- Email: [email protected]
Nitrite oxide and inducible nitric oxide synthase were regulated by polysaccharides isolated from Glycyrrhiza uralensis Fisch
Journal of Ethnopharmacology 118 (2008) 59–64
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jethpharm
Nitrite oxide and inducible nitric oxide synthase were regulated by polysaccharides isolated from Glycyrrhiza uralensis Fisch Anwei Cheng a , Fachun Wan b , Zhengyu Jin a,∗ , Jiaqi Wang c , Xueming Xu a a
School of Food Science and Technology, Jiangnan University, Wuxi 214122, China Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Science, Jinan 250100, China c Institute of Animal Science, Chinese Academy of Agricultural Science, Beijing 100094, China b
a r t i c l e
i n f o
Article history: Received 12 September 2007 Received in revised form 9 January 2008 Accepted 6 March 2008 Available online 13 March 2008 Keywords: Glycyrrhiza uralensis Fisch Polysaccharide Macrophage Nitric oxide Inducible nitric oxide synthase
a b s t r a c t Water-soluble polysaccharide(Glycyrrhiza polysaccharide, GP) was isolated from Glycyrrhiza uralensis Fisch, with glycosidic units were composed of ␣ (1–4) linked D-glucana. We demonstrated that GP significantly induces nitric oxides (NO) production and inducible NO synthase (iNOS) transcription in peritoneal macrophages. Moreover, iNOS mRNA expression was strongly induced by GP. NO in the culture supernatant was measured by Griess reaction, the production of iNOS was determined by commercially available iNOS kit. GP (10–400 g/ml) alone increased significantly NO and iNOS production in macrophages. Macrophages simultaneously treated with GP plus lipopolysaccharide (LPS)/interferon-␥ (IFN-␥) increased NO and iNOS production as compared to that of GP treatments alone. The production of NO and iNOS in macrophages pretreated with LPS followed by GP was higher than that of treatment with GP and LPS simultaneously. Using RT-PCR reveals that GP may provide a second triggering signal for the expression of iNOS mRNA. Thus, the iNOS-mediated NO synthesis in response to GP may be one of the mechanisms whereby this herbal medicine elicits its therapeutic effects. © 2008 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Glycyrrhiza uralensis Fisch is a well-known Chinese herbal medicine used for the treatment of various diseases as well as a tonic medicine for thousands of years. This herb has long been valued as a demulcent, to relieve respiratory ailments, stomach burn including heart burn, gastritis, inflammatory disorders, skin diseases and liver problems. Glycyrrhiza contains a variety of substances, the water extract of glycyrrhiza has been widely used in medicine, pharmacology and food industry because of its physical and functional properties. The medicinal and pharmacological uses of liquorice have been described in many other studies (Takahara and Watanabe, 1994; Arase et al., 1997). Glycyrrhiza polysaccharide (GP), one of the main active ingredients of glycyrrhiza is attributed to many healing properties of the herb. Recently, it has been reported that GP had many functions such as immunity regulation (Yang and Yu, 1990), phagocytosis (Nose et al., 1998), anti-virus (Wang et al., 2000), anti-tumor (Wang et al., 2003), anticomplement (Takada et al., 1992), and it has low cellular toxicity (Wang et al., 2000). The aqueous extracts from glycyrrhiza and the structure of their oligo and polysaccharides have been described
∗ Corresponding author. Tel.: +86 510 85913299; fax: +86 510 85811950. E-mail address: [email protected] (Z. Jin). 0378-8741/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2008.03.002
(Shimizu et al., 1992; Takada et al., 1992; Wang et al., 2000). Studies indicate that GP at least includes three core structures (Sun and Zhang, 2006): firstly, a backbone chain composed of -1,3linked d-galactosyl residues, three-fifth of the galactose units in the backbone carry side chains composed of -1,3- and -1,6-linked d-galactosyl residues at position 6 (Takada et al., 1992); secondly, glycosidic units in the backbone carry side chains composed of mainly ␣-1,5-linked l-arabino--1,6- or 1,3-linked d-galactosyl residues at position 6 (Shimizu et al., 1992); thirdly, glycosidic units were composed of ␣ (1 → 4) linked d-glucan (Wang et al., 2000). Macrophage plays an important role in the host defense mechanism, when activated it inhibited the growth of a wide variety of tumor cells and microorganisms. Nitric oxide (NO) has important roles in the nervous, immune and vascular systems (Mayer and Hemmens, 1997). It reacts with a large number of biological molecules, contributing to its signalling effects (Muriel, 2000). The synthesis of NO by activated macrophages is an important cytotoxic/cytostatic mechanism of non-specific immunity (Knight, 2000). NO is a highly reactive, diffusible and unstable radical produced from the oxidation of l-arginine (MacMicking et al., 1997; Sosroseno et al., 2002; Kim et al., 2005), a reaction catalyzed by nitric oxide synthase (NOS) (Song et al., 2002). NOS exists in three major isoforms: endothelial NOS (eNOS), neural NOS (nNOS) and inducible NOS (iNOS). They differ in their tissue distribution and regulation (MacMicking et al., 1997). iNOS is calcium independent
60
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
and synthesized in response to specific signals generated in cells such as hepatocytes, fibroblasts, and macrophages (Nathan and Xie, 1994). Original evidence of tumor cell cytostasis and cytotoxity was found in macrophage-tumor cell co-cultures in which cytokine and/or lipopolysaccharides (LPS)-stimulated macrophages inhibited metabolic functioning of co-cultured tumor cells (Hibbs et al., 1987). The expression of NO has been linked with DNA damage, thus stimulating the expression of p53 and ultimately leading to apoptosis (Messmer et al., 1994). Thus, NO-mediated tumoricidal effects, similar to its anti-microbial effects, require antigen recognition but result in antigen-nonspecific killing. For the induction of iNOS gene expression in macrophages, IFN-␥ is required as a priming signal before it can subsequently be triggered by a second signal, such as, bacterial LPS or pro-inflammatory cytokines (Lorsbach et al., 1993; Jun et al., 1995). iNOS-derived NO is involved in anti-microbial and anti-tumor defenses in mammals (Mayer and Hemmens, 1997), many efforts are directed to the finding of natural compounds which may influence iNOS gene expression in macrophages. Therefore, in the present study we evaluate the mechanisms of GP which activated macrophages. GP-induced NO production and the gene expression of iNOS were investigated in mice macrophages. The effects of GP to modulate macrophage function suggest it may contribute to the therapeutic potential of aqueous extract derived from this herb.
