Nickel modulates the electrical activity of cultured cortical neurons through a specific effect on N-methyl-d -aspartate receptor channels

Neuroscience 177 (2011) 43–55

NICKEL MODULATES THE ELECTRICAL ACTIVITY OF CULTURED CORTICAL NEURONS THROUGH A SPECIFIC EFFECT ON N-METHYL-D-ASPARTATE RECEPTOR CHANNELS P. GAVAZZO,a1 M. TEDESCO,b1 M. CHIAPPALONE,c I. ZANARDIa AND C. MARCHETTIa*

vealed a predominant expression of NR2B, with no modification during DIV. These results demonstrate that, in these cultured cells, the NR spontaneous current is almost entirely due by NR2B-containing receptors and that Ni2ⴙ affects the electrical activity through a specific effect on NR channels. © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

a Institute of Biophysics, National Research Council, via De Marini, 6 16149 Genova, Italy b Department of Biophysical and Electronic Engineering (DIBE), University of Genova, via Opera Pia 11A, 16145 Genova, Italy c Neuroscience and Brain Technologies, Italian Institute of Technology (IIT), via Morego, 30 16163, Genova, Italy

Key words: rat brain embryonic cultures, NR2 subunits, NR2B antagonists, heavy metal, in vitro development, neurotoxicity.

Abstract—Nickel (Ni2ⴙ) is a toxic metal that affects the function of several ionic channels. In the N-methyl-D-aspartate (NMDA) subtype of glutamate receptor (NR), it causes activity enhancement of the channels containing the NR2B subunit and voltageindependent inhibition of those containing NR2A. Thus, it may represent a functional marker for the identification of NR native channel subunits. We investigated the effect of Ni2ⴙ on spontaneous NR currents in cortical neurons, dissociated from 18day rat embryos and maintained in culture for up to ⬃40 days. In whole-cell voltage-clamp at ⴚ60 mV, in a Mg2ⴙ-free bath containing the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) antagonist 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX) (10 ␮M), spontaneous currents were blocked by 10 ␮M D(–)-2-Amino-5-phosphonopentanoic acid (APV) (10 ␮M), and by NR2B antagonists, ifenprodil (10 ␮M) or Ro25-6981 (Ro25, 1 ␮M), indicating that they are due to NRs containing predominantly the NR2B subunit. In the presence of Ni2ⴙ (30 ␮M) the amplitude and the frequency of spontaneous currents were increased and the decay time decreased. A higher dose (300 ␮M) blocked all electrical activity. In current-clamp, Ni2ⴙ (30 ␮M) caused a ⬃5 mV reversible depolarization. The effect of Ni2ⴙ, as well as that of NR2B antagonists, was almost independent of days in vitro (DIV) in the range from 18 to 33 DIV. The electrical activity of the neuronal networks measured by microelectrode arrays (MEAs) was also affected by Ni2ⴙ, which caused a decrease in firing rate, but an increase in burst duration, while Ro25 (1–10 ␮M) caused a decrease in both firing rate and burst duration. Finally, reverse transcription polymerase chain reaction (RT-PCR) re-

Nickel is a natural element of earth’s crust and therefore it is present in food, water, soil and even in air. Similar to several other metals, its concentration has increased following human exploitation and represents a significant environmental concern (ATSDR, 2005). Although the neurotoxicity of nickel (Ni2⫹) is largely unexplored, there are reasons to believe that this metal may be as injurious as lead (Slotkin et al., 2007). Ni2⫹ is taken up into the brain through failures of the blood– brain barrier, and also via the olfactory pathway (Henriksson et al., 1997), and can accumulate in the brain. Routine dietary intake produces brain Ni2⫹ concentrations close to 10 ␮M (Casey and Robinson, 1978; Slotkin et al., 2007). Ni2⫹ affects the function of several different neuronal ionic channels, including T-type and R-type voltage-dependent calcium (Kang et al., 2006, 2007), acid-sensing (Staruschenko et al., 2007) and GABA-activated (Fisher and Macdonald, 1998) channels. In particular, Ni2⫹ in 10 ␮M range modifies the behavior of the N-methyl-D-aspartate subtype of glutamate receptor (NR) in a subunit-dependent manner (Marchetti and Gavazzo, 2003; Gavazzo et al., 2006). NR is one of the main targets of heavy metal poisoning. This receptor mediates numerous forms of synaptic plasticity that organize the developing nervous system (Yashiro and Philpot, 2008). Excessive activation of NR is involved in a number of central nervous system diseases, including stroke, head trauma (Arundine and Tymianski, 2004) and epilepsy (Wasterlain and Chen, 2008), while abnormal expression, function and regulation of NR may play a role in schizophrenia (Kristiansen et al., 2007) and in chronic neurodegenerative diseases (Kalia et al., 2008). The current flowing through the NMDA subtype of glutamate receptor represents the “slow” component of the glutamate-activated post synaptic current. Beside its slower desensitization, this ligand-gated ionic channel has unique properties, such as Mg2⫹-mediated voltage-dependence and significantly high calcium permeability, and con-

1 P.G. and M.T. contributed equally to this work. *Correspondence to: C. Marchetti, Institute of Biophysics, National Research Council, via De Marini, 6, 16149 Genova, Italy. Tel: ⫹39010-647-5578; fax: ⫹39-010-647-5500. E-mail address: [email protected] (C. Marchetti). Abbreviations: AMPA, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate; APV, D(⫺)-2-amino-5-phosphonopentanoic acid; DIV, days in vitro; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; ifenprodil, 4-[2-(4-benzylpiperidin-1-yl)-1-hydroxypropyl]phenol; MEA, micro-electrode array; MK-801, (5R,10S)-(⫹)-5-methyl-10,11dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine hydrogen maleate; NBQX, 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione; Ni2⫹, nickel; NMDA, N-methyl-D-aspartate; NR, NMDA receptor; NR2A, NMDA receptor subunit 2A; NR2B, NMDA receptor subunit 2B; PBS, phosphate-buffered saline; PcTX, picrotoxin; Ro25, Ro25-6981 or [R-(R*,S*)]-␣-(4-hydroxyphenyl)-␤-methyl-4-(phenylmethyl)-1-piperidinepropanol hydrochloride; RT-PCR, reverse transcription polymerase chain reaction; TTX, tetrodotoxin.

0306-4522/11 $ - see front matter © 2011 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2010.12.018

43

44

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

tains a number of distinct recognition sites for endogenous and exogenous ligands, which are able to modulate its functions. All functional NMDA receptors (NRs) are heteromeric complex and contain two different types of subunits, the essential NR subunit NR1 and at least one of the four different NR2 types (named A, B, C and D). The NR2 pattern of expression is tissue- and age-dependent. In the immature brain, the NR2B subunit is widespread, but later in development it undergoes a down-regulation, while the NR2A subunit expression increases (Monyer et al., 1994; Sheng et al., 1994). NR2A subunits partition preferentially, but not exclusively, into synaptic locations and that, at maturation, NR2A- and NR2B-containing receptors are found in either synaptic or extrasynaptic compartments (Thomas et al., 2006; Martel et al., 2009). Ni2⫹ (30 ␮M) causes a potentiation of NR2B-containing channels, but just a minor, voltage-independent inhibition in those containing NR2A, suggesting that the effect of Ni2⫹ may change with neuronal development in vitro, switching from stimulatory to inhibitory as NR2A subunit become predominant (Gavazzo et al., 2006). In vitro cultured neuronal networks constitute a valuable experimental model for studying spontaneous electrophysiological activity of either single cells, with conventional intracellular patch-clamp recordings, or neuronal population grown onto microelectrode arrays (MEAs; Martinoia et al., 2005). These cultures offer a model to study neuronal dynamics and to characterize the network spontaneous activity over time (Chiappalone et al., 2006; Wagenaar et al., 2006). In this work we present a specific effect of Ni2⫹ on spontaneous NR currents in cortical neurons and further demonstrate a specific action of this metal on electrophysiological activity in central neurons.

and permeabilized for 10 min with 0.1% Triton-X100. Blocking reaction was performed with a buffer containing 3% BSA, 2% FBS, 0.05% Triton-X100 for 1 h, at room temperature. Cultures were then washed two times with PBS and incubated with primary antibodies anti-NeuN (Chemicon, Temecula, CA, USA, MAB377 1:200 dilution, Mullen et al., 1992) and anti-GABA (Sigma Aldrich Co. Gallarate, Italy, A2052), followed by secondary antibodies goat anti-mouse conjugated to Alexa fluor 546 and goat anti-rabbit conjugated to Alexa fluor 488 (Molecular probes, Carlsbad, CA, USA). Both incubations were performed at room temperature for 60 –90 min. Post-mitotic neurons are marked in red and GABAergic neurons in green. Red and green cells were counted in four fields for each coverslip from different culture ages.

