear. In this study, we demonstrated that the casticin selectively inhibited the proliferation of 5–8F cells in vitro. Further analysis revealed that casticin treatment significantly increased sub-G2 phase and incited pyroptotic process. Moreover, we demonstrated that PKR participated in in regulating the process of GSDMD-dependent pyroptotic tumor cell death. PKR knockdown alleviated the activation of JNK pathway and the expression of its downstream proteins, including cleaved caspase-1, GSDMD-N, interleukin-1β. These findings indicate that PKR/JNK/NF-κB signal is essential for casticin-induced caspase-1 inflammasome formation and inflammatory cytokines release in 5–8F cell.
1. Introduction Nasopharyngeal carcinoma (NPC) is a malignant tumor originating from the surface epithelium of the nasopharynx, which incidence is the highest among malignancies of the ear, nose, and throat [1]. And NPC is endemic in South-eastern Asia, with a poor prognosis [2]. Because of the non-specific symptoms of NPC, majorities of patients with the disease are diagnosed only when the tumor has reached an advanced stage. The kind of 5–8F cell is one of the most common types in NPC patients with cervical lymph node metastasis [3]. Clinical studies have shown that treatment of NPC patients can use cisplatin-based induction chemotherapy followed by radiation-based locoregional treatment. Unfortunately, approximately 30 % of patients will show isolated local recurrence and metastasis after treatment [4]. Therefore, to identify potential curative anticancer drugs is of great importance for advanced NPC patients. Casticin (CTC), also known as vitexicarpin, is a polymethoxylated flavonoid compound with a wide range of pharmacological activities extracted from the traditional Chinese medicine fructus viticis (CTC, Fig. 1) [5]. In recent years, CTC served as the main active ingredient of fructus viticis against tumor due to their unique structure. Some studies demonstrated that CTC caused cell cycle arrest in G2/M phase and induced apoptosis in some tumor cells through interference with spindle formation without affecting other microtubule functions during
⁎
anaphase and telephase [6–8]. Meanwhile, it also induced P21 protein expression and inhibited CDK1 activity, blocking cells to the G2/M phase transition [9]. The term pyroptosis was initially proposed by Brennan and Cookson for a novel form of inflammatory programmed cell death (PCD) and different from other types of apoptosis or necroptosis [10]. Programmed pyroptosis is now defined by its dependence on a dedicated set of inflammatory caspases, such as caspase-1,-4 and, -5 in humans, and caspase-1,and-11 in mice. Mechanistically, pyroptosis is driven by two distinct signaling pathways, either canonical pyroptosis or noncanonical pyroptosis [11–13]. Under the stimulation of various pathological stimuli, inflammsomes are assembled to activate proinflammtory caspases. The terminal cell lysis is mediated by cleavage of gasdermin D (GSDMD) by one of these caspases, then the N-terminal fragements will be translocated to the membrane and perforate [14]. Subsequently abundant damage-associated molecular pattern molecules (DAMPs), such as the matured form of interleukin-18 (IL-18) and interleukin-1β (IL-1β), are released into extracellular environment during cell dying induced by pyroptosis [15–17]. Ultimately, these cytoplasmic inflammatory content attract effector cells of the immune system to active sites during primary infection. Protein kinase R (PKR) is a serine-threonine kinase encoded by the EIF2AK2 gene, which is activated by various forms of stress signals and plays a critical role in central cellular processes, such as regulation of
Corresponding author. E-mail address: [email protected] (G. Tang).
https://doi.org/10.1016/j.biopha.2019.109576 Received 26 August 2019; Received in revised form 15 October 2019; Accepted 21 October 2019 0753-3322/ © 2020 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
were procured from Sigma Aldrich. Specific antibodies for PKR (12297, 1:1000), JNK (9252, 1:1000), P-JNK (4668, 1:1000), CDK4 (12790, 1:1000), CDK6 (13331, 1:1000), Cyclin D1 (2978, 1:1000), Cyclin B1 (12231, 1:1000), CDC25A (3652, 1:1000), IL-1β (12703, 1:1000), GSDMD (93709, 1:1000), ERK1/2 (4695, 1:1000), P-ERK1/2 (9101, 1:1000), P38/MAPK (8690, 1:1000), P-P38/MAPK (4511, 1:1000) were obtained from (CST, Danvers, MA, USA), antibodies for caspase-1 (ab207802, 1:1000), P21 (ab109520, 1:5000), P27 (ab32034, 1:5000), P53 (ab32389, 1:1000), NF‐kB/P65 (ab16502, 1:1000), P-NF‐kB/P65 (ab86299, 1:2000) and all the secondary antibodies were purchased from (Abcam, Cambridge, UK). UltraSYBR Green Mixture (CW0659) and HiFiScript cDNA Synthesis Kit (CW2569) were obtained from cwbiotech (Beijing, China). LDH detection Kit (C0016) purchased from Beyotime (Shanghai, China). Primers and shRNA PKR were prepared by Invitrogen (Shanghai, China).
