- Email: [email protected]
Nitric oxide restrain root growth by DNA damage induced cell cycle arrest in Arabidopsis thaliana
Nitric Oxide 26 (2012) 54–60
Contents lists available at SciVerse ScienceDirect
Nitric Oxide journal homepage: www.elsevier.com/locate/yniox
Nitric oxide restrain root growth by DNA damage induced cell cycle arrest in Arabidopsis thaliana Sulan Bai a,⇑, Miaomiao Li a, Tao Yao a, Hui Wang a, Yaochuan Zhang b, Lihong Xiao a, Jinzheng Wang a, Zhen Zhang a, Yong Hu a, Weizhong Liu c, Yikun He a,⇑ a b c
Key Laboratory of Genetics and Biotechnology, College of Life Sciences, Capital Normal University, Beijing 100048, PR China Department of Horticulture, Beijing Vocational College of Agriculture, Beijing 102442, PR China College of Life Sciences, Shanxi Normal University, Shanxi 041004, PR China
a r t i c l e
i n f o
Article history: Received 27 July 2011 Revised 6 December 2011 Available online 14 December 2011 Keywords: Cell-cycle response Cue1 DNA damage NO Root growth
a b s t r a c t Nitric oxide (NO) participates in the regulation of diverse functions in plant cells. However, different NO concentrations may trigger different pathways during the plant development. At basal levels of NO, plants utilize the NO signaling transduction pathway to facilitate plant growth and development, whereas higher concentrations trigger programmed cell death (PCD). Our results show that NO lower than the levels causing PCD, but higher than the basal levels induce DNA damage in root cells in Arabidopsis as witnessed by a reduction in root growth, rather than cell death, since cells retain the capacity to differentiate root hairs. The decrease in meristematic cells and increase in DNA damage signals in roots in responses to NO are in a dose dependent manner. The restraint of root growth is due to cell cycle arrest at G1 phase which is caused by NO induced DNA damage, besides a second arrest at G2/M existed in NO supersensitive mutant cue1. The results indicate that NO restrain root growth via DNA damage induced cell cycle arrest. Ó 2011 Elsevier Inc. All rights reserved.
Introduction The gas, NO, is a small and non polar molecule, readily soluble in water and lipids. Once produced, it moves within and between cells by diffusion. Thus, the range of its effects is limited to the cell in which it is generated, or to cells in the near neighborhood [1]. At low concentrations (less than 1 lM), NO can have a half-life of minutes to hours and could thus diffuse over several cell layers or over longer distances in intercellular spaces. At higher concentrations, NO has a much shorter half-life, in the order of seconds [1]. Thus, NO has a role in coordinating plant growth and development. It has diverse functions such as disease resistance, abiotic stress, respiration, senescence, stomatal closure, xylem differentiation, root development, seed germination, hormone responses, cold response and flower timing control [2–12]. NO in excess is toxic to bacteria, fungi, microbial parasites, tumor cells, and viruses as well as to higher organisms [7]. In plants excess endogenous NO reduces growth and delays development [8] and, at high concentrations, can induce programmed cell death [4,13]. In cell cultures, the ratio of NO to hydrogen peroxide is crucial for inducing cell death [4,13,14]. The involvement of NO in promoting root growth has been observed by Gouveˆa et al. [15]. A stress to centrifuge isolated leaves and callus can induce NO generation and PCD ⇑ Corresponding authors. Fax: +86 10 68981191. E-mail addresses: [email protected] (S. Bai), [email protected] (Y. He). 1089-8603/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.niox.2011.12.001
and subsequent DNA fragmentation [16]. However, it is not clear how the intact plant responds to different levels of NO treatment. In this work, we chose to investigate the responses of Arabidopsis root to NO in NO hypersensitive cue1 mutant that displayed an elevated level of endogenous NO, and showed root-growth hypersensitivity to NO donor, sodium nitroprusside (SNP) [8]. We aim to elucidate the mechanism of how NO caused developmental arrest in Arabidopsis roots and seek to determine whether NO induces DNA damage in intact plant cells and does have a checkpoint response to DNA damage. Materials and methods Stocks Seeds of Arabidopsis thaliana L. (Columbia) were used throughout. The cue1 seeds were the gift from Dr. J. Chory (Salk Institute). The cue1 mutants have an elevated level of endogenous NO and are hypersensitive to NO [8]. The CYCB1;1-GUS reporter line was the gift of Peter Doerner (University of Edinburgh) and was crossed into the cue1 background and selected in our laboratory. Plant growth conditions Plants were grown in growth chambers under 22 °C and a photoperiod of 16 h. Light was supplied by cool white fluorescent
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
55
bulbs (100 lmol m2 s1). Prior to placement in the growth chamber, seeds were surface sterilized with 20% bleach, rinsed in water, and placed at 4 °C for 3–4 days in darkness. Seeds were then plated on half-strength Murashige and Skoog (MS) media (Sigma–Aldrich, St. Louis, MO) supplemented with 1% sucrose and solidified with 0.8% agar. The NO donor, sodium nitroprusside, dissolved in water, was added separately into the medium and mixed well before gelation. Unless indicated otherwise, seeds were plated on medium containing nitroprusside (or on control medium) and effects assayed 6 days later. Scanning electron microscopy (SEM) SEM observations were conducted as described [17]. Six-dayold seedlings of cue1 and wild type (WT) (Columbia background) were fixed in FAA (formaldehyde:acetic acid:ethanol:H2O, 10:5:50:35, by vol.) and dehydrated in a graded ethanol series. Materials were critical-point-dried using liquid CO2, mounted on aluminum stubs with double-sided tape, gold-coated with an Edwards S150B sputter coater, and then examined under a scanning electron microscope (Hitachi S-4800, at 30 kV). At least 20 root tips were scored for each sample in each experiment; data were pooled from three independent experiments. Cell viability assay Six-day-old seedlings were collected and stained with the fluorescent stain, 40 ,6-diamidino-2-phenylindole (DAPI) at 3 lM in staining buffer (100 mM Tris, pH 7.4, 150 mM NaCl, 1 mM CaCl2, 0.5 mM MgCl2, 0.1% Nonidet P-40, Invitrogen), and mounded on
Fig. 2. Root morphology of SEM images in response to nitroprusside for wild type and cue1. Plants treated as for Fig. 1. Scale bar = 100 lm.
Fig. 3. Histology in response to nitroprusside for the wild type. Plants were treated as for Fig. 1 and stained with propidium iodide. Root meristem zone from the quiescent centre (marked with star) to the boundary cells obviously elongated (marked with arrow) in cortex cells. Scale bar = 50 lm. Fig. 1. Root growth in response to sodium nitroprusside (SNP) for Columbia wild type and cue1. Seeds were plated on the indicated concentrations and assayed after 6 days. (A) Overview of seedlings. (B) Quantification.
microscope slides. Then the nuclei of root tip were observed under fluorescence microscopy, with excitation at 360–400 nm (Leica
56
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
Fig. 4. Numbers of mitotic cells in response to nitroprusside for wild type and cue1. (A–D) Differential interference contrast micrographs of cleared roots. (A) Low power image of wild-type root. Higher magnification images of (B–C) wild type and (D) cue1. Arrows call out cells judged to be in mitosis. B is an enlarged view of C. (E) Quantification, M phase cells/100 cells.