Whole-cell recordings General procedure. Total membrane currents were measured in whole-cell clamp configuration as previously described (Marchetti and Gavazzo, 2003; Gavazzo et al., 2006). Electrodes were pulled from Clark borosilicate glass capillaries and had a resistance of 5– 8 M⍀ when filled with the intracellular solution (see below). Unless otherwise stated, membrane currents were recorded at ⫺60 mV, a membrane potential that is close to the reversal potential of GABAA receptor-mediated events in our ionic conditions. Membrane potential was measured in current-clamp condition in the absence of any stimulating current. Experiments were performed at room temperature. Currents and membrane potential were recorded by an Axopatch amplifier (Molecular devices, Foster City, CA, USA). Voltage stimulation and data acquisition were performed by a PC through a Digidata 1440A interface and Pclamp-10 software (Molecular devices). Capacitance transients following a pulse of 50 ms duration and 2 mV amplitude from holding potential were minimized by analog compensation and the value obtained by this compensation was taken as an estimate of the cell capacitance. Traces were low-pass filtered at 2 kHz and sampled at 5 kHz.

Immunohistochemistry

Solutions. The bath solution contained (in mM): NaCl 140, KCl 5.4, CaCl2 1.3, glucose 10, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 5 and either 0.7 MgCl2 or 0 MgCl2 and 30 ␮M glycine. The pH was adjusted at 7.4 with NaOH. The intracellular (patch pipette) solution contained (in mM): potassium gluconate, 145; EGTA, 5; MgCl, 5; ATP-Na, 5; and HEPES, 10; adjusted to pH 7·2 with KOH. To measure presynaptic NRs, 1 mM (⫹)-MK-801 hydrogen maleate was added to the pipette solution. When stated, the external solution was supplemented with 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX, 10 ␮M), and bicuculline (10 ␮M). Other modifiers included picrotoxin (PcTX, 100 ␮M), tetrodotoxin (TTX, 300 nM), D(⫺)-2-Amino-5-phosphonopentanoic acid (APV, 10 –50 ␮M), 4-[2-(4-benzylpiperidin-1-yl)-1-hydroxypropyl]phenol (ifenprodil, 10 ␮M), [R-(R*,S*)]-␣-(4-hydroxyphenyl)-␤-methyl-4-(phenylmethyl)-1-piperidinepropanol hydrochloride (Ro 25-6981, Ro25 1–10 ␮M) and spermine. Ni2⫹ stock solution was prepared from NiCl2, dissolved in distilled water to a concentration of 100 mM and diluted in the external bath just before the experiments. All chemicals were purchased from Sigma Aldrich Co. (Gallarate, Italy). Cells were continuously superfused by gravity flow (10 ml/ min) and all modifiers were applied by bath solution exchange. This was optimized by using solenoid microvalves and by feeding the chamber from two opposite angles at the same time. The solution exchange time was estimated by the change of membrane current produced by switching the Na⫹ concentration from 10 to 150 mM during application of kainic acid and it was approximately 400 ms (Marchetti and Gavazzo, 2003).

Cultured neurons were fixed for 20 min at room temperature with 4%(wt/vol) para formaldehyde in phosphate-buffered saline (PBS)

Data analysis. Traces were analyzed by Pclamp 10 software (Clampfit) and spontaneous currents were detected and

EXPERIMENTAL PROCEDURE Neuronal cultures Dissociated neuronal cultures were prepared from the cerebral cortices of embryonic Sprague–Dawley rats at embryonic day 18 (E18), as previously described (Martinoia et al., 2005; Chiappalone et al., 2006). Embryos were extracted by caesarean section from anaesthetized pregnant dams and the entire procedure was performed in accordance with the European Community Council Directive of 24 November 1986 for the care and use of laboratory animals and approved by MIUR (Ministero Istruzione Università e Ricerca). The use of dissociated cultures intrinsically helped to reduce the number of animals used. Cells were plated either on poly-D-lysine-coated glass coverslip (for immunocytochemistry and whole-cell clamp experiments), or six-well plates for RNA extraction and Western blotting, and on poly-D-lysine and laminin coated MEAs for network activity recordings. Cultures were derived from the same preparations and were maintained in Neurobasal medium supplemented with 2 mM glutamine and 2% medium B27, with no serum added. The medium was partially renewed every 7 days. Experiments were performed in cultures between 7 and 34 days in vitro (DIV).

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55 characterized by a template search algorithm. Templates are created by extracting and averaging segments of data that are manually identified as corresponding to an event. The template is then run through the data, identifying further events in the trace. The same traces were also analyzed by Mini Analysis Software (Synaptosoft, Decatur, GA, USA), using an interactive threshold crossing algorithm, where the threshold was set by the user. In both cases, three parameters were considered: frequency, amplitude and time course of decay of the currents. The results were compared and the analysis was accepted only when the two approaches gave similar (within 10%) results. All subsequent analysis was performed by Sigma Plot (SPSS Science, Chicago, IL, USA) software. Data are shown as mean⫾SEM. Each group of data was compared with the respective control values. Stastical significance was evaluated by paired t-test (In Stat, GraphPad Software, San Diego, CA, USA). The differences between two conditions were considered significant if P⬍0.05.

MEA recordings General procedure. Multisite extracellular recordings were performed using MEAs made up of 60 planar microelectrodes (TiN/SiN, 30 ␮m electrode diameter, 200 ␮m pitch) arranged over an 8⫻8 square grid (Multi Channel Systems, Reutlingen, Germany). After 1200⫻ amplification (MCS MEA 1060), signals were sampled at 10 kHz using the MCS data acquisition card controlled by the MCS MCRack software for data monitoring, acquisition and storage. Recordings were performed at 37 °C in the absence of solution flow, as in previous work (Chiappalone et al., 2006). Cultures were maintained in dishes sealed with a gas permeable Teflon membrane (MCS) to prevent infection and evaporation. Before each recording session, the culture medium was replaced by an extracellular solution containing (in mM): 150 NaCl, 1.3 CaCl2, 0.7 MgCl2, 2.8 KCl, 10 glucose, 10 HEPES. The pH was 7.4. After change of the medium, 15–20 min were allowed in order to stabilize electrical activity until recording, and spontaneous activity in physiological solution was recorded for 20 min (control condition). Then, networks were exposed to the different modifiers (Ni2⫹, Ro25) and the recording session was continued for additional 20 min. After recording, the raw signals obtained from each experiment were processed off-line by using the custom software tool SPYCODE (Bologna et al., 2010) developed in MATLAB (The Mathworks, Natick, MA, USA). Burst detection. Cortical networks show both random spiking activity and bursting behavior. Bursts consist of packages of spikes distributed over a range of a few milliseconds, which generally last from hundreds of milliseconds up to seconds, and are separated by long quiescent periods. A previously developed algorithm (Pasquale et al., 2009) was used to detect the presence of bursts and analyze their duration rate. The channels showing a bursting rate lower than 0.4 burst/min were not included in the analysis.