2.4. Animals Male BALB/c mice between 6 and 8 weeks old (weight: 18.6 ± 1.0 g) were purchased from the Experimental Animal Center of Peking University, China. Mice were kept for 1 week in our animal facility at 21–25 ◦ C and 50% relative humidity with a 12 h/12 h light/dark cycle. Soluble starch was prepared by dissolving 5 g in 100 ml distilled water, and the solution was filtered and stored at 4 ◦ C before using. The diluents of the solution (5 g/100 ml) was injected intraperitoneally to mice with the dose of 1 ml/mouse and then bred for 3 d. 2.5. Isolation of peritoneal macrophages
2. Materials and methods
Peritoneal fluid from male BALB/c mice were harvested from peritoneal cavities by infusing 10 ml ice-cold sterile PBS (pH 7.2–7.4). After centrifugation at 1000 rpm/min for 5 min, the cell pellets were suspended in RPMI-1640 supplemented with 10% (v/v) bovine calf serum, penicillin 100 U/ml, streptomycin 100 U/ml and seeded in 96-well plate at a cell density of 5 × 105 cells/ml, and allowed to adhere for 3 h at 37 ◦ C in 5% CO2 humidified incubator. After 3 h incubation, non-adherent cells were removed by washing twice with PBS and freshly prepared medium was added (Moretˇao et al., 2003). The viability of the adherent cells was assessed by trypan blue exclusion test, and the proportion of macrophages was determined by cell morphology under a microscope.
2.1. Plant material
2.6. NO production
Roots of Glycyrrhiza uralensis Fisch were collected from Inner Mongolia Municipality, China, and identified by Dr. Houwei Wang, Shandong University of Traditional Chinese Medicine, China. A voucher specimen was deposited at the School of Food Science and Technology, Jiangnan University, China. 2.2. Preparation of glycyrrhiza extract Briefly, aqueous extracts of glycyrrhiza roots were obtained at 90–95 ◦ C and at a water/root mass ratio of 10:1 (v/m) for 3–4 h. After filtration to remove debris fragments, the filtrate was concentrated in a rotary evaporator. Proteins were removed by adding 15% (m/m) of trichloroactic acid, the filtrate was neutralized by 1 mol/l NaOH, and then centrifuged to remove the precipitates. Subsequently, three volumes of ethanol were added to the supernates, and the precipitates were collected by centrifugation and washed with acetone for three times. The precipitates were dissolved in distilled water and then applied to a DEAE-cellulose column (2.5 cm × 60 cm). The bound materials were eluted with a linear gradient of NaCl (0–2 mol/l). Total polysaccharide obtained from the elution was fractionated by chromatography on a Sephacryl S400 HR column (3.5 cm × 100 cm) (Pharmacia, Sweden) and eluted with distilled water. The main fraction of GP was then dialyzed and lyophilized. The dried extract was dissolved in phosphate buffer solution (PBS, pH 7.2) and filtered through 0.22 m filter before use. 2.3. Materials Lipopolysaccharide (LPS), polymyxin B (PB) and interferon-␥ (IFN-␥) were purchased from Sigma (USA). RPMI-1640 medium was from Gibco (USA). Bovine calf serum was from Hyclone (USA). Commercially available iNOS kit was from Jiancheng bioengineering institute of Nanjing (China); RNAiso reagent and RNA PCR kit (AMV) ver.3.0 were from TaKaRa Biotechnology Co., Ltd. (Dalian, China).
Adherent macrophages (5 × 105 cells/well) were placed in a 96well plate and incubated in complete RPMI medium alone or medium containing various concentrations of GP or/and LPS/IFN-␥ for 48 h. Nitrite in the culture medium was determined by Griess reaction (Green et al., 1982). At the end of the culture period, a total 100 l/well of cell culture medium was incubated with equal volume of Griess solution (1% sulfanilamide, 0.1% napthyl ethyl diamine dihydrochloride in 5% phosphoric acid) at room temperature for 10 min. The absorbance was read at 492 nm, and the concentrations of NO2 − were determined from a least squares linear regression analysis of a sodium nitrite standard curve. 2.7. iNOS production RPMI-1640 of macrophages (1.0 × 106 cells/ml) were placed in a 6-well flat-bottomed plate and treated with different concentrations (0–400 g/ml) of GP, PBS and LPS were the blank and positive control groups, respectively. Macrophages were harvested as described above with 3000 l/well RPMI-1640 of different concentrations of GP up to 48 h, then the macrophages were collected and production of iNOS was measured using commercially available iNOS kit. 2.8. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was extracted using a RNA-purification kit. RT-PCR was performed using a RNA PCR kit (TaKaRa RNA PCR kit (AMV) ver.3.0). Complementary DNA (cDNA) was prepared from RNA (1 g) in 10 l reaction mixture which containing 1 l dNTP mixture (10 mM), 0.25 l RNase inhibitor, 0.5 l avian myeloblastosis virus (AMV) reverse transcriptase, and 0.5 l oligo-dT-adaptor primer at 55 ◦ C for 30 min. Subsequently, the mixture was heated at 99 ◦ C for 5 min, and refrigerated at 5 ◦ C for 5 min. The cDNA was amplified by PCR with a DNA thermal cycler. After 4 min pre-denaturation at 95 ◦ C, the PCR conditions were as follows: denaturation at 95 ◦ C for 50 s, annealing at 60 ◦ C for 30 s, and extension at 72 ◦ C for 90 s for 35 amplification cycles. Positive
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
and negative strand PCR primers were CCTTGTTCAGCTACGCCTTC and CTGAGGGCTCTGTTGAGGTC for the amplification of iNOS, CCTGAGGCTCTTTTCCAGCC and TAGAGGTCTTTACGGATGT CAACGT for -actin. A sample (7 l) of each amplified product was subjected to electrophoresis in a 1.5% agarose gel, stained with goldviewna IITM , and visualized under UV illumination. 2.9. Determination of endotoxin contamination Briefly, 1 ml of Affi-Prep Polymyxin Matrix was packed in a Bio-spin column, centrifuged at 200 rpm/mim for 2 min, and then 0.5 ml of GP (100 g/ml), LPS (2 g/ml) or GP (100 g/ml) plus LPS (2 g/ml) mixture were added. After incubating overnight at 4 ◦ C, the effluent was recovered from the column by centrifugation at the same condition (Im et al., 2006). 2.10. Fourier transformed infrared (FTIR) analysis The fractionated sample was analyzed by an absorbance IR spectroscopy by the KBr disc method using a Nexus-870 ThermoNickolet FTIR spectrometer from 400 to 4000 cm−1 . 2.11. Statistical analysis Biological assays were performed in triplicate. Results were expressed as mean ± standard deviations (S.D.). Data were analyzed using analysis of variance (SAS 9.0) and t-test to determine the statistical significance (p < 0.05).