Fig. 1. Chemical structure of CTC.
2.2. Cell culture
Table 1 Primer sequences used in this study. Genes
Primer
Primer Sequence (5′→3′)
PKR
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
CGGAAGGACACGGCATCAAGAT GAGCCAGGAAAACCTTCTCTGC AGCTCACCGCTAACGTGCTGC GCTTGGCTGCCGACTGAGGAG CCATCAGCACAGTTCGTGAGGT TCAGTTCGGGATGTGGCACAGA GGATAAAGTTCCAGAGCCTGGAG GCGATGCACTACTCGGTGTGAA TCTACACCGACAACTCCATCCG TCTGGCATTTTGGAGAGGAAGTG GACCTGTGTCAGGCTTTCTCTG GGTATTTTGGTCTGACTGCTTGC GGACTGAAGCACCTGTTGTGCA TCCTGAGTCTCCCAAGGCATTC CCCTGAGGCATTTAGGCAGCTA AGGTAGAGAGGTGGCTTAGGCT AGACAGCCACTCACCTCTTCAG TTCTGCCAGTGCCTCTTTGCTG CCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG ATGAGGTGCCTCCACAACTTCC CCAGTTCCTTGGAGATGGTCTC GCTGAGGTTGACATCACAGGCA TGCTGTCAGAGGTCTTGTGCTC GCCAACACAGTGCTGTCT AGGAGCAATGATCTTGATCTT
ASC CDK 4 CDK 6 Cyclin D1 Cyclin B1 NLRP3 TLR4 IL-6 IL-1β GSDMD Caspase-1 β-actin
Human normal nasopharyngeal epithelial cell line NP69, human NPC cell lines 6–10B and 5–8F were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in DMEM medium, supplemented with 10 % fetal bovine serum (Sijiqing, Hangzhou, China) at 37 ℃ in a CO2 incubator (5 % CO2 and 95 % air, 95 % humidity). 2.3. Cell proliferation assay Cells (8 × 103) were seeded into 96-well plate and incubated at 37 ℃ for 24 h, then treated with various concentrations of CTC (2, 4, 6, 8, 10, 12, 14 μM) for the indicated time (24, 48 h). 20 μL MTT (5 mg/mL) solution was added to each well and incubated for 4 h. Formazan crystals were dissolved in DMSO and measured using a multiwell sepctrophotometer (BioTek, Winooski, VT, USA) at 490 nm. 2.4. Cell cycle assay 5–8F cells (2 × 105) were seeded in 6-wells and then treated with CTC for 24, 48 h. Then cells were trypsinized and washed twice with cold PBS. For cell cycle analysis, cells were fixed by cold 75 % ethanol overnight at −20 ℃. After centrifuged at 1000 rpm for 5 min, cells were digested with RNaseA and stained with PI in the dark room for 30 min at 37 ℃, then analyzed by flow cytometer (Becton Dickinson, Franklin Lakes, USA).
Table 2 The sequence of PKR shRNA.
2.5. RNA extraction and sequencing
Gene
Sequence
Species
PKR PKR PKR PKR
GTGACTTGCGGTCACAGTGGCATTCAGCT TAGTGACCAGCACACTCGCTTCTGAATCA CTGAAGGTGACTTCTCAGCAGATACATCA ATACTAAGGACCTTGACTGTGTGGAAGAA
Human Human Human Human
shRNA-1 shRNA-2 shRNA-3 shRNA-4
The 5–8F cells were treated with CTC (6 μM) for 24 h and used for RNA sequencing detection. Total RNA was extracted with TRIzol® reagent (Invitrogen, USA) based on the manufacturer's instruction. cDNA library preparation and sequencing were carried out by BGI (shenzhen, China) Co., Ltd. Briefly, libraries for RNA-seq were constructed using TruSeq® RNA LT/HT Sample Prep Kit (Illumina, USA) following the manufacturer’s protocol. The purified libraries were assessed using the Agilent 2200 TapeStation and Qubit® 2.0 (Life Technologies, USA), and subsequently sequenced on an Illumina HiSeq 2500 with 2 × 100-bp paired-end reads. The gene expression abundance was normalized by FPKM (fragments per kilobase of exon per million fragments mapped) using Cufinks (v2.2.1). Differentially expressed genes (DEGs) were screened based on multiple differences |fold change| > 2 and significant difference in expression P-value < 0.05. Meanwhile, enrichment of KEGG pathways were analyzed based on the DEGs.