DMRE 2). A DAPI assay demonstrated that nuclei were intact regardless of the chromatin condensation and dead cells [18]. To detect the cell viability, the red-fluorescent propidium iodide dye (excitation/ emission maxima 535/617 nm, when bound to DNA) was used, which is permeant only to dead cells. PI was used at 5 lg/ml in staining buffer (1 PBS, 0.2% BSA, 0.1% sodium azide) [19]. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay The TUNEL assay was used for the whole mount in situ detection of DNA damage. For the assay, 6-day-old seedlings were fixed in FAA. After washing with 1 PBS twice, the fixed seedlings were then treated with 40 lg/ml proteinase K at 37 °C for 30 min. The TUNEL assay was then performed using the DeadEnd Colorimetric (and Fluorometric) Apoptosis Detection System (Promega) in accordance with the manufacturer’s instructions. Finally, the seedlings were mounted on slides and observed and photographed through a fluorescence microscope (excitation/emission maxima 475/540 nm) (Leica DMRE 2). At least 20 root tips were scored for each sample in each experiment; data were pooled from two independent experiments. Total RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR) The total RNA was isolated using the Trizol regent (Invitrogen) according to the procedures. The concentration of the total RNA
was measured by spectrophotometer NanoDrop Instrument (NanoDrop Technologies, Wilmington, DE, USA). The total RNA was reverse transcribed to cDNA using the RevertAid M-MULV Reverse Transcriptase (Fermentas). Real-time PCR was performed using SYBR green PCR master mix (Applied) and a Bio-Rad iQ5 real-time PCR detection system. All reaction were repeated at least three times. Statistical analysis of the results of real-time PCR was performed using iQ5 software. Three DNA damage response genes (PARP1, PARP2 and RAD51) were amplified. ACT2 served as control. The primer pair sequences are as follows: PARP1: 50 cacggttcacgtctcactaactg 30 , 50 gaggagctattcgcagacct tg 30 ; PARP2: 50 gcattgcgatatctcaccacttcc 30 , 50 cctctagctcaagact ccactctg 30 ; RAD51: 50 gtgagttccgctctggaaagactc 30 , 50 acctccttgatccatgg gaagttg 30 ; ACT2: 50 ctggatcggtggttccattc 30 , 50 cctggacctgcctcatcatac 30 . CYCLINB1;1-GUS staining Cells in G2/M phase were identified in plants containing the CYCB1;1-GUS reporter construct, described in Cólon-Carmona et al. [20]. Six-day-old seedlings were stained for the presence of b-glucuronidase as described previously [21]. At least 20 root tips were scored for each sample in each experiment; data were pooled from two independent experiments.
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
57
Fig. 5. TUNEL staining in response to nitroprusside for wild type and cue1. Plants treated as for Fig. 1 and double stained for DAPI (blue) and for TUNEL positive nuclei (green), and imaged with confocal microscopy. (A Left) DAPI staning of nuclei (blue). (A right) TUNEL positive nuclei control (green). (B upper panel) Wild-type seedlings treated as for Fig. 1. (B lower panel) The cue1 mutant seedlings treated as for Fig. 1. Representative images from three replicate experiments. Scale bars = 50 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).
Fig. 6. Expression levels of three DNA damage-responsive genes in response to nitroprusside for wild type and cue1. Expression was analyzed by real-time quantitative RTPCR (qRT-PCR) with RNA isolated from roots treated as for Fig. 1. ACT2 was used as an internal control. Significant differences are indicated by asterisks: ⁄P < 0.05; ⁄⁄P < 0.01.
Direct assay for mitotic cells Mitotic cells were assayed as described previously [21], with modifications. Six-day-old seedlings fixed with FAA for 2 h, followed by several rinses in distilled water. After rinsing, seedlings were mounted in an aqueous solution of glycerol and chloral hydrate, as described by Sabatini et al. [22]. The coverslips were sealed to the slide with clear fingernail polish and then gentle pressure was applied to the coverslip above each root tip. Samples were imaged with differential interference contrast (DIC) optics on a Leica DMRE 2 microscope. Using a 20 objective, each root tip was examined by focusing through each tip several times. Cells with clearly condensed chromosomes were classified as mitotic. At least 20 root tips were scored for each treatment in each experiment, and data were pooled from two independent experiments. Flow cytometry Sodium nitroprusside (in solidified growth medium) at the desired concentration was added to the upper cover of plates and the effects were analyzed after a 24-h treatment. Because NO is a gas, and is expected to reach equilibrium rapidly inside the plate, this method of treatment should be equivalent to the customary method of seedlings growing over agar medium containing
nitroprusside. Root tips of about 1 mm in length from approximately 600 seedlings were harvested. Nuclei were prepared from the harvested tissue as described previously [21,23]. Flow cytometry was performed on a flow cytometer (Backman Quanta SC) according to manufacturer recommendations. No fewer than 5000 nuclei were collected for each treatment. Data were pooled from two independent experiments. Results Root growth is arrested in response to NO To study the effects of NO on root growth, we germinated seeds in the presence of the NO donor, sodium nitroprusside (SNP), and examined the effects on the roots after 6 days. By this time, the wild type grows vigorously and has fully established its seedling condition. As a comparison to the wild type, we used the chlorophyll a/b binding protein under-expressed (cue1) mutant, which over produces NO because of an accumulation of arginine and citrulline [24]. On control medium, root length of the two genotypes was indistinguishable (Fig. 1). However, with increasing nitroprusside concentration, the mutant responded far more sensitively than did the wild type, with 2 lM nitroprusside in cue1 inhibiting growth more effectively than 2 lM in the wild type. At 50 lM nitroprusside, elongation of both genotypes was essentially zero.
58
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
NO and cell death To observe the effects of nitroprusside on root morphology, we used scanning electron microscopy (SEM). The NO donor caused root swelling and a decrease of the presumptive meristem, and these effects occurred at lower concentration in cue1 compared to the WT (Fig. 2). Seedlings exposed to even 50 lM nitroprusside were nevertheless able to produce root hairs. There was no evidence of collapsed or necrotic cells. To determine whether the extremely reduced root growth at high concentrations of nitroprusside was associated with cell death, we stained nitroprusside-treated roots with DAPI (data not shown) that demonstrated that nuclei were intact. Then PI staining was used (Fig. 3) and few if any dead cells were seen. PI stain cell walls are excluded from living cells. NO reduces the number of dividing cells and meristem cells To assess the effects of NO on cell division, we counted mitotic cells. In cleared roots, cells in metaphase and anaphase are distinct in differential interference microscopy, thanks to their condensed chromosomes (Fig. 4A–D). The numbers of mitotic cells per root decreased in response to nitroprusside (Fig. 4E). Doses above 2 lM were required to elicit an effect in the wild type whereas that dose caused almost a saturating effect in cue1. Also we find the decreased meristem zone [from the quiescent centre (marked with star) to elongated cells (marked with arrow) in cortex cells] in responses to increased SNP concentration (Fig. 3). This pattern of response for the two genotypes is nearly identical to that of root elongation (Fig. 1) and implies that NO reduces root elongation by interfering with cell division. NO induces DNA damage
Fig. 7. Nuclear DNA content in response to nitroprusside for wild type and cue1. Five day old seedlings were treated for 24 h prior to assay by flow cytometry. (A) Frequency distributions of DNA content of nuclei. (B) Relative abundance of nuclei with different DNA contents expressed as a percent of total.