61
Table 1 FTIR spectra of glycyrrhiza polysaccharide-derived fractions (4000–400 cm−1 ) were obtained from solid samples by KBr disc method Vibration mode
Characteristic peak (cm−1 )
Peaks of GP (cm−1 )
O–H stretching vibration C–H stretching vibration C–H bending vibration C–O stretching vibration ␣-Glucopyranose ␣-Isomeric pyranose symmetrical stretch
3600–3200 3000–2800 1400–1200 1200–1000 855–833 766 ± 10
3384 2886 1359, 1280, 1241 1018, 1060, 1148 842 760
cosidic structures are related to O–H stretching (3200–3600 cm−1 ), C–H stretching (2800–3000 cm−1 ), C–H bending vibration (1200–1400 cm−1 ) and C–O stretching (1000–1200 cm−1 ). Due to the presence of bands in the 3384, 2886, 1280, 1148, 1060 and 1018 spectra, the fraction was identified to contain a pyranose ring. The IR spectra (842, 760) also suggested that ␣-glycosidic bond was present in the isolated fraction. 3.2. Effects of GP on NO and iNOS production To investigate the effect of GP on NO and iNOS production, we measured the accumulation of nitrite, the stable end product of NO, in the culture media using Griess reagent. And the production of iNOS was measured using commercially available iNOS kit. The results showed that GP alone increased NO and iNOS production in macrophages by GP (10, 50,100, 200, 400 g/ml) in dose-dependent manner (Fig. 2), with NO levels to 1.66, 2.61, 4.2, 5.12, 5.15-fold and
3. Results 3.1. Isolation of water-soluble polysaccharide from glycyrrhiza The crude polysaccharides were purified by gel permeation using Sephacryl S-400 and Fig. 1 represents the gel permeation profile of ion exchange-purified polysaccharides. A single peak was found according to the carbohydrate concentration, fractions 11–31 were pooled as purified glycyrrhiza polysaccharide. Comparative analysis of pullulan standards measured by HPLC resulted in a calibration curve that was linear from molecular weight (Log Mol Wt = 1.44e + 001 − 5.53e − 001 T1 , where T is retention time), with a correlation coefficient is 0.982196. Using this calibration, the molecular weight of purified GP was approximately 11 kDa. The yields of crude and purified polysaccharide were approximately 4.25 and 0.87%, respectively. IR spectrum of the isolated polysaccharides is presented in Table 1. The attributes of the main absorption characteristics of gly-
Fig. 1. Gel permeation of extracted polysaccharide by chromatography on a column of Sephacryl S-400 HR (column dimension: 3.5 cm × 100 cm, flow rate = 0.5 ml/min, fraction size = 5 ml). Carbohydrate was estimated from each fraction by phenol sulfuric acid method.
Fig. 2. Effects of GP on NO (A) and iNOS (B) in macrophages or LPS-treated macrophages. Unfilled bars represent NO/iNOS inducing activity of macrophages were cultured with GP alone for 48 h. Filled bars represent NO/iNOS inducing activity of macrophages were pre-cultured with LPS (2 g/ml) for 6 h followed by GP (0–400 g/ml) for another 48 h. The data represent the means of triplicates, *p < 0.05 compared with control.
62
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
Fig. 3. Effects of GP on NO (A) and iNOS (B) and simultaneously with LPS (2 g/ml) in macrophages. The data represent the means of triplicates, *p < 0.05 compared with control.
Fig. 4. Production of NO (A) and iNOS (B) in macrophages treated with GP plus IFN-␥ for 48 h. The data represent the means of triplicates, *p < 0.05 compared with control.
iNOS to 1.76, 3.42, 3.74, 5.41, 5.43-fold respectively as compared to the control group. At the same time, the amount of NO and iNOS was produced in response to 50 g/ml of GP was similar to that induced by LPS (2 g/ml). Less than 10 g/ml of GP was showed slightly effective and, in some cases, ineffective (data not shown) to NO and iNOS production. The differences of NO and iNOS production between GP (>50 g/ml) treatments and the controls were statistically significant (p < 0.05). Pre-treatment with LPS significantly increased NO and iNOS production as compared to that of GP alone.
exposed to GP (100 g/ml) simultaneously. Similar trends were obtained for NO and iNOS production in macrophages treated with 10–400 g/ml doses of GP when exposed to IFN-␥ (100 U/ml) simultaneously.