inflammation, mRNA translation and apoptosis [18,19]. In recent studies, PKR is also involved in the activation of several signal transduction pathways, such as mitogen-activated protein kinase (MAPK) [20], eIF2α, and nuclear factor of κB (NF-κB) pathway [21]. In the present study, we explored the effect of CTC on cell cell cycle and pyroptosis in 5–8F cells. Furthermore, we also investigated the effect of CTC on pyroptotic tumor cell death through activating the PKR/JNK signal. 2. Materials and methods
2.6. Quantitative real-time RT-PCR 2.1. Reagents To verify the expression of selected DEGs detected by RNA-seq, quantitative real-time PCR (qRT-PCR) amplification was performed.
Casticin, JNK inhibitor (SP600125) and NF‐kB inhibitor (JSH-23) 2
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 2. CTC inhibits the viability of NPC cells. (A) NP69, 6–10B and 5–8F cells were incubated with indicated concentrations of CTC (0–14 μM) for 24, 48 h. Cell viability was determined using MTT assay. Per condition, three independent experiments were performed. Data were shown as mean ± SD, *P < 0.05, **P < 0.01 vs. the control group.
synthesizing PKR shRNA and cloning into pGFP-C-shLenti plasmid (OriGene Technologies, Beijing,China). The sequence of PKR shRNA is shown in Table 2. Briefly, lentiviral particles carrying PKR shRNA were obtained. Then 5–8F cells were infected with PKR shRNA lentiviral particles according to the manufacturer’sprotocol. After 72 h infection, we used puromycin (Solarbio, Beijing, China) to select and produce a stable PKR-knockdown 5–8F cells. Down-regulation of PKR was validated by quantitative RT-PCR.
Table 3 IC50 values (μM) of Casticin on three cell lines for different treatment periods. Cell line
NP69 6–10B 5–8F
IC50 (μM) 24 h
48 h
9.84 ± 0.65 8.12 ± 0.54** 6.84 ± 0.43**
8.11 ± 0.61## 6.01 ± 0.55**## 5.11 ± 0.38**##
Note: **P < 0.01, vs NP69;
##
P < 0.01, vs 24 h.
2.8. Western blotting
After treatment with CTC (6 μM) for 24 h, cells were collected and total RNA was extracted using TRIzol® reagent (Invitrogen, USA). Equal amount of RNA was reverse transcribed to cDNA using HiFiScript cDNA synthesis kit and amplified using UltraSYBR Green qPCR Mixture (with ROX) reagent in a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) according to the following protocol: 10 min at 95 ℃ for the initial denaturation, followed by 95 ℃ for 15 s for 40 cycles, 60 ℃ for 1 min at the cycling stage, and 95 ℃ for 15 s, 60 ℃ for 1 min, 95 ℃ for 15 s at the melt curve stage. β-actin served as an endogenous control, and the 2−△△C method was used to calculate T relative expression levels. Primer sequences are shown in Table 1.
5–8F cells were treated with various concentrations of CTC. CTCtreated cells were incubated with different inhibitors including JNK inhibitor (SP600125) (20 μM) and NF‐kB inhibitor (JSH-23) (20 μM) for 24 h, and then harvested and lysed in RIPA buffer containing 1 % protease inhibitor PMSF for 30 min. Proteins were separated by 10 % SDS-PAGE and transferred on the PVDF membranes. After blocked by 5 % BSA, the membranes were incubated with appropriate antibodies. Immunoreactive proteins were visualized using Odyssey Platform (LICOR, Biosciences, Lincoln, NE, USA). The experiments were performed three times and densitometric analysis was performed using ImageJ software. β-actin was used as an internal control. 2.9. Statistical analysis
2.7. Knockdown of PKR expression in 5–8F cells
All experiments were conducted at least three times and expressed
The PKR shRNA construct (PKR shRNA) was generated by 3
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 3. CTC induces inflammasome activation in 5–8F cells. (A) Heatmap of genes upregulated or downregulated with CTC treatment in 5–8F cells. (B) KEGG enrichment analysis indicates the underlying pathway affected by CTC treatment in 5–8F cells. (C) Genes related to inflammation and cell cycle pathways were screened from all the raw data and compiled into a new list shown as a Heatmap. (D) mRNA level of screened genes were assessed by qRT-PCR. Each experiment was performed in triplicate. *P < 0.05, **P < 0.01 vs. the control group.