Because NO treatment reduced the number of cells in the presumptive meristem, we tested whether DNA was damaged and the cell cycle arrested. To assay DNA damage, we used the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. In the wild type, TUNEL-positive nuclei appeared in seedlings treated with 20 and 50 lM nitroprusside (Fig. 5B upper panel). For
Fig. 8. CYCB1;1-GUS expression in response to nitroprusside for wild type and cue1. Plants treated as for Fig. 1. Scale bars = 50 lm.
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
the cue1 mutant, TUNEL-positive nuclei were abundant at 2 lM, an increase in sensitivity similar to that seen for root elongation. At higher concentrations the histology of the cue1 root was severely disrupted making comparisons difficult, and although positive nuclei were seen, they appeared to be less abundant than for the wild type (Fig. 5B lower panel). To confirm the induction of DNA damage, we assayed the steady state levels of three transcripts, PARP1, PARP2 and RAD51, that are regulated by DNA damage [25]. In the wild type, the levels of all three transcripts increased as a function of nitroprusside concentration, except declined precipitously on 50 lM (Fig. 6). In cue1, the responses of all three transcripts were generally consistent with that in wild type, except an increased sensitivity to NO, which may due to the elevated level of endogenous NO in cue1 mutant. NO cause cell cycle arrest To determine whether the decrease in dividing cell number in roots treated with NO was associated with cell cycle arrest, we used flow cytometry. Because we were unable to harvest sufficient numbers of nuclei from roots grown on 50 lM nitroprusside for 6 days, in this experiments seedlings were grown on control medium for 5 days and then transferred to experimental plates for 1 day prior to harvesting. In roots of A. thaliana, endoreduplication begins soon after cell division ends and profiles of DNA content of cells from even the first few millimeters of the tip commonly contain many 8C, 16C and even 32C levels (Fig. 7; also see Boudolf et al. [26]). Interestingly, compared to the wild type, cue1 roots contained greater percentages of nuclei with 4C, 8C, and 16C levels and fewer 2C nuclei. The reason for these differences is not known. In both genotypes, 50 lM nitroprusside substantially increased the percentage of 2C nuclei, consistent with G1 arrest; however, in the wild type, there was little change in levels of endoreduplication, whereas in cue1 the percentage of 8C nuclei increased. These responses, along with the responses to DNA damage, suggest that the response of cue1 to NO differs somewhat from that of the wild type. Finally, in both genotypes exposed to nitroprusside, the background (that is, the fluorescence level between peaks) was higher than for untreated seedlings, which is consistent with the presence of DNA damage. To assay for the presence of cells in G2/M phase by an alternative method, we used the CYCB1;1-GUS reporter [20] which fuses the N-terminal portion of CYCB1;1 containing a mitotic destruction box to the b-glucuronidase gene. GUS-positive cells therefore were primarily in G2/M at the time of staining. We found both cells in WT and cue1 root tips progressed into G2 at 0, 2, 20 lM SNP treatment. However, only the cue1 root tips grown on 20 lM SNP medium accumulated more G2/M cells while others did not (Fig. 8). With 50 lM SNP treatment, neither WT nor cue1 plants had G2/ M phase, implicating that they almost did not start any cell cycle process at high NO concentrations. These data, taken together with the mitotic index investigations, suggest that NO treatment of cue1 seedlings triggers a second arrest in G2/M besides G1 arrest. Discussion Root growth is highly responsive to environmental signals. In this paper, we demonstrated that NO restrains root growth and development by DNA damage induced cell cycle arrest. Taking into consideration the fact that NO induce DNA damage in intact plant root cells rather than cell death at lower concentrations, the antioxidant system may be applied at this status but inactive at high levels of NO concentration. Therefore, the lower concentrations of NO do not induce cell death but DNA damage in intact plant cells, and the cells with damaged DNA are not only viable but are capable of expansion and differentiation.
59
NO function in intact plant is different from culture cell that direct reaction with NO which make cell death. In intact plant, the immunosystem is stimulated and then defense the NO stress; and the DNA repair system restore NO induce DNA damage and make plant survive. The cue1 mutant has higher level of NO. Moreover, cue1 is impaired in chloroplast and mesophyll development [5,27]. NO is toxic to plants at high concentrations. The cue1 mutant has higher levels of endogenous NO than the wild type has, adscititious NO will easily elevate NO to the toxic levels in cue1 plant and cause NO induced effects. The malfunction of organelles may lead to the release of reactive oxygen species, the chemical reaction between NO and H2O2 produces either singlet oxygen or hydroxyl radicals [28]. Those may cause cue1 hypersensitive to NO. Besides, our research showed that G1 arrest existed in both cue1 and WT plant cells, but cue1 has a second arrest at G2/M phase which does not existed in WT. Plants need to pass on an intact copy of the genome to the next generation, combined with the requirement for a highly functional genome in meristematic tissues. It suggests that there would be a definite selective advantage to the genome-stabilizing effects of cell-cycle checkpoints. Plants evolve active surveillance mechanisms known as DNA damage checkpoint pathways to protect their genomic integrity [25,29]. Using WT and NO sensitive mutant cue1 with higher level of endogenous NO, we found that high levels of NO induced DNA damage in both WT and cue1 plants, and the damage degrees were different in response to different concentrations of SNP treatment. DNA damage checkpoint pathways should activate and cell-cycle should slowdown to allow time to repair damaged DNA. As a matter of fact, we found that NO caused root development arrest both in cue1 and WT, and the heavier the damage, the more the arrest. Thus we reached the conclusion that the cell cycle arrest in response to NO is caused by NO induced DNA damage. In the future, it will be challenging to gain more information on the NO functions in plant growth and development. Future experiments are necessary to further test the NO work model and functioning mechanisms. Conclusions Basal levels of NO affect plant growth and development. Here, we show that specifically levels of NO induce DNA damage in Arabidopsis root cells in a dose-dependent manner, since cells retain the capacity to differentiate root hairs. The future experiments show this NO induced DNA damage also cause cell cycle arrest at G1 phase, but in NO supersensitive mutant cue1 exist a second arrest at G2/M. Our results provide significative information for further test the NO work model and functioning mechanisms in plants. Acknowledgments We thank Dr. Tobias Baskin at Department of Biology, University of Massachusetts for the critical reading and commenting on this manuscript. This research work was supported by Natural Science Foundation of China (No. 30771094), Beijing Natural Science Foundation(Nos. 5082003, 5112006) and The National Key Scientific Program-Nanoscience and Nanotechnology (No. 2007CB948201 to He). References [1] Y.A. Henry, B. Ducastel, A. Guissani, Basic Chemistry of Nitric Oxide and Related Nitrogen Oxides, Biomedical Publishing Landes Company, 1997. pp. 15–46. [2] R. Desikan, M.K. Cheung, J. Bright, D. Henson, J.T. Hancock, S.J. Neill, ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells, J. Exp. Bot. 55 (2004) 205–212.