3.3. Synergistic effects of GP and LPS on NO and iNOS production Macrophages were used to study the synergistic effects of GP plus LPS on NO and iNOS production. As shown in Fig. 3, dose-dependent enhancement of NO and iNOS production was observed in macrophages when treated with 10–400 g/ml GP. Co-incubation of macrophages with GP plus LPS synergistically increased NO and iNOS production, the synergistic effect was maximal in the treatment of 400 g/ml GP. GP, at concentrations <50 g/ml, had no effects on NO and iNOS production (Fig. 3). Increases of NO and iNOS production exposed to combined GP with LPS were lower than those of pretreated with LPS when concentrations of GP was equal (Figs. 2 and 3).
3.5. Effects of GP on the induction of iNOS gene expression mRNA-specific RT-PCR analysis was performed to determine whether the increase in NO synthesis induced by GP was due to the enhancement of iNOS mRNA expression. Macrophages were directly exposed to GP, the expression level of iNOS gene was monitored by RT-PCR analysis. As shown in Fig. 5, unstimulated cells of GP expressed no detectable iNOS mRNA, whereas exposured to GP clearly induced its accumulation. Furthermore, the transcription of iNOS mRNA was dose-dependently activated. The results reflected that the increased production of NO in macrophage was mediated by the expression of the iNOS gene. Control -actin was constitutively expressed and was not affected by the treatment of GP. These results indicate that GP increases the gene expression of iNOS, which is involved in anti-tumor activity. 3.6. Effects of polymyxin B on NO and iNOS production To ensure that the effects of GP were not due to endotoxin contamination, GP was treated with polymyxin B, an inhibitor of
3.4. Synergistic effects of GP and IFN- on NO and iNOS production It has been known that IFN-␥ stimulates the production of NO by macrophages isolated from peritoneal lavage of mouse (Kim and Son, 1996). The concentration-dependent induction of NO and iNOS by IFN-␥ in macrophages was shown in Fig. 4, NO and iNOS production was higher in all treatments of GP plus IFN-␥ than that of the control group. The results showed that a dose-dependent enhancement of NO and iNOS was observed in macrophages treated with 1–100 U/ml doses of IFN-␥ when
Fig. 5. Activation of iNOS mRNA expression by GP in macrophages. Total RNA was extracted and analyzed for the magnitude of iNOS mRNA expression using RT-PCR. Results are presented as amplified products electrophoresed on goldviewna II TMstained agarose gels.
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
Fig. 6. Effects of polymyxin B-treatment. LPS (2 g/ml), GP (100 g/ml), or LPS (2 g/ml) and GP (100 g/ml) mixture was added to polymyxin B-affinity column, incubated overnight at 4 ◦ C, eluted from the column by centrifugation, and then added to the cultures of macrophages (final, 1:80 dilution) for 48 h.
LPS activity, and the immunomodulatory activity was examined in peritoneal macrophages. As shown in Fig. 6, passage of LPS solution (2 g/ml) through polymyxin B-affinity column reduced the production of NO and iNOS almost completely, indicating that polymyxin B-affinity column absorbed LPS almost completely. Passage of GP solution (100 g/ml) through polymyxin B-affinity column, however, did not reduce the production of NO and iNOS in a significant level. To exclude possible interference of the complexforming activity of polymyxin B by unknown substances contained in the GP solution, GP was mixed with LPS, passed through polymyxin B-affinity column, then the production of NO and iNOS in macrophages was examined. As shown in Fig. 6, polymyxin Baffinity column could remove LPS from the mixture of GP and LPS. These results indicate that the immunomodulatory activity of GP was not due to LPS contamination. 4. Discussion and conclusions We demonstrate that treatment with GP, polysaccharide isolated from Glycyrrhiza uralensis Fisch, significantly induces NO production and iNOS transcription in macrophage. The major finding of this study is that GP significantly induced NO production and iNOS expression. Since macrophage activation play a significant role in the host defense mechanism and NO is related to cytolytic function of macrophages against a variety of tumors (Hibbs et al., 1987; Palmer et al., 1988), the increased synthesis of NO by GP might interfere with the growth of tumors. The role of NO in tumoricidal effect was evidenced by the experiments using the inhibitors of NO production. The processing of tumor antigen and the activa-
63
tion of T cells by macrophages also possibly helped the retardation of tumor growth. Polysaccharides isolated from natural sources can profoundly affect the immune system and therefore have the potential as immunomodulators with wide clinical applications. For example, polysaccharides extracted from Glycyrrhiza uralensis Fisch can enhance the expression of bax protein and decreases that of bac-2, p53 protein of sarcoma 180 cells (Shi et al., 2005), and exhibits anti-complementary and mitogenic activities (Hiroako et al., 1996). Yang and Yu (1990) reported glycyrrhiza polysaccharide could activate peritoneal macrophages and increased IL-1 production. Crude polysaccharide fraction obtained from the shoot and hairy root of Glycyrrhiza sp. induced nitric oxide production by mice peritoneal macrophages in vitro under aseptic conditions (Nose et al., 1998). The present study utilizing the aqueous extract of glycyrrhiza in macrophages is the first study on the signal pathway for NO synthesis. The major finding of this