3.2. CTC induces inflammasome activation in 5–8F cells
as mean ± SD. All statistical analysis was performed using a Student’s t-test and P-values. One Way ANOVA was used and P < 0.05 was considered statistically significant. *P < 0.05, **P < 0.01.
To explore the effects of CTC on inflammation, we compared 5–8F cells transcriptomes from vehicle- and CTC- treatment. CTC treatment resulted in anti-proliferation transcriptional signature defined by 289 DEGs, involving 123 down-regulated and 166 up-regulated DEGs. The dysregulated genes were grouped and visualized as a Heatmap (Fig. 3). And further analysis revealed that CTC elicited canonical pyroptosis activation and cell cycle arrest, especially IL-6, IL-1β, ASC and Cyclins remarkably changed. The subsequent KEGG enrichment analysis revealed that the distinct difference genes were enriched in NF-κB signal, ILs signal and cell cycle (Fig. 3B). The change in expression of mRNA level should be investigated by qRT-PCR after CTC treatment (Fig. 3D). Consistently, CTC treatment significantly decreased the expression of CDKs and Cyclins, whereas the inflammatory cytokines IL-6, IL-1β, TLR4, and ASC were remarkably increased. These findings demonstrate CTC affects the cell cycle and inflammasome activation in 5–8F cells.
3. Results 3.1. CTC inhibits cell viability and proliferation of NPC cells The effect of CTC on cell viability of NP69, 6–10B and 5–8F cells was evaluated by MTT assay. These cell lines were treated with vehicle control (0.1 % DMSO) and elevated concentrations of CTC (0–14 μM) for 24, 48 h. As shown in Fig. 2, the results demonstrate that the cell viability remarkably decreased in a dose- and time-dependent manner in CTC treated cells. The IC50 values of CTC on these cell lines were also summarized (Table 3). Interestingly, 5–8F cells (IC50:6.84 ± 0.43 μM for 24 h, 5.11 ± 0.38 μM for 48 h respectively) were more sensitive to CTC treatment than NP69 and 6-10B cells at different time points. 4
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 4. CTC induces G2/M phase cell cycle arrest of 5–8F cells. (A) 5–8F cells were treated with CTC (3, 6 or 9 μM) for 24 and 48 h respectively. Cells were stained with PI and then the percentage of cell cycle distribution was determined by flow cytometry. (B) The regulation of Cyclin B1, Cyclin D1, CDK4, CDK6 and CDC25A in CTC-treated cells was detected by western blot. (D) Western blot results showed the expression of P53, P27, P21. Each experiment was repeated in triplicate. *P < 0.05, **P < 0.01 vs. the control group.
cells were determined by PI staining using flow cytometry. As shown in Fig. 4A, there was a significant amount of cell accumulation at G2/M phase in a dose- and time-dependent manner. To understand the potential molecular events associated with CTC-induced growth arrest in 5–8F cells, a variety of cell cycle regulatory cytokines were examined.
3.3. CTC induces G2/M phase cell cycle arrest of 5–8F cells Since CTC inhibited 5–8F cells proliferation, we further clarified whether CTC induced cell cycle arrest. 5–8F cells were treated with CTC of 3, 6 or 9 μM for 24 and 48 h respectively, then the DNA content in 5
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 5. CTC elicits pyroptotic event in 5–8F cells. (A) Western blot results showed the expression of PKR, IL-1β, Caspase-1, Cleaved Caspase-1, GSDMD-F, GSDMDN, P-NF-κB, NF-κB by the indicated antibodies after CTC treatment in 5–8F cells for 24 h. (B) The expression of P38/MAPK, P-P38/MAPK, ERK 1/2, P-ERK 1/2, JNK and P-JNK was detected by western blot. β-actin was used as a loading control. Each experiment was performed in triplicate. Data were shown as means ± SD. *P < 0.05, **P < 0.01.
cell lysis [14]. To investigate whether CTC treatment induce pyroptosis in 5–8F cells, the core proteins involved in pyroptotic event were examined. As shown in Fig. 5A, the expression of initiator Caspase-1 was down-regulated, whereas activation of capase-1 and phosphorylation of NF-κB/P65 were significantly increased, which further led to the cleavage of GSDMD. In addition, we further investigated the effect of CTC on MAPK signaling pathway as shown in Fig. 5B, the expression of level of P-JNK was considerably up-regulated in a dose-manner, whereas the expression of P-ERK and P-P38/MAPK did not change obviously.