60
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
[3] M.C. Romero-Puertas, M. Perazzolli, E.D. Zago, M. Delledonne, Nitric oxide signalling functions in plant–pathogen interactions, Cell. Microbiol. 6 (2004) 795–803. [4] S. Neill, NO way to die – nitric oxide, programmed cell death and xylogenesis, New Phytol. 165 (2005) 5–7. [5] N.M. Crawford, F.Q. Guo, New insights into nitric oxide metabolism and regulatory functions, Trends Plant Sci. 10 (2005) 195–200. [6] D.D. Wendehenne, J. Daniel, Nitric oxide: a new player in plant signalling and defense responses, Curr. Opin. Plant Biol. 7 (2004) 449–455. [7] C. Stohr, W.R. Ullrich, Generation and possible roles of NO in plant roots and their apoplastic space, J. Exp. Bot. 53 (2002) 2293–2303. [8] Y.K. He, R.H. Tang, Y. Hao, R.D. Stevens, C.W. Cook, S.M. Am, L.F. Jing, Z.G. Yang, L.G. Chen, F.Q. Guo, F. Fiorani, R.B. Jackson, N.M. Crawford, Z.M. Pei, Nitric oxide represses the Arabidopsis floral transition, Science 305 (2004) 1968–1971. [9] C. Cantrel, T. Vazquez, J. Puyaubert, N. Reze, M. Lesch, W.M. Kaiser, C. Dutilleul, I. Guillas, A. Zachowski, E. Baudouin, Nitric oxide participates in coldresponsive phosphosphingolipid formation and gene expression in Arabidopsis thaliana, New Phytol. 189 (2011) 415–427. [10] I. Guillas, A. Zachowski, E. Baudouin, A matter of fat: interaction between nitric oxide and sphingolipid signaling in plant cold response, Plant Signal. Behav. 6 (2011) 140–142. [11] J. Lozano-Juste, J. Leon, Nitric oxide regulates DELLA content and PIF expression to promote photomorphogenesis in Arabidopsis, Plant Physiol. 156 (2011) 1410–1423. [12] A. Zhang, J. Zhang, N. Ye, H. Zhang, M. Tan, M. Jiang, Nitric oxide mediates brassinosteroid-induced ABA biosynthesis involved in oxidative stress tolerance in maize leaves, Plant Cell Physiol. 52 (2011) 181–192. [13] A. Clarke, R. Desikan, R.D. Hurst, J.T. Hancock, S.J. Neill, NO way back: nitric oxide and programmed cell death in Arabidopsis thaliana suspension cultures, Plant J. 24 (2000) 667–677. [14] M. Delledonne, J. Zeier, A. Marocco, C. Lamb, Signal interactions between nitric oxide and reactive oxygen intermediates in the plant hypersensitive disease resistance response, Proc. Natl. Acad. Sci. U S A 98 (2001) 13454–13459. [15] C. Gouveˆa, J. Souza, C. Magalhaes, I. Martins, NO-releasing substances that induce growth elongation in maize root segments, Plant Growth Regul. 21 (1997) 183–187. [16] M.C. Pedroso, J.R. Magalhaes, D. Durzan, Nitric oxide induces cell death in Taxus cells, Plant Sci. 157 (2000) 173–180. [17] S.L. Bai, Y.B. Peng, J.X. Cui, H.T. Gu, L.Y. Xu, Y.Q. Li, Z.H. Xu, S.N. Bai, Developmental analyses reveal early arrests of the spore-bearing parts of
[18] [19]
[20]
[21]
[22]
[23] [24]
[25]
[26]
[27]
[28]
[29]
reproductive organs in unisexual flowers of cucumber (Cucumis sativus L.), Planta 220 (2004) 230–240. B.I. Tarnowsk, F.G. Spinale, J.H. Nicholson, DAPI as a useful stain for nuclear quantitation, Biotech. Histochem. 66 (1991) 297–302. M. Curtis, J. Hays, Tolerance of dividing cells to replication stress in UVBirradiated Arabidopsis roots: requirements for DNA translesion polymerases h and z, DNA Repair 6 (2007) 1341–1358. A. Colon-Carmona, R. You, T. Haimovitch-Gal, P. Doerner, Technical advance: spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein, Plant J. 20 (1999) 503–508. E. Hefner, N. Huefner, A.B. Britt, Tissue-specific regulation of cell-cycle responses to DNA damage in Arabidopsis seedlings, DNA Repair (Amst) 5 (2006) 102–110. S. Sabatini, D. Beis, H. Wolkenfelt, J. Murfett, T. Guilfoyle, J. Malamy, P. Benfey, O. Leyser, N. Bechtold, P. Weisbeek, B. Scheres, An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root, Cell 99 (1999) 463– 472. M.H. Fox, D.W. Galbraith, Application of Flow Cytometry and Sorting to Higher Plant Systems, Wiley-Liss Inc., 1990. pp. 633–650. H. Li, K. Culligan, R.A. Dixon, J. Chory, C4UE1: a mesophyll cell-specific positive regulator of light-controlled gene expression in Arabidopsis, Plant Cell 7 (1995) 1599–1610. C.X. Wang, Z.C. Liu, Arabidopsis ribonucleotide reductases are critical for cell cycle progression, DNA damage repair, and plant development, Plant Cell 18 (2006) 350–365. V. Boudolf, K. Vlieghe, G. Beemster, Z. Magyar, J.A.T. Acosta, S. Maes, V.D. Schueren, D.E. Inzé, L.D. Veylder, The plant-specific cyclin-dependent kinase CDKB1;1 and transcription factor E2Fa-DPa control the balance of mitotically dividing and endoreduplicating cells in Arabidopsis, Plant Cell 16 (2004) 2683– 2692. L. Voll, R.E. Hausler, R. Hecker, A. Weber, G. Weissenbock, G. Fiene, S. Waffenschmidt, U. Flugge, The phenotype of the arabidopsis cue1 mutant is not simply caused by a general restriction of the shikimate pathway, Plant J. 36 (2003) 301–317. A.A. Noronhadutra, M.M. Epperlein, N. Woolf, Reaction of nitric-oxide with hydrogen-peroxide to produce potentially cytotoxic singlet oxygen as a model for nitric oxide-mediated killing, FEBS Lett. 321 (1993) 59–62. S.B. Preuss, A.B. Britt, A DNA-damage-induced cell cycle checkpoint in Arabidopsis, Genetics 164 (2003) 323–334.