study is that the GP treatment alone induced NO production and iNOS expression significantly and peaked at the dose of 400 g/ml. Because of the pivotal role of NO and TNF-␥ in the anti-microbial and tumoricidal activity, many studies have been focused on developing therapeutic agents that regulate NO and TNF-␥ production (Poderoso et al., 1999). The results of present study suggested that simultaneously treatment with GP plus LPS/TNF-␥ have increased NO and iNOS production in mice macrophages treated with GP alone. However, the production of NO and iNOS in macrophages treated with LPS prior to adding to GP was higher than that of treatments with GP and LPS simultaneously. Although macrophage activation by GP is quite similar with that by LPS, differences are also observed between GP and LPS. The treatment with LPS/TNF-␥ followed by GP may affect NO and iNOS production. While it abolished LPS/TNF-␥ stimulation of macrophages, GP still may increase NO and iNOS production. NO production specific to IFN-␥ by macrophages, which determined by nitrite accumulation in culture media, have increased linearly at the concentrations of 0–100 U/ml for 48 h. IFN-␥-dependent formation of NO in macrophages results from the induction of iNOS expression (Gregory et al., 1993). This cytokine specificity was consistent with the previous report that peritoneal macrophages released reactive nitrogen intermediates in response to IFN-␥ only (Ding et al., 1988). It was testified that maximal production of NO and iNOS by macrophages was found in the treatment of 400 g/ml GP. It has also been demonstrated that macrophages stimulated by GP produced NO through the expression of iNOS gene, and it is though that the reactive nitrogen intermediates so induced play a significant role in tumoricidal activity (Lorsbach et al., 1993). Furthermore, the induction of NO production and gene expression by activated macrophages can lead to cytotoxic effects on malignant cells (Stuehr and Nathan, 1989; Duerksen-Hughes et al., 1992). In our experimental conditions and detection limits, the GP fraction was significantly active without the concomitant addition of LPS or IFN-␥ in the culture medium. This indicated that the addition of GP to LPS or IFN-␥-activated macrophages stimulated nitrite production via an immunomodulatory action rather than through a non-specific response due to cellular death. Because endotoxin is a strong activator of macrophages and is contaminated in many plant materials, possible contamination of endotoxin is always a matter of concern for the high molecular weight components isolated from plants. The macrophage-activating activity of GP, however, was not due to endotoxin contamination as shown by polymyxin B-treatment experiments. These results showed the possible roles of macrophages in the anti-tumor activity of polysaccharides. The anti-tumor activity of polysaccharides was explained in two points, the first one was the direct tumoricidal action of macrophages. Since NO is related to cytolytic function of macrophages against
64
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
a variety of tumors (Hibbs et al., 1987; Palmer et al., 1988), the increased synthesis of NO might interfere with the growth of tumors. This was further evidenced by the results of experiments using the inhibitors of NO production (Yim et al., 1993; Farias-Eisner et al., 1994; Xie et al., 1995). The other one was related to the indirect actions of macrophages. For example, the augmented processing of tumor antigen and the lymphokine mediated helper T cells activation by macrophages also possibly helped the retardation of tumor growth. In summary, these experiments demonstrate that GP stimulates macrophages to produce NO through the induction of iNOS gene expression. Due to the critical role that NO release plays in cytolytic function of macrophages, the activation effects of GP on iNOS suggest that this compound may represent useful immunopotentiating agents. References Arase, Y., Ikeda, K., Murashima, N., Chayama, K., Tsubota, A., Koida, I., Suzuki, Y., Saitoh, S., Kobayashi, M., Kumada, H., 1997. The long-term efficacy of glycyrrhizin in chronic hepatitis C patients. Cancer 79, 1494–1500. Ding, A.H., Nathan, C.F., Stuehr, D.J., 1988. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidences for independent production. Journal of Immunology 141, 2407–2412. Duerksen-Hughes, P.J., Day, D., Laster, S.M., Zachariades, N.A., Aquino, L., Gooding, L.R., 1992. Both tumor necrosis factor and nitric oxide participate in lysis of simian virus 40-transformed cells by activated macrophages. Journal of Immunology 149, 2114–2122. Farias-Eisner, R., Sherman, M.P., Aeberhard, E., Chaudhuri, G., 1994. Nitric oxide is an important mediator for tumoricidal activity in vivo. Proceedings of the National Academy of Sciences (USA) 91, 9407–9411. Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum, S.R., 1982. Analysis of nitrate, nitrite, and [15 N] nitrate in biological fluids. Analytical Biochemistry 126, 131–138. Gregory, S.H., Wing, E.J., Hoffman, R.A., Simmons, R.L., 1993. Reactive nitrogen intermediates suppress the primary immunologic response to Listeria. Journal of Immunology 150, 2901–2909. Hibbs Jr., J.B., Taintor, R.R., Vavrin, Z., 1987. Macrophage cytotoxicity: role for l-arginine deiminase and imino nitrogen oxidation to nitrite. Science 235, 473–479. Hiroako, K., Norito, T., Zhao, J.F., Hideki, K., Haruki, Y., 1996. Pectic polysaccharides from roots of Glycyrrhiza uralensis: possible contribution of neutral oligosaccharides in the galacturonase-resistant region to anti-complementary and mitogenic activities. Plant Medicine 62, 14–19. Im, S.A., Kim, K., Lee, C.K., 2006. Immunomodulatory activity of polysaccharides isolated from Salicornia herbacea. International Immunopharmacology 6, 1451–1458. Jun, C.D., Choi, B.M., Kim, H.M., Chung, H.T., 1995. Involvement of protein kinase C during taxol-induced activation of murine peritoneal macrophages. Journal of Immunology 154, 6541–6547. Kim, Y.M., Son, K., 1996. A nitric oxide production bioassay for interferon-␥. Journal of Immunology Methods 198, 203–209. Kim, Y.H., Woo, K.J., Lim, J.H., Kim, S., Lee, T.J., Jung, E.M., Lee, J.M., Park, J.W., Kwon, T.K., 2005. ␥-Hydroxyquinoline inhibits iNOS expression and nitric oxide production by down-regulating LPS-induced activity of NF-B and C/EB in Raw 264.7 cells. Biochemical and Biophysical Research Communications 329, 591–597. Knight, J.A., 2000. Free radicals, antioxidants, and the immune system. Annual Clinic Laboratory Science 30, 145–158. Lorsbach, R.B., Murphy, W.J., Lowenstein, C.J., Snyder, S.H., Russell, S.W., 1993. Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor
cell killing. Molecular basis for the synergy between interferon-gamma and lipopolysaccharide. Journal of Biological Chemistry 268, 1908–1913. MacMicking, J., Xie, Q.W., Nathan, C., 1997. Nitric oxide and macrophage function. Annual Review of Immunology 15, 323–350. Moretˇao, M.P., Buchi, D.F., Gorin, P.A.J., Iacomini, M., Oliveira, M.B.M, 2003. Effect of an acidic heteropolysaccharide (ARAGAL) from the gum of Anadenanthera colubrina (Angico branco) on peritoneal macrophage functions. Immunology Letters 89, 175–185. Mayer, B., Hemmens, B., 1997. Biosynthesis and action of nitric oxide in mammalian cells. Trends in Biochemical Science 22, 477–481. Messmer, U.K., Ankarcrona, M., Nicotera, P., Brune, B., 1994. p53 expression in nitric oxide-induced apoptosis. FEBS Letters 355, 23–29. Muriel, P., 2000. Regulation of nitric oxide synthesis in the liver. Journal of Applied Toxicology 20, 189–195. Nathan, C., Xie, Q.W., 1994. Nitric oxide synthases: roles, tolls and controls. Cell 78, 915–918. Nose, M., Terawaki, K., Oguri, K., Ogihara, Y., Yoshimatsu, K., Shimomura, K., 1998. Activation of macrophages by crude polysaccharide fractions obtained from shoots of Glycyrrhiza glabra and hairy roots of Glycyrrhiza uralensis in vitro. Chemical Pharmacology Bulletin 21, 1110–1111. Palmer, R.M., Ashton, D.S., Moncada, S., 1988. Vascular endothelial cells synthesize nitric oxide from l-arginine. Nature 333, 664–670. Poderoso, J.J., Carreras, M.C., Schopfer, F., Lisdero, C.L., Riobo, N.A., Giulivi, C., Boveris, A.D., Boveris, A., Cadenas, E., 1999. The reaction of nitric oxide with ubiquinol: kinetic properties and biological significance. Free Radical Biology and Medicine 26, 925–935. Shi, Y.R., Wei, S.Y., Yang, Y., Niu, R.F., Song, F., 2005. Detecting induced apoptosis effect of the glycyrrhizia polysaccharide with flow cytometer (FCM). Modern Apparatus 4, 30–31. Shimizu, N., Tomoda, M., Takada, K., Gonda, R., 1992. The core structure and immunological activities of glycyrrhizan UA, the main polysaccharide from the root of Glycyrrhiza uralensis. Chemical Pharmacology Bulletin (Tokyo) 40, 2125–2128. Song, Y.S., Park, E.H., Hur, G.M., Ryu, Y.S., Kim, Y.M., Jin, C., 2002. Ethanol extract of propolis inhibits nitric oxide synthase gene expression and enzyme activity. Journal of Ethnopharmacology 80, 155–171. Sosroseno, W., Barid, I., Herminajeng, E., Susilowati, H., 2002. Nitric oxide production by a murine macrophage cell line (RAW264.7) stimulated with lipopolysaccharide from Actinobacillus action mycetemcomitans. Oral Microbiology Immunology 17, 72–78. Stuehr, D.J., Nathan, C.F., 1989. Nitric oxide: a macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. Journal of Experimental Medicine 169, 1543–1555. Sun, R.G., Zhang, J., 2006. A study of helical structure of glycyrrhiza polysaccharides by atomic force microscope. Acta Chimica Sinica 64, 2467–2472. Takada, K., Tomoda, M., Shimizu, N., 1992. Core structure of glycyrrhiza GA, the main polysaccharide from the stolon of Glycyrrhiza glabra var. glandulifera; anti-complementary and alkaline phosphatase-inducing activities of the polysaccharide and its degradation products. Chemical Pharmacology Bulletin 40, 2487–2490. Takahara, T., Watanabe, A., 1994. Effects of glycyrrhizin on hepatitis B surface antigen: a biochemical and morphological study. Journal of Hepatology 21, 601–609. Wang, C., Xi, G.R., Shi, Y.R., Zhang, L.H., 2003. Study on the anti-tumor effect in vivo of glycyrrhiza polysaccharide and its mechanism. Chinese Journal of Clinical Oncology 8, 85–87. Wang, Y.W., Zhang, H.B., Lv, J., Shi, Y.R., He, M., Wang, S.S., Ding, Y.F., 2000. Inhibition of glycyrrhiza polysaccharides (GPS) on virus. Acta Scientiarum Naturalium Universitatis Nankaiensis 33, 46–48. Xie, K., Huang, S., Dong, Z., Juang, S.H., Gutman, M., Xie, Q.W., 1995. Transfection with the inducible nitric oxide synthase gene suppresses tumorigenicity and abrogates metastasis by K-1735 murine melanoma cells. Journal of Experimental Medicine 181, 1333–1343. Yang, G., Yu, Y., 1990. Immunopotentiating effect of traditional Chinese drugs–ginsenoside and glycyrrhiza polysaccharide. Proceedings of the Chinese Academy of Medical Sciences, Peking Union Medical College 5, 188–193. Yim, C.Y., Bastian, N.R., Smith, J.C., Hibbs Jr., J.B., Samlowski, W.E., 1993. Macrophage nitric oxide synthesis delays progression of ultraviolet light-induced murine skin cancers. Cancer Research 53, 5507–5518.