Western blot demonstrated that the expression of CDK4, CDK6, cyclin D1, cyclin B1 and CDC25A protein were substantially decreased in a dose-dependent manner, as shown in Fig. 4B. Meanwhile, the proteins of P53, P21 and P27 were significantly increased, especially at high concentrations Fig. 4C. Taken together, CTC causes proliferation arrest in the G2/M phase in 5–8F cells probably through up-regulating P53, P27 and P21, following by inhibiting the expression of CDKs and Cyclins. 3.4. CTC triggers pyroptotic event in 5–8F cells through cleaving GSDMD
3.5. Inhibition of PKR protects CTC-induced pyroptosis through PKR/JNK axis in 5–8F cells
Pyroptosis is a form of programmed cell death, accompanied by inflammatory cytokines release. Pyroptosis occurs when GSDMD, the effector molecular, is cleaved to generate C-terminal and N-terminal fragments after Asp275. The N-terminal GSDMD can assemble to form pores in the plasma membrane. Then the active mature cytokines, IL-18 and IL-1β, can be released through GSDMD pores, and eventually cause
In human 5–8F cells, transduced with a PKR shRNA or control scramble lentivirus Fig. 6A and Supplemental Fig. 1, PKR downregulation resulted in a significant promotion of cell growth. We further checked whether CTC was able to activate PKR/JNK axis and induced 6
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 6. CTC elicits inflammasome-induced pyroptosis through activating PKR/JNK/NF-κB signal in 5–8F cells. (A) Photograph of 5–8F cells transduced with scramble shRNA or PKR shRNA (magnification × 200, scale bar: 100 μm). (B,C) To determine whether PKR is upstream factor of pyroptotic pathway, 5–8F cells were incubated with CTC in the presence of different inhibitors shRNA PKR, JNK inhibitor (SP600125, 20 μM) and NF-κB inhibitor (JSH-23, 20 μM) for 24 h, cell growth was determined at different periods. LDH enzyme activity was measured in supernatant, **P < 0.01 versus Scramble shRNA group. #P < 0.01, $P < 0.01, and @ P < 0.01 versus CTC group. (C,D) Cultured 5–8 F cells were incubated with CTC in the presence of shRNA PKR, JNK inhibitor or NF-κB inhibitor, the protein level of P-JNK, JNK, IL-1β, Caspase-1, Cleaved Caspase-1, GSDMD-F, GSDMD-N, P-NF-κB, NF-κB was examined. β-actin was used as a loading control. Experiments were performed in triplicate. Each experiment was performed in triplicate. Data were shown as means ± SD. *P < 0.05, **P < 0.01.
pyroptotic event through inhibiting the Cleaved Caspase-1, p-NF-κB and p-JNK, IL-1β activation, as well as the GSDMD-N also decreased. Together, CTC exerts inflammasome-induced pyroptosis through activating PKR/JNK signal in 5–8F cells.
programmed cell death. The group which treated with CTC along showed significant decrease in cell growth compared with CTC co-incubated with different inhibitors such as shPKR, JNK inhibitor (SP600125) and NF-κB inhibitor (JSH-23) Fig. 6B. Interestingly, neither JNK inhibitor (SP600125) or NF-κB inhibitor (JSH-23) could alleviate the expression of PKR after treated with CTC for 24 h, except for shPKR group. We also investigated the level of LDH from cell supernatants after incubation with CTC and different inhibitors Fig. 6C. The activity of LDH was remarkably increased in CTC treatment group, whereas a significant attenuation was assessed in CTC co-incubated with different inhibitors group. These data indicate that CTC treatment induces pyroptotic tumor cell death via activating PKR/JNK signal. To estimate the effects of CTC on canonical inflammasome pathway in 5–8F cells, we examined the core inflammtory cytokines including IL-1β, p-NF-κB, pJNK, Caspase-1 and GSDMD at protein level as shown in Fig. 6D,E. These different inhibitors substantially attenuated CTC induced
4. Discussion Traditional Chinese medicine has been widely used for the prevention, treatment, and cure of disorders or diseases for thousands years [22]. In addition to being used as therapeutic agents, herbal medicine are also an crucial sources for new drug discoveries and pharmacological drug researches. Increasing evidence indicate that natural products, especially casticin, exhibit diverse biological activities, including anti-oxdidant, anti-inflammatory, anti-tumor effects [23–25]. At present, many studies have shown that casticin has a unique advantage in anti-tumor effect, which could inhibit the 7
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
Fig. 7. Schematic diagram depicts signaling pathway responsible for CTC-induced pyroptosis in 5–8F cells.