Contents lists available at SciVerse ScienceDirect
Nitric Oxide journal homepage: www.elsevier.com/locate/yniox
Nitric oxide restrain root growth by DNA damage induced cell cycle arrest in Arabidopsis thaliana Sulan Bai a,⇑, Miaomiao Li a, Tao Yao a, Hui Wang a, Yaochuan Zhang b, Lihong Xiao a, Jinzheng Wang a, Zhen Zhang a, Yong Hu a, Weizhong Liu c, Yikun He a,⇑ a b c
Key Laboratory of Genetics and Biotechnology, College of Life Sciences, Capital Normal University, Beijing 100048, PR China Department of Horticulture, Beijing Vocational College of Agriculture, Beijing 102442, PR China College of Life Sciences, Shanxi Normal University, Shanxi 041004, PR China
a r t i c l e
i n f o
Article history: Received 27 July 2011 Revised 6 December 2011 Available online 14 December 2011 Keywords: Cell-cycle response Cue1 DNA damage NO Root growth
a b s t r a c t Nitric oxide (NO) participates in the regulation of diverse functions in plant cells. However, different NO concentrations may trigger different pathways during the plant development. At basal levels of NO, plants utilize the NO signaling transduction pathway to facilitate plant growth and development, whereas higher concentrations trigger programmed cell death (PCD). Our results show that NO lower than the levels causing PCD, but higher than the basal levels induce DNA damage in root cells in Arabidopsis as witnessed by a reduction in root growth, rather than cell death, since cells retain the capacity to differentiate root hairs. The decrease in meristematic cells and increase in DNA damage signals in roots in responses to NO are in a dose dependent manner. The restraint of root growth is due to cell cycle arrest at G1 phase which is caused by NO induced DNA damage, besides a second arrest at G2/M existed in NO supersensitive mutant cue1. The results indicate that NO restrain root growth via DNA damage induced cell cycle arrest. Ó 2011 Elsevier Inc. All rights reserved.
Introduction The gas, NO, is a small and non polar molecule, readily soluble in water and lipids. Once produced, it moves within and between cells by diffusion. Thus, the range of its effects is limited to the cell in which it is generated, or to cells in the near neighborhood [1]. At low concentrations (less than 1 lM), NO can have a half-life of minutes to hours and could thus diffuse over several cell layers or over longer distances in intercellular spaces. At higher concentrations, NO has a much shorter half-life, in the order of seconds [1]. Thus, NO has a role in coordinating plant growth and development. It has diverse functions such as disease resistance, abiotic stress, respiration, senescence, stomatal closure, xylem differentiation, root development, seed germination, hormone responses, cold response and flower timing control [2–12]. NO in excess is toxic to bacteria, fungi, microbial parasites, tumor cells, and viruses as well as to higher organisms [7]. In plants excess endogenous NO reduces growth and delays development [8] and, at high concentrations, can induce programmed cell death [4,13]. In cell cultures, the ratio of NO to hydrogen peroxide is crucial for inducing cell death [4,13,14]. The involvement of NO in promoting root growth has been observed by Gouveˆa et al. [15]. A stress to centrifuge isolated leaves and callus can induce NO generation and PCD ⇑ Corresponding authors. Fax: +86 10 68981191. E-mail addresses: [email protected] (S. Bai), [email protected] (Y. He). 1089-8603/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.niox.2011.12.001
and subsequent DNA fragmentation [16]. However, it is not clear how the intact plant responds to different levels of NO treatment. In this work, we chose to investigate the responses of Arabidopsis root to NO in NO hypersensitive cue1 mutant that displayed an elevated level of endogenous NO, and showed root-growth hypersensitivity to NO donor, sodium nitroprusside (SNP) [8]. We aim to elucidate the mechanism of how NO caused developmental arrest in Arabidopsis roots and seek to determine whether NO induces DNA damage in intact plant cells and does have a checkpoint response to DNA damage. Materials and methods Stocks Seeds of Arabidopsis thaliana L. (Columbia) were used throughout. The cue1 seeds were the gift from Dr. J. Chory (Salk Institute). The cue1 mutants have an elevated level of endogenous NO and are hypersensitive to NO [8]. The CYCB1;1-GUS reporter line was the gift of Peter Doerner (University of Edinburgh) and was crossed into the cue1 background and selected in our laboratory. Plant growth conditions Plants were grown in growth chambers under 22 °C and a photoperiod of 16 h. Light was supplied by cool white fluorescent
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
55
bulbs (100 lmol m2 s1). Prior to placement in the growth chamber, seeds were surface sterilized with 20% bleach, rinsed in water, and placed at 4 °C for 3–4 days in darkness. Seeds were then plated on half-strength Murashige and Skoog (MS) media (Sigma–Aldrich, St. Louis, MO) supplemented with 1% sucrose and solidified with 0.8% agar. The NO donor, sodium nitroprusside, dissolved in water, was added separately into the medium and mixed well before gelation. Unless indicated otherwise, seeds were plated on medium containing nitroprusside (or on control medium) and effects assayed 6 days later. Scanning electron microscopy (SEM) SEM observations were conducted as described [17]. Six-dayold seedlings of cue1 and wild type (WT) (Columbia background) were fixed in FAA (formaldehyde:acetic acid:ethanol:H2O, 10:5:50:35, by vol.) and dehydrated in a graded ethanol series. Materials were critical-point-dried using liquid CO2, mounted on aluminum stubs with double-sided tape, gold-coated with an Edwards S150B sputter coater, and then examined under a scanning electron microscope (Hitachi S-4800, at 30 kV). At least 20 root tips were scored for each sample in each experiment; data were pooled from three independent experiments. Cell viability assay Six-day-old seedlings were collected and stained with the fluorescent stain, 40 ,6-diamidino-2-phenylindole (DAPI) at 3 lM in staining buffer (100 mM Tris, pH 7.4, 150 mM NaCl, 1 mM CaCl2, 0.5 mM MgCl2, 0.1% Nonidet P-40, Invitrogen), and mounded on
Fig. 2. Root morphology of SEM images in response to nitroprusside for wild type and cue1. Plants treated as for Fig. 1. Scale bar = 100 lm.
Fig. 3. Histology in response to nitroprusside for the wild type. Plants were treated as for Fig. 1 and stained with propidium iodide. Root meristem zone from the quiescent centre (marked with star) to the boundary cells obviously elongated (marked with arrow) in cortex cells. Scale bar = 50 lm. Fig. 1. Root growth in response to sodium nitroprusside (SNP) for Columbia wild type and cue1. Seeds were plated on the indicated concentrations and assayed after 6 days. (A) Overview of seedlings. (B) Quantification.
microscope slides. Then the nuclei of root tip were observed under fluorescence microscopy, with excitation at 360–400 nm (Leica
56
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
Fig. 4. Numbers of mitotic cells in response to nitroprusside for wild type and cue1. (A–D) Differential interference contrast micrographs of cleared roots. (A) Low power image of wild-type root. Higher magnification images of (B–C) wild type and (D) cue1. Arrows call out cells judged to be in mitosis. B is an enlarged view of C. (E) Quantification, M phase cells/100 cells.