RNA purification and PCR Total RNA was prepared from cultured cortical neurons of different DIV using the Nucleospin RNA XS kit from Macherey Nagel and according to the procedure suggested in the manual. Concentration and purity of RNA was estimated by optical density at 260 and 280 nm. cDNA was retro-transcribed using oligo(dT) as primers and M-MuLV reverse transcriptase (Fermentas, St. Leon-Rot, Germany). Random hexamer primer reaction was also occasionally performed without significant variation of the results. PCR reaction was carried out using primer pairs as in Itzstein et al. (2001). In particular, for NR2A the sequence of the sense and antisense primers were as follows 5= tatagagggtaaatgttgga 3=, 5= agaaactgtgaggcatttct 3=; for NR2B 5= actgtgacaacccacccttc 3=, 5=

45

cggaactgtctccagcttct 3=. The housekeeping gene glyceraldehyde3-phosphate dehydrogenase (G3PDH) was chosen as an internal standard and the following primer set was designed: sense 5= atggtgaaggtcggtgtgaac 3=, antisense 5= gctgacaatcttgagggagt 3=. From the amplification with the designed primers fragment sizes of 322 bp for NR2A, 400 bp for NR2B and 437 bp for G3PDH were expected. The PCR reaction was performed in a Perkin Elmer Termocycler 2400 using a Pfu Polymerase from Promega and programmed as follow: denaturation 95 °C for 50⬙, annealing 55 °C for 1=, extension 72 °C for 1=, 25–35 cycles. In each experiment a control reaction was run with no cDNA added. Amplified samples were resolved in a 1.5% agarose gel and visualized with ethidium bromide.

Western blot Neuronal cultures were grown in six-well plates. At the specified day in vitro, cultures were transferred on ice, rinsed twice with PBS (without Ca2⫹ and Mg2⫹) and lysed by incubation with 0.1 ml/well of RIPA buffer (1X PBS, 1% NP-40, 0.5% DOC, 0.1% SDS) supplemented with freshly added 0.5 mM PMSF (phenylmethylsulfonyl fluoride) for 30 min at 4 °C. Lysates were scraped from the dish and collected by centrifugation for 10 min at 10,000 g at 4 °C, then supernatants were aliquoted and stored at ⫺80 °C. The protein concentration was determined by Bradford assay, using bovine serum albumin as a standard. Western blots were performed following standard procedures: 20 ␮g of protein was separated on each lane of a 7.5% sodium-dodecyl sulphatepolyacrilamide gel electrophoresis (SDS-PAGE) and then electroblotted onto a nitrocellulose membrane. After treatment in blocking buffer (skimmed milk) for 30 min, membranes were incubated overnight with primary antibodies anti-NMDA2B (mouse monoclonal Chemicon MAB5574, 1:500) or anti-NMDA2A (mouse monoclonal Chemicon MAB5572, 1:100). Antibodies against alphatubulin (Sigma Aldrich Co.) were used as internal control. Membranes were incubated in horseradish peroxidase-conjugated rabbit anti-mouse antibodies for 1 h and protein bands were detected with ECL (Bio-Rad Laboratories Srl, Segrate, Italy). Molecular weights were obtained from prestained broad range standards (DUAL COLOR standards Bio-Rad laboratories).

RESULTS Dissociated cortical neurons grown in culture in defined medium developed extended networks and displayed complex electrical activity that changed during in vitro development (Fig. 1). Neurons were identified by immunocytochemistry as glutamatergic excitatory by 80% and GABAergic inhibitory by 20% at 21 DIV (Fig. 1B). These percentages did not change significantly within the culture range examined (up to 40 DIV). In the first week in vitro, neurons displayed only small evoked response to neurotransmitters (glutamate and GABA) and the response to NMDA increased gradually in amplitude during the second week, reaching a plateau at approximately 18 DIV (Fig. 1). This increase correlates with previously described development of network connections (Chiappalone et al., 2006) and was largely accounted for by the increase in cellular size, estimated by cell capacitance measurements (Fig. 1C). During the second week in culture, and more consistently during the third week, neurons started to display spontaneous synaptic currents. The membrane potential of the cells in physiological solutions was ⫺68⫾2 mV (mean⫾SEM) in 12 cells from 18 to 33 DIV with no significant modification in this time range. The electrical activity

46

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

12 DIV

25 DIV

A

B

7 DIV

C

12 DIV

NMDA

25 DIV NMDA

NMDA

20 pA

500 pA

200 pA

C (pF)

2 sec

D

80 40

10

20

250

30

DIV

200

1500

150 1000

pA/pF

current (pA)

0

2000

100

500

50

0

0 5

10

15

20

25

DIV Fig. 1. (A) Microphotographs of cultured cortical neurons at different days in vitro (DIV). Bar⫽20 ␮M. (B) Immunofluorescence staining of neurons—the neuron identity was estimated with NeuN antibody, which recognizes all post-mitotic neurons (in red), and with an anti-GABA antibody, which recognize the GABAergic neurons among them (in green). Bar⫽20 ␮M. (C) Representative traces of NMDA current at different DIV. Neurons were voltage-clamped at ⫺60 mV and challenged by 2 s application of 200 ␮M NMDA. (D) Average amplitude of the current evoked by NMDA (filled circles; pA, left axis) and of the specific current (open diamonds; pA/pF, right axis) vs. time in vitro. Points represent mean⫾SEM in minimum 3–15 cells for each day in vitro. Currents were normalized to evaluated capacitance and averaged. The inset shows the change in membrane capacitance with DIV in 3–15 for each day in vitro. The increase in NMDA current with DIV is mostly accounted for by the average membrane capacitance increase due to larger size of the neurons.

was recorded in voltage-clamp conditions from a holding potential of ⫺60 mV. This potential is slightly depolarized with respect to the resting membrane potential, but it was chosen because it is very close to the reversal potential for GABA activated current in the experimental condition (see below and Cossart et al., 2000). Synaptic activity of neuron from a 33 DIV culture and the effect of Mg2⫹ removal are shown in Fig. 2. Removal of Mg2⫹ from the external solution caused a sizeable modification in the shape of spontaneous currents recorded at ⫺60 mV. In current clamp experiments, Mg2⫹ removal caused the zero current membrane potential to change to a more depolarized value; in 12 cells, the membrane potential in 0 Mg2⫹ was ⫺45⫾3 mV (mean⫾SEM). At ⫺60 mV, the spontaneous currents were due to activation of glutamate receptors because PcTX (up to 100 ␮M) and/or bicuculline (10 ␮M) did not

cause modifications in amplitude, frequency or time course of the spontaneous electrical activity in 0 Mg2⫹ (Fig. 2B). GABAA receptors specific blockers were also ineffective in other four cells from cultures ranging from 20 to 35 DIV. Nevertheless, bicuculline (10 ␮M) was always added to the solution used to assure isolation of the glutamate component and to eliminate the influence of presynaptic GABAA receptors, which have been shown to occur at excitatory synapses in cultured neocortical neurons (Draguhn et al., 2008). In addition, the spontaneous currents recorded in the absence of Mg2⫹ were completely eliminated by TTX, indicating a requirement for action-potential driven neurotransmitter release. Addition of the AMPA specific antagonist NBQX (10 ␮M) caused a reduction of the frequency and a slow down of the decay time course of spontaneous currents (Fig.

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

47

(30 ␮M) caused a further depolarization to ⫺42⫾2 mV (mean⫾SEM). The membrane potential returned to the initial value (⫺78 mV in the cell of Fig. 4B) upon washing Ni2⫹and replacing 0.7 mM Mg2⫹ in the external bath. In other experiments, the membrane potential repolarized by addition of 1 ␮M Ro25, which mimicked Mg2⫹ in closing NR channels (not shown).