identify whether PKR is an upstream factor in regulating the process of GSDMD-dependent pyroptotic tumor cell death, 5–8F cells were incubated with CTC in presence of different inhibitors. Interestingly, we observed that inhibition of PKR or co-incubated with JNK inhibitor, NFκB inhibitor remarkably decreased the activity of enzyme lactate dehydrogenase (LDH) in 5–8F cells compared with CTC-treatment along Fig. 6C. Davis MA [30] has reported that LDH usually released from cytosol in pathological state due to loss of cell membrane, which further validated the relationship among PKR and JNK, NF-κB, GSDMD. In our study, inhibition of PKR can suppress JNK and NF-κB phosphorylation, attenuates GSDMD-dependent pyroptosis and downstream cytokines expression, which suggests that CTC elicits inflammasome-induced pyroptosis through activating PKR/JNK signal. In summary, our present study demonstrates that CTC inhibits 5–8F cell proliferation through inducing cell cycle arrest and pyroptotic process (summarized in Fig. 7). Moreover, PKR/JNK axis is essential for CTC eliciting caspase-1 inflammasome formation and inflammatory cytokines release in 5–8F cell.
proliferation of a variety of tumor cells, and thus become a plant-derived natural product for anti-tumor candidate drug [26]. However, the underlying mechanisms of CTC inhibiting the proliferation and inducing pyroptosis of NPC cells remain largely unknown. In this study, we focused on investigating the ability of CTC on inhibiting NPC cell progression and demonstrated the underlying molecular mechanism responsible for NPC cell death in vitro. The results of cell viability showed that CTC significantly inhibited 5–8F cell proliferation in a dose- and time-dependent manner with IC50 = 6.84 ± 0.43 μM at 24 h and 5.11 ± 0.38 μM at 48 h. Meanwhile, we next investigated the RNA-Seq analysis of overall transcriptomic changes in 5–8F cells. We found that CTC induced cell cycle arrest and pyroptotic event through modulating CDK4, Cyclin D1, IL-1β and ASC etc, which significantly enriched in NF-κB signal, ILs signal and cell cycle. Furthermore, the flow cytometer assasy showed that CTC increased the percentage of G2/M phase and then the core proteins involved in cell cycle were detected, which consistent with the RNA-seq results. Research groups led by Vishva M Dixit [27] and Feng shao [12] independently found that GSDMD was the core executor for pyroptotic cell death, which could be cleaved by inflammatory caspase-1,4,5 at conserved residue D276 and generated N-terminal fragments to perforate in the membrane. During the pyroptosis with plasma membrane rupture, several inflammatory factors, including IL-18 and IL-1β, released into extracellular [28]. Western blot demonstrated that CTC induced pyroptosis through activating the caspase-1 and GSDMD, the proinflammatory cytokines IL-1β was also up-regulated in a dosemanner Fig. 5A. Taken the RNA-seq results into consideration, the increased level of PKR mRNA and proinflammatory cytokines induced by CTC led us to hypothesize that PKR seemed to exert as upstream factor in regulating MAPK signal and inflammatory infiltration. PKR is known to regulate cell inflammation, proliferation and apoptosis in uninfected cell types. Many studies concluded that PKR could be activated by various stimuli and autophosphorylation, it could cause NF-κB and MAPK signaling pathway activation and ultimately the canonical inflammasome activation [29]. Interestingly, we observed that CTC only induced the phosphoryaltion of JNK, whereas the P38 MAPK/JNK and ERK phosphorylation has not changed obviously. To
Declaration of ethics The authors declare that there is no ethical issue to declare. Declaration of Competing Interest The authors declare that there is no conflict of interest regarding the publication of this paper. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109576. References [1] G. Carioli, E. Negri, D. Kawakita, W. Garavello, C. La Vecchia, M. Malvezzi, Global trends in nasopharyngeal cancer mortality since 1970 and predictions for 2020: focus on low-risk areas, Int. J. Cancer 140 (May (10)) (2017) 2256–2264. [2] M.L. He, M.X. Luo, M.C. Lin, H.F. Kung, MicroRNAs: potential diagnostic markers