DMRE 2). A DAPI assay demonstrated that nuclei were intact regardless of the chromatin condensation and dead cells [18]. To detect the cell viability, the red-fluorescent propidium iodide dye (excitation/ emission maxima 535/617 nm, when bound to DNA) was used, which is permeant only to dead cells. PI was used at 5 lg/ml in staining buffer (1 PBS, 0.2% BSA, 0.1% sodium azide) [19]. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay The TUNEL assay was used for the whole mount in situ detection of DNA damage. For the assay, 6-day-old seedlings were fixed in FAA. After washing with 1 PBS twice, the fixed seedlings were then treated with 40 lg/ml proteinase K at 37 °C for 30 min. The TUNEL assay was then performed using the DeadEnd Colorimetric (and Fluorometric) Apoptosis Detection System (Promega) in accordance with the manufacturer’s instructions. Finally, the seedlings were mounted on slides and observed and photographed through a fluorescence microscope (excitation/emission maxima 475/540 nm) (Leica DMRE 2). At least 20 root tips were scored for each sample in each experiment; data were pooled from two independent experiments. Total RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR) The total RNA was isolated using the Trizol regent (Invitrogen) according to the procedures. The concentration of the total RNA
was measured by spectrophotometer NanoDrop Instrument (NanoDrop Technologies, Wilmington, DE, USA). The total RNA was reverse transcribed to cDNA using the RevertAid M-MULV Reverse Transcriptase (Fermentas). Real-time PCR was performed using SYBR green PCR master mix (Applied) and a Bio-Rad iQ5 real-time PCR detection system. All reaction were repeated at least three times. Statistical analysis of the results of real-time PCR was performed using iQ5 software. Three DNA damage response genes (PARP1, PARP2 and RAD51) were amplified. ACT2 served as control. The primer pair sequences are as follows: PARP1: 50 cacggttcacgtctcactaactg 30 , 50 gaggagctattcgcagacct tg 30 ; PARP2: 50 gcattgcgatatctcaccacttcc 30 , 50 cctctagctcaagact ccactctg 30 ; RAD51: 50 gtgagttccgctctggaaagactc 30 , 50 acctccttgatccatgg gaagttg 30 ; ACT2: 50 ctggatcggtggttccattc 30 , 50 cctggacctgcctcatcatac 30 . CYCLINB1;1-GUS staining Cells in G2/M phase were identified in plants containing the CYCB1;1-GUS reporter construct, described in Cólon-Carmona et al. [20]. Six-day-old seedlings were stained for the presence of b-glucuronidase as described previously [21]. At least 20 root tips were scored for each sample in each experiment; data were pooled from two independent experiments.
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
57
Fig. 5. TUNEL staining in response to nitroprusside for wild type and cue1. Plants treated as for Fig. 1 and double stained for DAPI (blue) and for TUNEL positive nuclei (green), and imaged with confocal microscopy. (A Left) DAPI staning of nuclei (blue). (A right) TUNEL positive nuclei control (green). (B upper panel) Wild-type seedlings treated as for Fig. 1. (B lower panel) The cue1 mutant seedlings treated as for Fig. 1. Representative images from three replicate experiments. Scale bars = 50 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).
Fig. 6. Expression levels of three DNA damage-responsive genes in response to nitroprusside for wild type and cue1. Expression was analyzed by real-time quantitative RTPCR (qRT-PCR) with RNA isolated from roots treated as for Fig. 1. ACT2 was used as an internal control. Significant differences are indicated by asterisks: ⁄P < 0.05; ⁄⁄P < 0.01.
Direct assay for mitotic cells Mitotic cells were assayed as described previously [21], with modifications. Six-day-old seedlings fixed with FAA for 2 h, followed by several rinses in distilled water. After rinsing, seedlings were mounted in an aqueous solution of glycerol and chloral hydrate, as described by Sabatini et al. [22]. The coverslips were sealed to the slide with clear fingernail polish and then gentle pressure was applied to the coverslip above each root tip. Samples were imaged with differential interference contrast (DIC) optics on a Leica DMRE 2 microscope. Using a 20 objective, each root tip was examined by focusing through each tip several times. Cells with clearly condensed chromosomes were classified as mitotic. At least 20 root tips were scored for each treatment in each experiment, and data were pooled from two independent experiments. Flow cytometry Sodium nitroprusside (in solidified growth medium) at the desired concentration was added to the upper cover of plates and the effects were analyzed after a 24-h treatment. Because NO is a gas, and is expected to reach equilibrium rapidly inside the plate, this method of treatment should be equivalent to the customary method of seedlings growing over agar medium containing
nitroprusside. Root tips of about 1 mm in length from approximately 600 seedlings were harvested. Nuclei were prepared from the harvested tissue as described previously [21,23]. Flow cytometry was performed on a flow cytometer (Backman Quanta SC) according to manufacturer recommendations. No fewer than 5000 nuclei were collected for each treatment. Data were pooled from two independent experiments. Results Root growth is arrested in response to NO To study the effects of NO on root growth, we germinated seeds in the presence of the NO donor, sodium nitroprusside (SNP), and examined the effects on the roots after 6 days. By this time, the wild type grows vigorously and has fully established its seedling condition. As a comparison to the wild type, we used the chlorophyll a/b binding protein under-expressed (cue1) mutant, which over produces NO because of an accumulation of arginine and citrulline [24]. On control medium, root length of the two genotypes was indistinguishable (Fig. 1). However, with increasing nitroprusside concentration, the mutant responded far more sensitively than did the wild type, with 2 lM nitroprusside in cue1 inhibiting growth more effectively than 2 lM in the wild type. At 50 lM nitroprusside, elongation of both genotypes was essentially zero.
58
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
NO and cell death To observe the effects of nitroprusside on root morphology, we used scanning electron microscopy (SEM). The NO donor caused root swelling and a decrease of the presumptive meristem, and these effects occurred at lower concentration in cue1 compared to the WT (Fig. 2). Seedlings exposed to even 50 lM nitroprusside were nevertheless able to produce root hairs. There was no evidence of collapsed or necrotic cells. To determine whether the extremely reduced root growth at high concentrations of nitroprusside was associated with cell death, we stained nitroprusside-treated roots with DAPI (data not shown) that demonstrated that nuclei were intact. Then PI staining was used (Fig. 3) and few if any dead cells were seen. PI stain cell walls are excluded from living cells. NO reduces the number of dividing cells and meristem cells To assess the effects of NO on cell division, we counted mitotic cells. In cleared roots, cells in metaphase and anaphase are distinct in differential interference microscopy, thanks to their condensed chromosomes (Fig. 4A–D). The numbers of mitotic cells per root decreased in response to nitroprusside (Fig. 4E). Doses above 2 lM were required to elicit an effect in the wild type whereas that dose caused almost a saturating effect in cue1. Also we find the decreased meristem zone [from the quiescent centre (marked with star) to elongated cells (marked with arrow) in cortex cells] in responses to increased SNP concentration (Fig. 3). This pattern of response for the two genotypes is nearly identical to that of root elongation (Fig. 1) and implies that NO reduces root elongation by interfering with cell division. NO induces DNA damage
Fig. 7. Nuclear DNA content in response to nitroprusside for wild type and cue1. Five day old seedlings were treated for 24 h prior to assay by flow cytometry. (A) Frequency distributions of DNA content of nuclei. (B) Relative abundance of nuclei with different DNA contents expressed as a percent of total.