Fig. 2. Baseline electrical activity in voltage-clamped cortical neuron from a 33 DIV culture. (A) Effect of Mg2⫹ removal at ⫺60 mV membrane potentials. Removal of Mg2⫹ from the external solution (indicated by horizontal bars) caused a modification in amplitude and shape of spontaneous currents and an increase in their frequency. (B) Lack of effect of GABAA blockers on the baseline electrical activity of a neuron from the same preparation as in (A). The cell was voltageclamped at ⫺60 mV and picrotoxin (100 ␮M) and bicucculine (10 ␮M) were applied in the Mg2⫹-free solution as indicated by the thick bar. The insets show expanded traces before and after the addition of the GABAA blockers. Currents parameters were not modifed.

3A). The residual activity in NBQX was totally and reversibly blocked by 10 ␮M APV, as well as by 10 ␮M ifenprodil or 1 ␮M Ro25 (Fig. 3B, C). Ifenprodil caused a similar complete reversible block of spontaneous currents in other four and Ro25 in eight neurons from different cultures ranging from 18 to 33 DIV. These observations indicate that in a Mg2⫹-free NBQX-containing bath, spontaneous currents are due to NRs, containing predominantly the NR2B subunit, independent of DIV in this time range. We investigated the effect of different concentrations of Ni2⫹ on these currents in Mg2⫹-free bath containing bicuculline and NBQX. Application of 30 ␮M Ni2⫹ caused an increase of the amplitude of the current events, which became more frequent and decayed with a faster time course (see following paragraph for statistics). At higher doses (300 ␮M) Ni2⫹ blocked any kind of electrical activity (Fig. 4A). Ni2⫹ also modified the membrane potential at 0 current, as shown in Fig. 4B. In three cells with resting membrane potential of ⫺71⫾4 mV (mean⫾SEM) in control condition, changing the external bath to a Mg2⫹-free solution containing NBQX caused a depolarization to ⫺48⫾1 mV (mean⫾SEM). Subsequent addition of Ni2⫹

Fig. 3. Effect of different pharmacological modifiers on the spontaneous current in cortical neurons. The external solution contained 0 Mg, 30 ␮M glycine and 10 ␮M bicuculline. Cells were voltage-clamped at ⫺60 mV and drugs were applied as indicated by the thick bar. (A) Representative spontaneous activity of neuron from a 33 DIV culture. This cell displayed regular inward currents at a frequency of 2.46 event/s and average decay time of 44⫾7 ms. When the AMPA antagonist NBQX (10 ␮M) was applied, these current events slowed down considerably and had a frequency of 0.63 event/s and decay time of 186⫾14 ms. The lower inset represent show traces in expanded scale in the two conditions (left: 0 Mg control solution; right: in the presence of NBQX). (B) Effect of the competitive NMDA antagonist APV on the spontaneous current in 0 Mg⫹NBQX (10 ␮M) in an 18 DIV neuron. (C) Effect of two NR2B antagonist, ifenprodil (ife, 10 ␮M) and Ro25 (Ro, 1 ␮m) on the spontaneous current in 0 Mg⫹NBQX in two neurons from 18 and 21 DIV culture respectively.

48

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

Fig. 4. (A) Effect of Ni2⫹ on the electrical activity in a voltage-clamped neuron from 19 DIV culture. The holding potential was ⫺60 mV and the drugs were applied as indicated by the bar. The external solution (control) contained 0 Mg, 30 ␮M glycine, 10 ␮M bicuculline and 10 ␮M NBQX. The insets show expanded traces in control and after the addition of 30 ␮M Ni2⫹. When the concentration of Ni2⫹ was increased to 300 ␮M, all electrical activity disappeared. (B) Effect of 30 ␮M Ni2⫹ on the membrane potential recorded in current clamp in a 33 DIV neuron. The membrane potential was ⫺77 mV in 0.7 mM Mg and reached a plateau at ⫺49 mV in 0 Mg⫹10 ␮M NBQX. Addition of 30 ␮M Ni2⫹ caused a further small depolarization to ⫺43 mV. All effects were reversible upon washing and replacing 0.7 Mg in the bath. (C) Effect of Ni2⫹ on synaptic currents in a neuron internally dialyzed with a solution containing 1 mM MK-801 to block postsynaptic NR channels. The holding potential was ⫺60 mV and modifiers were applied as indicated by the bars. The external solution (control) contained 0 Mg and 10 ␮M bicuculline. The insets show expanded traces before, after the addition of 30 ␮M Ni2⫹ and in the presence of 30 ␮M Ni2⫹ and 50 ␮M APV. In control currents present had mean amplitude of 17⫾1 pA and decay time of 6.3⫾0.2 ms; in Ni2⫹ the current had amplitude of 174⫾5 pA and a decay time of 68⫾4 ms. Addition of APV restored the initial condition. Similar responses were recorded from other five cells from 22 DIV culture.

As recent evidence demonstrates that NRs also exist presynaptically (Berretta and Jones, 1996; Corlew et al.,

2007; Corlew et al., 2008), we have investigated whether the effect of Ni2⫹ was mediated also by presynaptic NR channels. These experiments were performed by blocking postsynaptic channels with the NR antagonist MK-801 (1 mM) in the internal solution (Berretta and Jones, 1996). To facilitate binding of MK-801 and block of NR channels, cells were stimulated several times with depolarizing pulses to ⫹20 mV (Woodhall et al., 2001). With MK-801 in the pipette and in the presence of bicuculline (10 ␮M), small, miniature postsynaptic currents were usually recorded (Fig. 4C), although larger synaptic currents were present also occasionally. All these currents were fully blocked by NBQX (10 ␮M) and experiments in which this block was not complete were discarded. Ni2⫹ caused a prominent increase of the current, which was completely reversed by addition of APV (Fig. 4C). These currents were also totally abolished in the presence of NBQX (not shown). In six cells, the current in the presence of Ni2⫹ had amplitude ranging from 150 to 250 pA and decay time ranging from 60 to 90 ms. These features are similar to those found in the currents recorded with normal internal solution in the presence of Mg2⫹ (see Fig. 2A). Presynaptic NR channels were not investigated further, but these observations indicate that these receptors are also affected by Ni2⫹ and partially mediate its effect. All further analysis was performed without MK-801 in the pipette. In 32 neurons tested, ranging from 18 to 33 DIV from five different preparations, the average amplitude of the NR current in 0 Mg2⫹ and in the presence of NBQX was 388⫾30 pA (mean⫾SEM), with a frequency of 0.56⫾0.06 event per second and with a decay time constant of 297⫾26 ms. In the presence of 30 ␮M Ni2⫹ these parameters became amplitude: 478⫾36 pA; frequency: 0.83⫾0.08 event per second; decay time: 167⫾11 ms (Fig. 5). As the potentiation exerted by Ni2⫹ in NR2B-containing receptors (Gavazzo et al., 2006, 2009) is reminiscent in many respects to the glycine-independent potentiation described for spermine (Zhang et al., 1994; Masuko et al., 1999), we investigated whether spermine (250 ␮M) caused a similar effect on the spontaneous NR currents. Similar to 30 ␮M Ni2⫹, this dose of spermine induced enhancement in amplitude, frequency and slowed down the time course of decay of the NR currents (Fig. 5B). However, only the effect on decay time was statistically significant (P⬍0.05). Thus spermine is less effective than 30 ␮M Ni2⫹. At higher doses, voltage-dependent inhibition prevailed and 2.5 mM spermine blocked all electrical activity, in a way similar to 300 ␮M Ni2⫹ (not shown). Ni2⫹-induced spontaneous current modifications were mostly independent of DIV in the range from 18 to 33 DIV (Fig. 6), although the effect on the frequency and on decay time diminished slightly with time in culture. These observations correlate well with the effect of NR2B antagonists on spontaneous current, because both ifenprodil and Ro25 inhibited the NR currents almost completely at the doses tested (see Fig. 3) and this effect was independent of DIV in this range of culture development. Further information on the Ni2⫹-induced modulation of the spontaneous electrical activity of cultured cortical neuro-