Contents lists available at ScienceDirect
Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jethpharm
Nitrite oxide and inducible nitric oxide synthase were regulated by polysaccharides isolated from Glycyrrhiza uralensis Fisch Anwei Cheng a , Fachun Wan b , Zhengyu Jin a,∗ , Jiaqi Wang c , Xueming Xu a a
School of Food Science and Technology, Jiangnan University, Wuxi 214122, China Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Science, Jinan 250100, China c Institute of Animal Science, Chinese Academy of Agricultural Science, Beijing 100094, China b
a r t i c l e
i n f o
Article history: Received 12 September 2007 Received in revised form 9 January 2008 Accepted 6 March 2008 Available online 13 March 2008 Keywords: Glycyrrhiza uralensis Fisch Polysaccharide Macrophage Nitric oxide Inducible nitric oxide synthase
a b s t r a c t Water-soluble polysaccharide(Glycyrrhiza polysaccharide, GP) was isolated from Glycyrrhiza uralensis Fisch, with glycosidic units were composed of ␣ (1–4) linked D-glucana. We demonstrated that GP significantly induces nitric oxides (NO) production and inducible NO synthase (iNOS) transcription in peritoneal macrophages. Moreover, iNOS mRNA expression was strongly induced by GP. NO in the culture supernatant was measured by Griess reaction, the production of iNOS was determined by commercially available iNOS kit. GP (10–400 g/ml) alone increased significantly NO and iNOS production in macrophages. Macrophages simultaneously treated with GP plus lipopolysaccharide (LPS)/interferon-␥ (IFN-␥) increased NO and iNOS production as compared to that of GP treatments alone. The production of NO and iNOS in macrophages pretreated with LPS followed by GP was higher than that of treatment with GP and LPS simultaneously. Using RT-PCR reveals that GP may provide a second triggering signal for the expression of iNOS mRNA. Thus, the iNOS-mediated NO synthesis in response to GP may be one of the mechanisms whereby this herbal medicine elicits its therapeutic effects. © 2008 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Glycyrrhiza uralensis Fisch is a well-known Chinese herbal medicine used for the treatment of various diseases as well as a tonic medicine for thousands of years. This herb has long been valued as a demulcent, to relieve respiratory ailments, stomach burn including heart burn, gastritis, inflammatory disorders, skin diseases and liver problems. Glycyrrhiza contains a variety of substances, the water extract of glycyrrhiza has been widely used in medicine, pharmacology and food industry because of its physical and functional properties. The medicinal and pharmacological uses of liquorice have been described in many other studies (Takahara and Watanabe, 1994; Arase et al., 1997). Glycyrrhiza polysaccharide (GP), one of the main active ingredients of glycyrrhiza is attributed to many healing properties of the herb. Recently, it has been reported that GP had many functions such as immunity regulation (Yang and Yu, 1990), phagocytosis (Nose et al., 1998), anti-virus (Wang et al., 2000), anti-tumor (Wang et al., 2003), anticomplement (Takada et al., 1992), and it has low cellular toxicity (Wang et al., 2000). The aqueous extracts from glycyrrhiza and the structure of their oligo and polysaccharides have been described
∗ Corresponding author. Tel.: +86 510 85913299; fax: +86 510 85811950. E-mail address: [email protected] (Z. Jin). 0378-8741/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.jep.2008.03.002
(Shimizu et al., 1992; Takada et al., 1992; Wang et al., 2000). Studies indicate that GP at least includes three core structures (Sun and Zhang, 2006): firstly, a backbone chain composed of -1,3linked d-galactosyl residues, three-fifth of the galactose units in the backbone carry side chains composed of -1,3- and -1,6-linked d-galactosyl residues at position 6 (Takada et al., 1992); secondly, glycosidic units in the backbone carry side chains composed of mainly ␣-1,5-linked l-arabino--1,6- or 1,3-linked d-galactosyl residues at position 6 (Shimizu et al., 1992); thirdly, glycosidic units were composed of ␣ (1 → 4) linked d-glucan (Wang et al., 2000). Macrophage plays an important role in the host defense mechanism, when activated it inhibited the growth of a wide variety of tumor cells and microorganisms. Nitric oxide (NO) has important roles in the nervous, immune and vascular systems (Mayer and Hemmens, 1997). It reacts with a large number of biological molecules, contributing to its signalling effects (Muriel, 2000). The synthesis of NO by activated macrophages is an important cytotoxic/cytostatic mechanism of non-specific immunity (Knight, 2000). NO is a highly reactive, diffusible and unstable radical produced from the oxidation of l-arginine (MacMicking et al., 1997; Sosroseno et al., 2002; Kim et al., 2005), a reaction catalyzed by nitric oxide synthase (NOS) (Song et al., 2002). NOS exists in three major isoforms: endothelial NOS (eNOS), neural NOS (nNOS) and inducible NOS (iNOS). They differ in their tissue distribution and regulation (MacMicking et al., 1997). iNOS is calcium independent
60
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
and synthesized in response to specific signals generated in cells such as hepatocytes, fibroblasts, and macrophages (Nathan and Xie, 1994). Original evidence of tumor cell cytostasis and cytotoxity was found in macrophage-tumor cell co-cultures in which cytokine and/or lipopolysaccharides (LPS)-stimulated macrophages inhibited metabolic functioning of co-cultured tumor cells (Hibbs et al., 1987). The expression of NO has been linked with DNA damage, thus stimulating the expression of p53 and ultimately leading to apoptosis (Messmer et al., 1994). Thus, NO-mediated tumoricidal effects, similar to its anti-microbial effects, require antigen recognition but result in antigen-nonspecific killing. For the induction of iNOS gene expression in macrophages, IFN-␥ is required as a priming signal before it can subsequently be triggered by a second signal, such as, bacterial LPS or pro-inflammatory cytokines (Lorsbach et al., 1993; Jun et al., 1995). iNOS-derived NO is involved in anti-microbial and anti-tumor defenses in mammals (Mayer and Hemmens, 1997), many efforts are directed to the finding of natural compounds which may influence iNOS gene expression in macrophages. Therefore, in the present study we evaluate the mechanisms of GP which activated macrophages. GP-induced NO production and the gene expression of iNOS were investigated in mice macrophages. The effects of GP to modulate macrophage function suggest it may contribute to the therapeutic potential of aqueous extract derived from this herb.