Because NO treatment reduced the number of cells in the presumptive meristem, we tested whether DNA was damaged and the cell cycle arrested. To assay DNA damage, we used the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. In the wild type, TUNEL-positive nuclei appeared in seedlings treated with 20 and 50 lM nitroprusside (Fig. 5B upper panel). For
Fig. 8. CYCB1;1-GUS expression in response to nitroprusside for wild type and cue1. Plants treated as for Fig. 1. Scale bars = 50 lm.
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
the cue1 mutant, TUNEL-positive nuclei were abundant at 2 lM, an increase in sensitivity similar to that seen for root elongation. At higher concentrations the histology of the cue1 root was severely disrupted making comparisons difficult, and although positive nuclei were seen, they appeared to be less abundant than for the wild type (Fig. 5B lower panel). To confirm the induction of DNA damage, we assayed the steady state levels of three transcripts, PARP1, PARP2 and RAD51, that are regulated by DNA damage [25]. In the wild type, the levels of all three transcripts increased as a function of nitroprusside concentration, except declined precipitously on 50 lM (Fig. 6). In cue1, the responses of all three transcripts were generally consistent with that in wild type, except an increased sensitivity to NO, which may due to the elevated level of endogenous NO in cue1 mutant. NO cause cell cycle arrest To determine whether the decrease in dividing cell number in roots treated with NO was associated with cell cycle arrest, we used flow cytometry. Because we were unable to harvest sufficient numbers of nuclei from roots grown on 50 lM nitroprusside for 6 days, in this experiments seedlings were grown on control medium for 5 days and then transferred to experimental plates for 1 day prior to harvesting. In roots of A. thaliana, endoreduplication begins soon after cell division ends and profiles of DNA content of cells from even the first few millimeters of the tip commonly contain many 8C, 16C and even 32C levels (Fig. 7; also see Boudolf et al. [26]). Interestingly, compared to the wild type, cue1 roots contained greater percentages of nuclei with 4C, 8C, and 16C levels and fewer 2C nuclei. The reason for these differences is not known. In both genotypes, 50 lM nitroprusside substantially increased the percentage of 2C nuclei, consistent with G1 arrest; however, in the wild type, there was little change in levels of endoreduplication, whereas in cue1 the percentage of 8C nuclei increased. These responses, along with the responses to DNA damage, suggest that the response of cue1 to NO differs somewhat from that of the wild type. Finally, in both genotypes exposed to nitroprusside, the background (that is, the fluorescence level between peaks) was higher than for untreated seedlings, which is consistent with the presence of DNA damage. To assay for the presence of cells in G2/M phase by an alternative method, we used the CYCB1;1-GUS reporter [20] which fuses the N-terminal portion of CYCB1;1 containing a mitotic destruction box to the b-glucuronidase gene. GUS-positive cells therefore were primarily in G2/M at the time of staining. We found both cells in WT and cue1 root tips progressed into G2 at 0, 2, 20 lM SNP treatment. However, only the cue1 root tips grown on 20 lM SNP medium accumulated more G2/M cells while others did not (Fig. 8). With 50 lM SNP treatment, neither WT nor cue1 plants had G2/ M phase, implicating that they almost did not start any cell cycle process at high NO concentrations. These data, taken together with the mitotic index investigations, suggest that NO treatment of cue1 seedlings triggers a second arrest in G2/M besides G1 arrest. Discussion Root growth is highly responsive to environmental signals. In this paper, we demonstrated that NO restrains root growth and development by DNA damage induced cell cycle arrest. Taking into consideration the fact that NO induce DNA damage in intact plant root cells rather than cell death at lower concentrations, the antioxidant system may be applied at this status but inactive at high levels of NO concentration. Therefore, the lower concentrations of NO do not induce cell death but DNA damage in intact plant cells, and the cells with damaged DNA are not only viable but are capable of expansion and differentiation.
59
NO function in intact plant is different from culture cell that direct reaction with NO which make cell death. In intact plant, the immunosystem is stimulated and then defense the NO stress; and the DNA repair system restore NO induce DNA damage and make plant survive. The cue1 mutant has higher level of NO. Moreover, cue1 is impaired in chloroplast and mesophyll development [5,27]. NO is toxic to plants at high concentrations. The cue1 mutant has higher levels of endogenous NO than the wild type has, adscititious NO will easily elevate NO to the toxic levels in cue1 plant and cause NO induced effects. The malfunction of organelles may lead to the release of reactive oxygen species, the chemical reaction between NO and H2O2 produces either singlet oxygen or hydroxyl radicals [28]. Those may cause cue1 hypersensitive to NO. Besides, our research showed that G1 arrest existed in both cue1 and WT plant cells, but cue1 has a second arrest at G2/M phase which does not existed in WT. Plants need to pass on an intact copy of the genome to the next generation, combined with the requirement for a highly functional genome in meristematic tissues. It suggests that there would be a definite selective advantage to the genome-stabilizing effects of cell-cycle checkpoints. Plants evolve active surveillance mechanisms known as DNA damage checkpoint pathways to protect their genomic integrity [25,29]. Using WT and NO sensitive mutant cue1 with higher level of endogenous NO, we found that high levels of NO induced DNA damage in both WT and cue1 plants, and the damage degrees were different in response to different concentrations of SNP treatment. DNA damage checkpoint pathways should activate and cell-cycle should slowdown to allow time to repair damaged DNA. As a matter of fact, we found that NO caused root development arrest both in cue1 and WT, and the heavier the damage, the more the arrest. Thus we reached the conclusion that the cell cycle arrest in response to NO is caused by NO induced DNA damage. In the future, it will be challenging to gain more information on the NO functions in plant growth and development. Future experiments are necessary to further test the NO work model and functioning mechanisms. Conclusions Basal levels of NO affect plant growth and development. Here, we show that specifically levels of NO induce DNA damage in Arabidopsis root cells in a dose-dependent manner, since cells retain the capacity to differentiate root hairs. The future experiments show this NO induced DNA damage also cause cell cycle arrest at G1 phase, but in NO supersensitive mutant cue1 exist a second arrest at G2/M. Our results provide significative information for further test the NO work model and functioning mechanisms in plants. Acknowledgments We thank Dr. Tobias Baskin at Department of Biology, University of Massachusetts for the critical reading and commenting on this manuscript. This research work was supported by Natural Science Foundation of China (No. 30771094), Beijing Natural Science Foundation(Nos. 5082003, 5112006) and The National Key Scientific Program-Nanoscience and Nanotechnology (No. 2007CB948201 to He). References [1] Y.A. Henry, B. Ducastel, A. Guissani, Basic Chemistry of Nitric Oxide and Related Nitrogen Oxides, Biomedical Publishing Landes Company, 1997. pp. 15–46. [2] R. Desikan, M.K. Cheung, J. Bright, D. Henson, J.T. Hancock, S.J. Neill, ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells, J. Exp. Bot. 55 (2004) 205–212.