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

49

Fig. 5. (A) Summary of the effects of Ni2⫹ on amplitude, frequency and decay time of NR current in 32 neurons from 18 to 33 DIV cultures. All neurons from different DIV were pooled. Bars are averages⫾SEM. The effect of 3 ␮M Ni2⫹ was not statistically significant, while 300 ␮M drastically reduced the frequency of spontaneous currents and amplitude and decay time could not be evaluated in this condition. ⴱ P⬍0.0001 vs. control (0Ni). (B) Summary of the effects of 30 ␮M Ni2⫹ and 250 ␮M spermine in 18 cells from 18 to 33 DIV cultures. Each value was normalized to the respective value in control condition (no Ni2⫹ or spermine added). * P⬍0.0001 vs. control (0Ni), ** P⬍0.05 vs. control (0 spermine).

nal networks was provided by MEA recording. In these experiments, our conditions do not isolate NR currents, but the electrical activity is the result of contribution for many different channel types. Fig. 7B presents electrophysiological record-

ings of a cortical network in control condition (basal physiological solution) and in the presence of two concentrations of Ni2⫹. The lower dose, 30 ␮M, caused a decrease in firing and burst rate and a sizeable increase in burst duration. The

Fig. 6. Summary of the effects of 30 ␮M Ni2⫹ on the three parameters of spontaneous NMDA current, amplitude, frequency and decay time, as a function of DIV, in 32 neurons from 18 to 33 DIV cultures. Each value was normalized to the respective value in control condition (no Ni2⫹ added). Straight lines represent linear regression lines. The slope of the regression for frequency and decay time indicates that the effect on these two parameters was less pronounced as DIV progressed.

50

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

Fig. 7. Effect of Ni2⫹ on the electrical activity of cortical networks cultured over micro-electrode arrays (MEAs). (A) A network of dissociated cortical neurons plated over a MEA. Electrode diameter: 30 ␮m. Electrode distance: 200 ␮m. (B) Electrophysiological recordings of the spontaneous activity measured by one channel (electrode) of the MEA in basal (left trace), in the presence of 30 ␮M (top right) and 300 ␮M (bottom right) Ni2⫹. Scale bar: horizontal (time) 20 s; vertical (voltage) 20 ␮V. (C) and (D) Summary of the effects of Ni2⫹ on networks cultured on MEAs. (C) Box plots of the firing rate and of the burst duration during spontaneous activity in basal condition and 30 ␮M Ni2⫹ (n⫽340 active channels from seven cultures). (D) Box plot of the firing rate and the burst duration during spontaneous activity in basal condition and 300 ␮M Ni2⫹ (n⫽180 active channels from three cultures). □⫽media; box⫽25–75%; horizontal line⫽median; bars⫽standard deviation; -⫽max; * P⬍0.001 vs. control (0Ni).

higher dose, 300 ␮M, almost completely abolished firing, consistent with a predominant blocking action of this dose of the metal. Statistical analysis confirmed this observation (Fig. 7C, D). Firing rate was decreased and the burst duration increased by 30 ␮M Ni2⫹ (n⫽340 active channels from seven cultures), while both firing rate and burst duration were reduced to 0 by 300 ␮M Ni2⫹ (n⫽180 active channels from three cultures). To resolve the contribution of NR2B-containing channels, the effect of Ro25 addition was investigated (Fig. 8). In this case, network electrical behavior is represented in raster plots, where each row corresponds to a recording site and each small vertical line to a detected spike, in the basal condition and following the addition of 1 ␮M and 10 ␮M Ro25. It is evident that the treatment with Ro25 1 ␮M substantially diminished and that with 10 ␮M completely abolishes the spontaneous electrical activity of the culture. These results were confirmed in other three cultures of similar age (22 DIV), indicating a sizeable contribution of NR2B-containing NR channels to network electrical activity.

All functional results so far described indicate that the electrical activity of dissociated cortical neurons in developing networks is driven by NR containing the NR2B subunit. Therefore we examined the expression of NR2A and NR2B subunits by RT-PCR to investigate which subunit was expressed and the possible prevalence of one or the other at different times of culture. RNA purified at 12 and 34 DIV appeared to contain predominantly the NR2B subunit, and a band corresponding to NR2A subunit was detected only when the reaction was prolonged to 35 cycles (Fig. 9A). Western blot analysis, performed on neurons from similar cultures, confirmed the presence of NR2B, while NR2A was below detection level. In both cases, the composition of NR did not change appreciably with DIV in the range examined.

DISCUSSION We have previously reported that Ni2⫹ modulates NR channel activity in a way that is partially dependent on the

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

Fig. 8. Effects of NR2B-antagonist Ro25 on the electrical activity of cortical networks cultured over MEAs. (A) Raster plots of the electrical activity of a subset of MEA channels (30 out of 60) in a representative experiment in basal (top), in the presence of 1 ␮M (middle) and 10 ␮M (bottom) Ro25. Each row corresponds to a recording site and each small vertical line to a detected spike. (B) Firing rate profile of the same network under the three experimental conditions. The treatment with Ro25 10 ␮M completely abolishes the spontaneous electrophysiological activity of the culture.

subunit (NR2A or NR2B) present in the receptor (Marchetti and Gavazzo, 2003, 2005; Gavazzo et al., 2006, 2009). The effects of Ni2⫹ are complex and include: (i) subunitindependent voltage-dependent inhibition, similar to that caused by other metals like Mg2⫹; (ii) voltage- and pHindependent block of NR2A-containing receptors, which is mediated through a binding site different from that of Zn2⫹ (Gavazzo et al., 2009) and (iii) voltage-independent, but pH-dependent potentiation of NR2B-containing receptors (Marchetti and Gavazzo, 2003; Gavazzo et al., 2009). An

51

action of Ni2⫹ on NR channels was not unexpected because seminal works have established how divalent cations deeply affect the behavior of NR channel activity (Mayer and Westbrook, 1987; Mayer et al., 1989) and specific effect of Ni2⫹ was also reported (Hollmann et al., 1993; Fayyazuddin et al., 2000). However, in previous works on synaptic current and plasticity, Ni2⫹ was treated mainly as a specific blocker of T-type voltage-dependent Ca channel (Gorji et al., 2000; Poulain, 2001) and a direct influence on NR currents was not considered. We have now investigated the effect of Ni2⫹ on spontaneous, pharmacologically identified, NR currents in cortical neurons in dissociated cultures. The NR component of spontaneous currents was isolated by voltage-clamp at ⫺60 mV membrane potential, a value close to the reversal potential for GABA activated current (Cossart et al., 2000; Hanganu et al., 2001), and by using an external solution with 0 added Mg2⫹ and containing 10 ␮M NBQX and 10 ␮M bicuculline. Block by APV, and by the specific NR2Bantagonists ifenprodil (Williams, 1993) and Ro25 (Boyce et al., 1999) indicated that these currents are driven by NR, predominantly containing the NR2B subunit. As these currents were abolished in the presence of the Na channel blocker TTX, they appeared to require action-potential dependent transmitter release, as reported for similar currents in other preparations (Cossart et al., 2000; Hanganu et al., 2001). A high dose of Ni2⫹ (300 ␮M) completely blocked these spontaneous NR currents, as expected from its Mg2⫹-like action (Marchetti and Gavazzo, 2005). The lower dose (30 ␮M) was mainly stimulatory and modified three parameters of the currents: it increased the amplitude and the frequency of event occurrence and accelerated the time course of decay. Increase in the current amplitude is in full agreement with previous observations on evoked current in primary neurons and transiently transfected cells that expressed NR2B-containing receptors (Marchetti and Gavazzo, 2003; Gavazzo et al., 2006). The higher event frequency can be related with an enhanced frequency of channel opening, previously reported for heterologously expressed NR2B-containing channels (Marchetti and Gavazzo, 2005). The faster decay is a completely new observation and may be a consequence of accelerated deactivation of the receptors, similar to that reported for spermine (Rumbaugh et al., 2000); accordingly, a similar effect was also caused by 250 ␮M spermine (see Fig. 5B). In addition, part of the effect of Ni2⫹ we observed on synaptic currents may be mediated by presynaptic receptors, as suggested by the results we obtained by dialysing the postsynaptic cell with NR blocker MK-801. Activation of these receptors facilitate glutamate release (Berretta and Jones, 1996; Corlew et al., 2008) and the potentiation of these receptors mediated by Ni2⫹ causes enhancement of postsynaptic glutamate-gated current as expected (Fig. 4C). So, the present data clearly indicate that Ni2⫹ can alter spontaneous currents as it does with evoked current. However, it should be noted that as a consequence of the three actions, the total charge crossing the membrane was