8
Biomedicine & Pharmacotherapy 123 (2020) 109576
C. Jiang, et al.
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10] [11] [12]
[13]
[14]
[15]
[16] W.T. He, H. Wan, L. Hu, P. Chen, X. Wang, Z. Huang, Z.H. Yang, C.Q. Zhong, J. Han, Gasdermin D is an executor of pyroptosis and required for interleukin-1β secretion, Cell Res. 25 (December (12)) (2015) 1285–1298. [17] J. Yuan, A. Najafov, B.F. Py, Roles of caspases in necrotic cell death, Cell 167 (December (7)) (2016) 1693–1704. [18] F. Borghese, F. Sorgeloos, T. Cesaro, T. Michiels, The leader protein of Theiler’s virus prevents the activation of PKR by dsRNA, J. Virol. (July) (2019) pii: JVI.01010-19. [19] Z.M. Zheng, Circular RNAs and RNase L in PKR activation and virus infection, Cell Biosci. 9 (May) (2019) 43. [20] T. Watanabe, T. Lmamura, Y. Hiasa, Roles of protein kinase R in cancer: potential as a therapeutic target, Cancer Sci. 109 (April (4)) (2018) 919–925. [21] H.W. Chiu, L.H. Li, C.Y. Hsieh, Y.K. Rao, F.H. Chen, A. Chen, S.M. Ka, K.F. Hua, Glucosamine inhibits IL-1β expression by preserving mitochondrial integrity and disrupting assembly of the NLRP3 inflammasome, Sci. Rep. 9 (April (1)) (2019) 5603. [22] D. Cyranoski, Why Chinese medicine is heading for clinics around the world, Nature 561 (September (7724)) (2018) 448–450. [23] S.M. Lee, Y.J. Lee, Y.C. Kim, J.S. Kim, D.G. Kang, H.S. Lee, Vascular protective role of vitexicarpin isolated from Vitex rotundifolia in human umbilical vein endothelial cells, Inflammation 35 (April (2)) (2012) 584–593. [24] Y.Q. Zhang, Z.H. Wen, K. Wan, D. Yuan, X. Zeng, G. Liang, J. Zhu, B. Xu, H. Luo, A novel synthesized 3′, 5′-diprenylated chalcone mediates the proliferation of human leukemia cells by regulating apoptosis and autophagy pathways, Biomed. Pharmacother. 106 (October) (2018) 794–804. [25] C.J. Liou, C.Y. Cheng, K.W. Yeh, Y.H. Wu, W.C. Huang, Protective effects of casticin from Vitex trifolia alleviate eosinophilic airway inflammation and oxidative stress in a murine asthma model, Front. Pharmacol. 9 (June) (2018) 635. [26] K. Haïdara, L. Zamir, Q.W. Shi, G. Batist, The flavonoid Casticin has multiple mechanisms of tumor cytotoxicity action, Cancer Lett. 242 (October (2)) (2006) 180–190. [27] M. Lamkanfi, V.M. Dixit, A new lead to NLRP3 inhibition, J. Exp. Med. 214 (November (11)) (2017) 3147–3149. [28] N. Miao, F. Yin, H. Xie, Y. Wang, Y. Xu, Y. Shen, D. Xu, J. Yin, B. Wang, Z. Zhou, Q. Cheng, P. Chen, H. Xue, L. Zhou, J. Liu, X. Wang, W. Zhang, L. Lu, The cleavage of gasdermin D by caspase-11 promotes tubular epithelial cell pyroptosis and urinary IL-18 excretion in acute kidney injury, Kidney Int. (May) (2019) pii: S00852538(19)30517-4. [29] S. Mangali, A. Bhat, M.P. Udumula, I. Dhar, D. Sriram, A. Dhar, Inhibition of protein kinase R protects against palmitic acid-induced inflammation, oxidative stress, and apoptosis through the JNK/NF-kB/NLRP3 pathway in cultured H9C2 cardiomyocytes, J. Cell. Biochem. 120 (March (3)) (2019) 3651–3663. [30] M.A. Davis, M.R. Fairgrieve, A. Den Hartigh, O. Yakovenko, B. Duvvuri, C. Lood, W.E. Thomas, S.L. Fink, M. Gale Jr., Calpain drives pyroptotic vimentin cleavage, intermediate filament loss, and cell rupture that mediates immunostimulation, Proc. Natl. Acad. Sci. U. S. A. 116 (March (11)) (2019) 5061–5070..