60
S. Bai et al. / Nitric Oxide 26 (2012) 54–60
[3] M.C. Romero-Puertas, M. Perazzolli, E.D. Zago, M. Delledonne, Nitric oxide signalling functions in plant–pathogen interactions, Cell. Microbiol. 6 (2004) 795–803. [4] S. Neill, NO way to die – nitric oxide, programmed cell death and xylogenesis, New Phytol. 165 (2005) 5–7. [5] N.M. Crawford, F.Q. Guo, New insights into nitric oxide metabolism and regulatory functions, Trends Plant Sci. 10 (2005) 195–200. [6] D.D. Wendehenne, J. Daniel, Nitric oxide: a new player in plant signalling and defense responses, Curr. Opin. Plant Biol. 7 (2004) 449–455. [7] C. Stohr, W.R. Ullrich, Generation and possible roles of NO in plant roots and their apoplastic space, J. Exp. Bot. 53 (2002) 2293–2303. [8] Y.K. He, R.H. Tang, Y. Hao, R.D. Stevens, C.W. Cook, S.M. Am, L.F. Jing, Z.G. Yang, L.G. Chen, F.Q. Guo, F. Fiorani, R.B. Jackson, N.M. Crawford, Z.M. Pei, Nitric oxide represses the Arabidopsis floral transition, Science 305 (2004) 1968–1971. [9] C. Cantrel, T. Vazquez, J. Puyaubert, N. Reze, M. Lesch, W.M. Kaiser, C. Dutilleul, I. Guillas, A. Zachowski, E. Baudouin, Nitric oxide participates in coldresponsive phosphosphingolipid formation and gene expression in Arabidopsis thaliana, New Phytol. 189 (2011) 415–427. [10] I. Guillas, A. Zachowski, E. Baudouin, A matter of fat: interaction between nitric oxide and sphingolipid signaling in plant cold response, Plant Signal. Behav. 6 (2011) 140–142. [11] J. Lozano-Juste, J. Leon, Nitric oxide regulates DELLA content and PIF expression to promote photomorphogenesis in Arabidopsis, Plant Physiol. 156 (2011) 1410–1423. [12] A. Zhang, J. Zhang, N. Ye, H. Zhang, M. Tan, M. Jiang, Nitric oxide mediates brassinosteroid-induced ABA biosynthesis involved in oxidative stress tolerance in maize leaves, Plant Cell Physiol. 52 (2011) 181–192. [13] A. Clarke, R. Desikan, R.D. Hurst, J.T. Hancock, S.J. Neill, NO way back: nitric oxide and programmed cell death in Arabidopsis thaliana suspension cultures, Plant J. 24 (2000) 667–677. [14] M. Delledonne, J. Zeier, A. Marocco, C. Lamb, Signal interactions between nitric oxide and reactive oxygen intermediates in the plant hypersensitive disease resistance response, Proc. Natl. Acad. Sci. U S A 98 (2001) 13454–13459. [15] C. Gouveˆa, J. Souza, C. Magalhaes, I. Martins, NO-releasing substances that induce growth elongation in maize root segments, Plant Growth Regul. 21 (1997) 183–187. [16] M.C. Pedroso, J.R. Magalhaes, D. Durzan, Nitric oxide induces cell death in Taxus cells, Plant Sci. 157 (2000) 173–180. [17] S.L. Bai, Y.B. Peng, J.X. Cui, H.T. Gu, L.Y. Xu, Y.Q. Li, Z.H. Xu, S.N. Bai, Developmental analyses reveal early arrests of the spore-bearing parts of
[18] [19]
[20]
[21]
[22]
[23] [24]
[25]
[26]
[27]
[28]
[29]
reproductive organs in unisexual flowers of cucumber (Cucumis sativus L.), Planta 220 (2004) 230–240. B.I. Tarnowsk, F.G. Spinale, J.H. Nicholson, DAPI as a useful stain for nuclear quantitation, Biotech. Histochem. 66 (1991) 297–302. M. Curtis, J. Hays, Tolerance of dividing cells to replication stress in UVBirradiated Arabidopsis roots: requirements for DNA translesion polymerases h and z, DNA Repair 6 (2007) 1341–1358. A. Colon-Carmona, R. You, T. Haimovitch-Gal, P. Doerner, Technical advance: spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein, Plant J. 20 (1999) 503–508. E. Hefner, N. Huefner, A.B. Britt, Tissue-specific regulation of cell-cycle responses to DNA damage in Arabidopsis seedlings, DNA Repair (Amst) 5 (2006) 102–110. S. Sabatini, D. Beis, H. Wolkenfelt, J. Murfett, T. Guilfoyle, J. Malamy, P. Benfey, O. Leyser, N. Bechtold, P. Weisbeek, B. Scheres, An auxin-dependent distal organizer of pattern and polarity in the Arabidopsis root, Cell 99 (1999) 463– 472. M.H. Fox, D.W. Galbraith, Application of Flow Cytometry and Sorting to Higher Plant Systems, Wiley-Liss Inc., 1990. pp. 633–650. H. Li, K. Culligan, R.A. Dixon, J. Chory, C4UE1: a mesophyll cell-specific positive regulator of light-controlled gene expression in Arabidopsis, Plant Cell 7 (1995) 1599–1610. C.X. Wang, Z.C. Liu, Arabidopsis ribonucleotide reductases are critical for cell cycle progression, DNA damage repair, and plant development, Plant Cell 18 (2006) 350–365. V. Boudolf, K. Vlieghe, G. Beemster, Z. Magyar, J.A.T. Acosta, S. Maes, V.D. Schueren, D.E. Inzé, L.D. Veylder, The plant-specific cyclin-dependent kinase CDKB1;1 and transcription factor E2Fa-DPa control the balance of mitotically dividing and endoreduplicating cells in Arabidopsis, Plant Cell 16 (2004) 2683– 2692. L. Voll, R.E. Hausler, R. Hecker, A. Weber, G. Weissenbock, G. Fiene, S. Waffenschmidt, U. Flugge, The phenotype of the arabidopsis cue1 mutant is not simply caused by a general restriction of the shikimate pathway, Plant J. 36 (2003) 301–317. A.A. Noronhadutra, M.M. Epperlein, N. Woolf, Reaction of nitric-oxide with hydrogen-peroxide to produce potentially cytotoxic singlet oxygen as a model for nitric oxide-mediated killing, FEBS Lett. 321 (1993) 59–62. S.B. Preuss, A.B. Britt, A DNA-damage-induced cell cycle checkpoint in Arabidopsis, Genetics 164 (2003) 323–334.