52

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

Fig. 9. Expression of NR2A and NR2B in cortical neurons. (A) RNA was purified at 12 and 34 DIV from the same cell preparation, retrotranscribed with oligo(dT), then amplified with NR2-specific primers. The lane marked with “M” is relative to the molecular weight marker (1 kb ladder from Fermentas) with the 1, 0.75, 0.5, 0.25 kb fragments indicated. “C” is the control lane with no added cDNA. The other lanes are relative to NR2A (1,4), NR2B (2,5), G3PDH (3,6) fragments for the samples at 12 or at 34 DIV respectively. In the upper gel, the PCR reaction was run for 30 cycles and only NR2B subunit is visible at 12 (lane 2) and 34 (lane 5) DIV. The lower gel shows PCR reaction run for 35 cycles, with appearance of a band relative to NR2A of similar intensity at 12 (lane 1) and 34 (lane 4) DIV. (B) Representative western blots of NR2A and NR2B subunit from two cultures at 12 and 34 DIV. A 180 kDa band is observed in each lane of the NR2B subunit, while no immunoreactive band is evident in the NR2A lanes. Molecular weights were obtained from prestained broad range standards (DUAL COLOR standards Bio-Rad laboratories).

hardly altered and this is possibly a reason why a direct effect of Ni2⫹ on NR receptor function may have been disregarded. In this work we also present data of the effect of Ni2⫹ on electrical activity recorded extracellularly from neuronal networks in the same dissociated cultures growing on MEAs. In these experiments, we do not isolate NR currents and record total spontaneous firing. While 300 ␮M clearly blocked all electrical activity, 30 ␮M had a more complex effect, which consisted of a decrease of firing and burst rate and an increase in burst duration. These effects may be a consequence of Ni2⫹ action on different channel types. As mentioned above, Ni2⫹ is a fairly specific blocker of T-type and R-type voltage-dependent calcium channels (Kang et al., 2006, 2007), and

these channels play a significant role in the generation of single cell and neuronal network excitability characterized by high frequency burst of action potentials (Huguenard, 1996). Block of these channels would provoke a reduced firing and burst rate. On the other hand, once the burst started, the stimulating effect on NR2B-containing NR channels would result in a prolongation of burst duration, as presently reported. Also in these experiments, predominance of the NR2B-containing NR was confirmed by an important blocking effect of the NR2B selective antagonist Ro25. As these dissociated neuronal cultures can represent a valuable experimental model for studying in vitro neuronal development (Chiappalone et al., 2006), we examined changes in the electrical behavior and Ni2⫹ effect with the

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

time in culture. Evoked currents increased in amplitude, reaching a plateau at approximately 18 DIV; the increase was largely accounted for by cellular growth, as judged by the concurrent increase in cell capacitance (Fig. 1). Nevertheless it was correlated with an acquired ability of spontaneous electrical activity, which was consistently recorded from single neurons from the third week in vitro. Beside the increase in size, the most remarkable landmark of neuronal maturation is the switch from receptors containing only NR2B subunit to receptors containing also, and possibly mainly, NR2A (Sheng et al., 1994; Rumbaugh and Vicini, 1999). In previous work, the progressive reduction in sensitivity of NR currents to ifenprodil has been taken as indicative of down-regulation of the NR2B subunits and up-regulation of NR2A (Flint et al., 1997; Kew et al., 1998; Li et al., 1998; Tovar and Westbrook, 1999; Martel et al., 2009). As Ni2⫹ caused a potentiation of NR2B-containing channels, but a voltage-independent inhibition in those containing NR2A, our previous work on evoked NR currents in these cultures suggested that the effect of Ni2⫹ may change with neuronal development in vitro, switching from stimulatory to inhibitory as NR2A subunit become predominant (Gavazzo et al., 2006). However, the proposed switch was not evident when we examined the effect on the spontaneous currents in 18 –33 DIV range and the effect of Ni2⫹ suggested a preponderance of NR2B-containing receptor throughout all this time range. Ni2⫹-induced modifications in amplitude, frequency and decay time of the currents were most independent of DIV in this time range (Fig. 6), although the effect on the frequency and on decay time diminished slightly with time in culture. The predominance of NR2B-containing receptors was also confirmed by a persistent blocking effect of NR2B antagonists, ifenprodil and Ro25, and by the slow deactivation time of the currents, a feature of NR2B-containing receptors (Flint et al., 1997). Finally both semiquantitative RT-PCR and Western blot indicated that these cultures express mainly the NR2B subunit, and that the composition of NR did not change appreciably with DIV in this range of culture development. Because all evidences support a predominance of NR2B-containing NR, this work also confirms that the effect of Ni2⫹ is a suitable functional indicator of NR subunit composition (Gavazzo et al., 2006, 2009). The present data indicate that NRs do not undergo maturation in these cultures in the time range examined in this work. As the patterns of collective rhythmic activity do change in time spontaneously during in vitro development (Chiappalone et al., 2006; Wagenaar et al., 2006; Pasquale et al., 2008; Bologna et al., 2010), in this time range these cultures are capable to establish synaptic functional connections and general correlated activity, spread over the entire network. However, this evolution does not reflect maturation of NR as reported in different tissues (CullCandy and Leszkiewicz, 2004; Simeone et al., 2004). This conclusion is not in contrast with previous work. The results obtained for evoked currents (Gavazzo et al., 2006) and the partial reversal of Ni2⫹ effect on frequency and time course of decay suggest that NR2A-containing recep-

53

tors gradually start to be expressed, but this may occur with more slowly and less significantly than expected. Indeed some maturation may occur at later DIV, but the time range examined (18 –33 DIV) appeared the most suitable to record consistently and obtain satisfactory statistics. We have successfully recorded from cells up to 38 DIV, and although in two out of six cells the effect of Ni2⫹ appeared inhibitory as expected from a predominance of NR2Acontaining receptors, this result could not be confirmed in different cultures because of aging of the preparation. Similarly, in MEAs older than 40 DIV, Ni2⫹ did not show a clear effect on burst duration; but the same cultures were not responding in a satisfactory manner. It seems that if some maturation occurs, it is hampered by progressive degradation of the culture. The predominance of NR2B-containing receptors is indeed a feature of immature neurons (Monyer et al., 1994; Sheng et al., 1994; Flint et al., 1997) and it is not surprisingly that cultures from embryonic brain retain this immaturity even after several weeks in vitro. Other neuronal models may have a different rate of maturation due to different culture conditions, including the presence of added serum (Zhong et al., 1994; Hoffmann et al., 2000) or chronic depolarization (Bessho et al., 1994; Priestley et al., 1996). It is generally believed that spontaneous NR currents are through synaptic activated receptors, while evoked currents are through all receptors, mainly extrasynaptic. Recent works suggest that expression of NR2A subunit is not a prerequisite to synaptic formation because soon after synapse formation begins, the majority of NR are still extrasynaptic and highly ifenprodil-sensitive (Tovar and Westbrook, 1999) and that, at maturation, NR2A- and NR2B-containing receptors can be located in either synaptic or extrasynaptic compartments (Thomas et al., 2006; Martel et al., 2009). Our data show that while synapses are formed and functioning, the prevalent NR2 subunit is still NR2B, with no requirement, at least in these in vitro conditions, for predominant NR2A expression. This view is in agreement with evidences that NR2B subunit is a vital requirement (Kutsuwada et al., 1996) and that NR2B subunit is critically involved in synaptic expression and function of NMDA receptors (Akashi et al., 2009).