and therapeutic targets for EBV-associated nasopharyngeal carcinoma, Biochim. Biophys. Acta 1825 (January (1)) (2012) 1–10. X.Y. Kong, J.X. Lu, Zhang J. Yu XW, Q.L. Xu, R.J. Zhang, J.L. Mi, S.F. Liao, J.F. Fan, X.L. Qin, D.C. Yao, H.Y. Tang, W. Jiang, Gemcitabine plus cisplatin versus fluorouracil plus cisplatin as a first-line concurrent chemotherapy regimen in nasopharyngeal carcinoma: a prospective, multi-institution, randomized controlled phase II study, Cancer Chemother. Pharmacol. 84 (July (1)) (2019) 155–161. L.R. Ke, W.X. Xia, W.Z. Qiu, X.J. Huang, Liang H. Yu YH, G.Y. Liu, Y.Q. Xiang, X. Guo, X. Lv, A phase II trial of induction NAB-paclitaxel and cisplatin followed by concurrent chemoradiotherapy in patients with locally advanced nasopharyngeal carcinoma, Oral Oncol. 70 (July) (2017) 7–13. J. Kobayakawa, F. Sato-Nishimori, M. Moriyasu, Y. Matsukawa, G2-M arrest and antimitotic activity mediated by casticin, a flavonoid isolated from Viticis Fructus (Vitex rotundifolia Linne fil.), Cancer Lett. 208 (May (1)) (2004) 59–64. J.H. Lee, C. Kim, J.Y. Um, G. Sethi, K.S. Ahn, Casticin-induced inhibition of cell growth and survival are mediated through the dual modulation of Akt/mTOR signaling cascade, Cancers (Basel) 11 (February (2)) (2019) pii: E254. A.C. Huang, Y.D. Cheng, L.H. Huang, Y.T. Hsiao, S.F. Peng, K.W. Lu, J.C. Lien, J.L. Yang, T.S. Lin, J.G. Chung, Casticin induces DNA damage and impairs DNA repair in human bladder cancer TSGH-8301 cells, Anticancer Res. 39 (April (4)) (2019) 1839–1847. X.L. Song, Y.J. Zhang, X.F. Wang, W.J. Zhang, Z. Wang, F. Zhang, Y.J. Zhang, J.H. Lu, J.W. Mei, Y.P. Hu, L. Chen, H.F. Li, Y.Y. Ye, Y.B. Liu, J. Gu, Casticin induces apoptosis and G0/G1 cell cycle arrest in gallbladder cancer cells, Cancer Cell Int. 17 (January) (2017) 9. G.L. Chou, S.F. Peng, C.L. Liao, H.C. Ho, K.W. Lu, J.C. Lien, M.J. Fan, K.C. La, J.G. Chung, Casticin impairs cell growth and induces cell apoptosis via cell cycle arrest in human oral cancer SCC-4 cells, Environ. Toxicol. 33 (February (2)) (2018) 127–141. S. Nagata, M. Tanaka, Programmed cell death and the immune system, Nat. Rev. Immunol. 17 (May (5)) (2017) 333–340. D.R. Green, The coming decade of cell death research: five riddles, Cell 177 (May (5)) (2019) 1094–1107. Y. Wang, W. Gao, X. Shi, J. Ding, W. Liu, H. He, K. Wang, F. Shao, Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin, Nature 547 (July (7661)) (2017) 99–103. C. Rogers, D.A. Erkes, A. Nardone, A.E. Aplin, T. Fernandes-Alnemri, E.S. Alnemri, Gasdermin pores permeabilize mitochondria to augment caspase-3 activation during apoptosis and inflammasome activation, Nat. Commun. 10 (April (1)) (2019) 1689. J. Shi, Y. Zhao, K. Wang, X. Shi, Y. Wang, H. Huang, Y. zhuang, T. Cai, F. Wang, F. Shao, Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death, Nature 526 (October (7575)) (2015) 660–665. K. Tsuchiya, S. Nakajima, S. Hosojima, D. Thi Nguyen, T. Hattori, T. Manh Le, O. Hori, M.R. Mahib, Y. Yamaguchi, M. Miura, T. Kinoshita, H. Kushiyama, M. Sakurai, T. Shiroishi, T. Suda, Caspase-1 initiates apoptosis in the absence of gasdermin D, Nat. Commun. 10 (May (1)) (2019) 2091.
9