CONCLUSION In conclusion, our results demonstrate that the NR current in embryonic cultured neurons is almost entirely due to NR2B-containing receptors and that Ni2⫹ modifies the electrical activity of cultured cortical neurons through a specific effect on NR channels. Our findings further suggest a role of Ni2⫹ in neuronal injury mediated by NRs. Despite the fact that toxicological literature is almost restricted to Ni2⫹ allergenic properties or carcinogenicity of some of its compounds (Denkhaus and Salnikow, 2002), several reports have indeed suggested that Ni2⫹ may affect development (Smith et al., 1993) and especially neurodevelopment (Slotkin et al., 2007; Slotkin and Seidler, 2009). The present work deals with an acute effect of the

54

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55

metal on immature neurons and the doses considered are consistent with a low to moderate exposure (Casey and Robinson, 1978; Slotkin et al., 2007). However, we do not know the consequences of Ni2⫹ effect on neuronal function. Recent research indicates that NR2B-containing NR currents lead to larger Ca2⫹ accumulations not only because of their longer duration due to slower deactivation (Carmignoto and Vicini, 1992), but also specifically because those channels let permeate more Ca2⫹ per unit of current (Sobczyk et al., 2005). It is possible that Ni2⫹ may exacerbate neuronal injury by potentiating the activity of NR2B-containing NRs, especially in developing neurons. But, as previously remarked, we have no indication that Ni2⫹ alter the total charge crossing the membrane, and additional data, possibly through a different experimental approach, may be required to clarify the real impact of this Ni2⫹ effect on neuronal function. Acknowledgments—We are grateful to Dr Mario Nizzari, Department of Oncology, Biology and Genetics, University of Genova for his skillful help for Western blotting.

REFERENCES Akashi K, Kakizaki T, Kamiya H, Fukaya M, Yamasaki M, Abe M, Natsume R, Watanabe M, Sakimura K (2009) NMDA receptor GluN2B (GluR epsilon 2/NR2B) subunit is crucial for channel function, postsynaptic macromolecular organization, and actin cytoskeleton at hippocampal CA3 synapses. J Neurosci 29:10869 – 10882. Arundine M, Tymianski M (2004) Molecular mechanisms of glutamatedependent neurodegeneration in ischemia and traumatic brain injury. Cell Mol Life Sci 61:657– 668. ATSDR—Agency for Toxic Substances and Diseases Registry (2005) Toxicological profile for nickel. Atlanta, GA: U.S. Department of Health and Human Services. Berretta N, Jones RS (1996) Tonic facilitation of glutamate release by presynaptic N-methyl-D-aspartate autoreceptors in the entorhinal cortex. Neuroscience 75:339 –344. Bessho Y, Nawa H, Nakanishi A (1994) Selective up-regulation of an NMDA receptor subunit mRNA in cultured cerebellar granule cells by K⫹-induced depolarization and NMDA treatment. Neuron 12:87–95. Bologna LL, Pasquale V, Garofalo M, Gandolfo M, Baljon PL, Maccione A, Martinoia S, Chiappalone M (2010) Investigating neuronal activity by SPYCODE multi-channel data analyzer. Neural Netw 23:685– 697. Boyce S, Wyatt A, Webb JK, O’Donnell R, Mason G, Rigby M, Sirinathsinghji D, Hill RG, Rupniak NM (1999) Selective NMDA NR2B antagonists induce antinociception without motor dysfunction: correlation with restricted localisation of NR2B subunit in dorsal horn. Neuropharmacology 38:611– 623. Carmignoto G, Vicini S (1992) Activity-dependent decrease in NMDA receptor responses during development of the visual cortex. Science 258:1007–1011. Casey CE, Robinson MF (1978) Copper, manganese, zinc, nickel, cadmium and lead in human foetal tissues. Br J Nutr 39:639 – 646. Chiappalone M, Bove M, Vato A, Tedesco M, Martinoia S (2006) Dissociated cortical networks show spontaneously correlated activity patterns during in vitro development. Brain Res 1093:41–53. Corlew R, Brasier DJ, Feldman DE, Philpot BD (2008) Presynaptic NMDA receptors: newly appreciated roles in cortical synaptic function and plasticity. Neuroscientist 14:609 – 625. Corlew R, Wang Y, Ghermazien H, Erisir A, Philpot BD (2007) Developmental switch in the contribution of presynaptic and postsynaptic

NMDA receptors to long-term depression. J Neurosci 27:9835– 9845. Cossart R, Hirsch JC, Cannon RC, Dinoncourt C, Wheal HV, Ben-Ari Y, Esclapez M, Bernard C (2000) Distribution of spontaneous currents along the somato-dendritic axis of rat hippocampal CA1 pyramidal neurons. Neuroscience 99:593– 603. Cull-Candy SG, Leszkiewicz DN (2004) Role of distinct NMDA receptor subtypes at central synapses. Sci STKE 2004: re16. Denkhaus E, Salnikow K (2002) Nickel essentiality, toxicity, and carcinogenicity. Crit Rev Oncol Hematol 42:35–56. Draguhn A, Axmacher N, Kolbaev S (2008) Presynaptic ionotropic GABA receptors. Results Probl Cell Differ 44:69 – 85. Fayyazuddin A, Villarroel A, Le Goff A, Lerma J, Neyton J (2000) Four residues of the extracellular N-terminal domain of the NR2A subunit control high-affinity Zn2⫹ binding to NMDA receptors. Neuron 25:683– 694. Fisher JL, Macdonald RL (1998) The role of an alpha subtype M2-M3 His in regulating inhibition of GABAA receptor current by zinc and other divalent cations. J Neurosci 18:2944 –2953. Flint AC, Maisch US, Weishaupt JH, Kriegstein AR, Monyer H (1997) NR2A subunit expression shortens NMDA receptor synaptic currents in developing neocortex. J Neurosci 17:2469 –2476. Gavazzo P, Guida P, Zanardi I, Marchetti C (2009) Molecular determinants of multiple effects of nickel on NMDA receptor channels. Neurotox Res 15:38 – 48. Gavazzo P, Mazzolini M, Tedesco M, Marchetti C (2006) Nickel differentially affects NMDA receptor channels in developing cultured rat neurons. Brain Res 1078:71–79. Gorji A, Scheller D, Tegtmeier F, Kohling R, Straub H, Speckmann EJ (2000) NiCl2 and amiloride induce spreading depression in guinea pig hippocampal slices. Cephalalgia 20:740 –747. Hanganu IL, Kilb W, Luhmann HJ (2001) Spontaneous synaptic activity of subplate neurons in neonatal rat somatosensory cortex. Cereb Cortex 11:400 – 410. Henriksson J, Tallkvist J, Tjalve H (1997) Uptake of nickel into the brain via olfactory neurons in rats. Toxicol Lett 91:153–162. Hoffmann H, Gremme T, Hatt H, Gottmann K (2000) Synaptic activitydependent developmental regulation of NMDA receptor subunit expression in cultured neocortical neurons. J Neurochem 75: 1590 –1599. Hollmann M, Boulter J, Maron C, Beasley L, Sullivan J, Pecht G, Heinemann S (1993) Zinc potentiates agonist-induced currents at certain splice variants of the NMDA receptor. Neuron 10:943–954. Huguenard J (1996) Low-threshold calcium currents in central nervous system neurons. Annu Rev Physiol 58:329 –348. Itzstein C, Cheynel H, Burt-Pichat B, Merle B, Espinosa L, Delmas PD, Chenu C (2001) Molecular identification of NMDA glutamate receptors expressed in bone cells. J Cell Biochem 82:134 –144. Kalia LV, Kalia SK, Salter MW (2008) NMDA receptors in clinical neurology: excitatory times ahead. Lancet Neurol 7:742–755. Kang HW, Moon HJ, Joo SH, Lee JH (2007) Histidine residues in the IS3-IS4 loop are critical for nickel-sensitive inhibition of the Cav2.3 calcium channel. FEBS Lett 581:5774 –5780. Kang HW, Park JY, Jeong SW, Kim JA, Moon HJ, Perez-Reyes E, Lee JH (2006) A molecular determinant of nickel inhibition in Cav3.2 T-type calcium channels. J Biol Chem 281:4823– 4830. Kew JN, Richards JG, Mutel V, Kemp JA (1998) Developmental changes in NMDA receptor glycine affinity and ifenprodil sensitivity reveal three distinct populations of NMDA receptors in individual rat cortical neurons. J Neurosci 18:1935–1943. Kristiansen LV, Huerta I, Beneyto M, Meador-Woodruff JH (2007) NMDA receptors and schizophrenia. Curr Opin Pharmacol 7:48 –55. Kutsuwada T, Sakimura K, Manabe T, Takayama C, Katakura N, Kushiya E, Natsume R, Watanabe M, Inoue Y, Yagi T, Aizawa S, Arakawa M, Takahashi T, Nakamura Y, Mori H, Mishina M (1996) Impairment of suckling response, trigeminal neuronal pattern for-

P. Gavazzo et al. / Neuroscience 177 (2011) 43–55 mation, and hippocampal LTD in NMDA receptor epsilon 2 subunit mutant mice. Neuron 16:333–344. Li JH, Wang YH, Wolfe BB, Krueger KE, Corsi L, Stocca G, Vicini S (1998) Developmental changes in localization of NMDA receptor subunits in primary cultures of cortical neurons. Eur J Neurosci 10:1704 –1715. Marchetti C, Gavazzo P (2003) Subunit-dependent effects of nickel on NMDA receptor channels. Brain Res Mol Brain Res 117:139 –144. Marchetti C, Gavazzo P (2005) NMDA receptors as targets of heavy metal interaction and toxicity. Neurotox Res 8:1–14. Martel MA, Wyllie DJ, Hardingham GE (2009) In developing hippocampal neurons, NR2B-containing N-methyl-D-aspartate receptors (NMDARs) can mediate signaling to neuronal survival and synaptic potentiation, as well as neuronal death. Neuroscience 158:334 –343. Martinoia S, Bonzano L, Chiappalone M, Tedesco M, Marcoli M, Maura G (2005) In vitro cortical neuronal networks as a new high-sensitive system for biosensing applications. Biosens Bioelectron 20:2071– 2078. Masuko T, Kashiwagi K, Kuno T, Nguyen ND, Pahk AJ, Fukuchi J, Igarashi K, Williams K (1999) A regulatory domain (R1-R2) in the aminoterminus of the N-methyl-D-aspartate receptor: effects of spermine, protons, and ifenprodil, and structural similarity to bacterial leucine/isoleucine/valine binding protein. Mol Pharmacol 55:957–969. Mayer ML, Vyklicky L Jr, Westbrook GL (1989) Modulation of excitatory amino acid receptors by group IIB metal cations in cultured mouse hippocampal neurones. J Physiol 415:329 –350. Mayer ML, Westbrook GL (1987) Permeation and block of N-methylD-aspartic acid receptor channels by divalent cations in mouse cultured central neurones. J Physiol 394:501–527. Monyer H, Burnashev N, Laurie DJ, Sakmann B, Seeburg PH (1994) Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron 12:529 –540. Mullen RJ, Buck CR, Smith AM (1992) NeuN, a neuronal specific nuclear protein in vertebrates. Development 116:201–211. Pasquale V, Martinoia S, Chiappalone M (2009) A self-adapting approach for the detection of bursts and network bursts in neuronal cultures. J Comput Neurosci 29:213–229. Pasquale V, Massobrio P, Bologna LL, Chiappalone M, Martinoia S (2008) Self-organization and neuronal avalanches in networks of dissociated cortical neurons. Neuroscience 153:1354 –1369. Poulain P (2001) Two distinct types of repetitive bursting activity mediated by NMDA in hypothalamic neurons in vitro. Eur J Neurosci 14:657– 665. Priestley T, Ochu E, Macaulay AJ (1996) Time-dependent changes in NMDA receptor expression in neurones cultured from rat brain. Brain Res Mol Brain Res 40:271–274. Rumbaugh G, Prybylowski K, Wang JF, Vicini S (2000) Exon 5 and spermine regulate deactivation of NMDA receptor subtypes. J Neurophysiol 83:1300 –1306. Rumbaugh G, Vicini S (1999) Distinct synaptic and extrasynaptic NMDA receptors in developing cerebellar granule neurons. J Neurosci 19:10603–10610.

55

Sheng M, Cummings J, Roldan LA, Jan YN, Jan LY (1994) Changing subunit composition of heteromeric NMDA receptors during development of rat cortex. Nature 368:144 –147. Simeone TA, Sanchez RM, Rho JM (2004) Molecular biology and ontogeny of glutamate receptors in the mammalian central nervous system. J Child Neurol 19:343–360; discussion 361. Slotkin TA, MacKillop EA, Ryde IT, Tate CA, Seidler FJ (2007) Screening for developmental neurotoxicity using PC12 cells: comparisons of organophosphates with a carbamate, an organochlorine, and divalent nickel. Environ Health Perspect 115:93–101. Slotkin TA, Seidler FJ (2009) Oxidative and excitatory mechanisms of developmental neurotoxicity: transcriptional profiles for chlorpyrifos, diazinon, dieldrin, and divalent nickel in PC12 cells. Environ Health Perspect 117:587–596. Smith MK, George EL, Stober JA, Feng HA, Kimmel GL (1993) Perinatal toxicity associated with nickel chloride exposure. Environ Res 61:200 –211. Sobczyk A, Scheuss V, Svoboda K (2005) NMDA receptor subunitdependent [Ca2⫹] signaling in individual hippocampal dendritic spines. J Neurosci 25:6037– 6046. Staruschenko A, Dorofeeva NA, Bolshakov KV, Stockand JD (2007) Subunit-dependent cadmium and nickel inhibition of acid-sensing ion channels. J Neurobiol 67:97–107. Thomas CG, Miller AJ, Westbrook GL (2006) Synaptic and extrasynaptic NMDA receptor NR2 subunits in cultured hippocampal neurons. J Neurophysiol 95:1727–1734. Tovar KR, Westbrook GL (1999) The incorporation of NMDA receptors with a distinct subunit composition at nascent hippocampal synapses in vitro. J Neurosci 19:4180 – 4188. Wagenaar DA, Pine J, Potter SM (2006) An extremely rich repertoire of bursting patterns during the development of cortical cultures. BMC Neurosci 7:11. Wasterlain CG, Chen JWY (2008) Mechanistic and pharmacologic aspects of status epilepticus and its treatment with new antiepileptic drugs. Epilepsia 49:63–73. Williams K (1993) Ifenprodil discriminates subtypes of the N-methylD-aspartate receptor: selectivity and mechanisms at recombinant heteromeric receptors. Mol Pharmacol 44:851– 859. Woodhall G, Evans DI, Cunningham MO, Jones RS (2001) NR2Bcontaining NMDA autoreceptors at synapses on entorhinal cortical neurons. J Neurophysiol 86:1644 –1651. Yashiro K, Philpot BD (2008) Regulation of NMDA receptor subunit expression and its implications for LTD, LTP, and metaplasticity. Neuropharmacology 55:1081–1094. Zhang L, Zheng X, Paupard MC, Wang AP, Santchi L, Friedman LK, Zukin RS, Bennett MV (1994) Spermine potentiation of recombinant N-methyl-D-aspartate receptors is affected by subunit composition. Proc Natl Acad Sci U S A 91:10883–10887. Zhong J, Russell SL, Pritchett DB, Molinoff PB, Williams K (1994) Expression of mRNAs encoding subunits of the N-methyl-D-aspartate receptor in cultured cortical neurons. Mol Pharmacol 45: 846 – 853.

(Accepted 15 December 2010) (Available online 21 December 2010)