2.4. Animals Male BALB/c mice between 6 and 8 weeks old (weight: 18.6 ± 1.0 g) were purchased from the Experimental Animal Center of Peking University, China. Mice were kept for 1 week in our animal facility at 21–25 ◦ C and 50% relative humidity with a 12 h/12 h light/dark cycle. Soluble starch was prepared by dissolving 5 g in 100 ml distilled water, and the solution was filtered and stored at 4 ◦ C before using. The diluents of the solution (5 g/100 ml) was injected intraperitoneally to mice with the dose of 1 ml/mouse and then bred for 3 d. 2.5. Isolation of peritoneal macrophages
2. Materials and methods
Peritoneal fluid from male BALB/c mice were harvested from peritoneal cavities by infusing 10 ml ice-cold sterile PBS (pH 7.2–7.4). After centrifugation at 1000 rpm/min for 5 min, the cell pellets were suspended in RPMI-1640 supplemented with 10% (v/v) bovine calf serum, penicillin 100 U/ml, streptomycin 100 U/ml and seeded in 96-well plate at a cell density of 5 × 105 cells/ml, and allowed to adhere for 3 h at 37 ◦ C in 5% CO2 humidified incubator. After 3 h incubation, non-adherent cells were removed by washing twice with PBS and freshly prepared medium was added (Moretˇao et al., 2003). The viability of the adherent cells was assessed by trypan blue exclusion test, and the proportion of macrophages was determined by cell morphology under a microscope.
2.1. Plant material
2.6. NO production
Roots of Glycyrrhiza uralensis Fisch were collected from Inner Mongolia Municipality, China, and identified by Dr. Houwei Wang, Shandong University of Traditional Chinese Medicine, China. A voucher specimen was deposited at the School of Food Science and Technology, Jiangnan University, China. 2.2. Preparation of glycyrrhiza extract Briefly, aqueous extracts of glycyrrhiza roots were obtained at 90–95 ◦ C and at a water/root mass ratio of 10:1 (v/m) for 3–4 h. After filtration to remove debris fragments, the filtrate was concentrated in a rotary evaporator. Proteins were removed by adding 15% (m/m) of trichloroactic acid, the filtrate was neutralized by 1 mol/l NaOH, and then centrifuged to remove the precipitates. Subsequently, three volumes of ethanol were added to the supernates, and the precipitates were collected by centrifugation and washed with acetone for three times. The precipitates were dissolved in distilled water and then applied to a DEAE-cellulose column (2.5 cm × 60 cm). The bound materials were eluted with a linear gradient of NaCl (0–2 mol/l). Total polysaccharide obtained from the elution was fractionated by chromatography on a Sephacryl S400 HR column (3.5 cm × 100 cm) (Pharmacia, Sweden) and eluted with distilled water. The main fraction of GP was then dialyzed and lyophilized. The dried extract was dissolved in phosphate buffer solution (PBS, pH 7.2) and filtered through 0.22 m filter before use. 2.3. Materials Lipopolysaccharide (LPS), polymyxin B (PB) and interferon-␥ (IFN-␥) were purchased from Sigma (USA). RPMI-1640 medium was from Gibco (USA). Bovine calf serum was from Hyclone (USA). Commercially available iNOS kit was from Jiancheng bioengineering institute of Nanjing (China); RNAiso reagent and RNA PCR kit (AMV) ver.3.0 were from TaKaRa Biotechnology Co., Ltd. (Dalian, China).
Adherent macrophages (5 × 105 cells/well) were placed in a 96well plate and incubated in complete RPMI medium alone or medium containing various concentrations of GP or/and LPS/IFN-␥ for 48 h. Nitrite in the culture medium was determined by Griess reaction (Green et al., 1982). At the end of the culture period, a total 100 l/well of cell culture medium was incubated with equal volume of Griess solution (1% sulfanilamide, 0.1% napthyl ethyl diamine dihydrochloride in 5% phosphoric acid) at room temperature for 10 min. The absorbance was read at 492 nm, and the concentrations of NO2 − were determined from a least squares linear regression analysis of a sodium nitrite standard curve. 2.7. iNOS production RPMI-1640 of macrophages (1.0 × 106 cells/ml) were placed in a 6-well flat-bottomed plate and treated with different concentrations (0–400 g/ml) of GP, PBS and LPS were the blank and positive control groups, respectively. Macrophages were harvested as described above with 3000 l/well RPMI-1640 of different concentrations of GP up to 48 h, then the macrophages were collected and production of iNOS was measured using commercially available iNOS kit. 2.8. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was extracted using a RNA-purification kit. RT-PCR was performed using a RNA PCR kit (TaKaRa RNA PCR kit (AMV) ver.3.0). Complementary DNA (cDNA) was prepared from RNA (1 g) in 10 l reaction mixture which containing 1 l dNTP mixture (10 mM), 0.25 l RNase inhibitor, 0.5 l avian myeloblastosis virus (AMV) reverse transcriptase, and 0.5 l oligo-dT-adaptor primer at 55 ◦ C for 30 min. Subsequently, the mixture was heated at 99 ◦ C for 5 min, and refrigerated at 5 ◦ C for 5 min. The cDNA was amplified by PCR with a DNA thermal cycler. After 4 min pre-denaturation at 95 ◦ C, the PCR conditions were as follows: denaturation at 95 ◦ C for 50 s, annealing at 60 ◦ C for 30 s, and extension at 72 ◦ C for 90 s for 35 amplification cycles. Positive
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
and negative strand PCR primers were CCTTGTTCAGCTACGCCTTC and CTGAGGGCTCTGTTGAGGTC for the amplification of iNOS, CCTGAGGCTCTTTTCCAGCC and TAGAGGTCTTTACGGATGT CAACGT for -actin. A sample (7 l) of each amplified product was subjected to electrophoresis in a 1.5% agarose gel, stained with goldviewna IITM , and visualized under UV illumination. 2.9. Determination of endotoxin contamination Briefly, 1 ml of Affi-Prep Polymyxin Matrix was packed in a Bio-spin column, centrifuged at 200 rpm/mim for 2 min, and then 0.5 ml of GP (100 g/ml), LPS (2 g/ml) or GP (100 g/ml) plus LPS (2 g/ml) mixture were added. After incubating overnight at 4 ◦ C, the effluent was recovered from the column by centrifugation at the same condition (Im et al., 2006). 2.10. Fourier transformed infrared (FTIR) analysis The fractionated sample was analyzed by an absorbance IR spectroscopy by the KBr disc method using a Nexus-870 ThermoNickolet FTIR spectrometer from 400 to 4000 cm−1 . 2.11. Statistical analysis Biological assays were performed in triplicate. Results were expressed as mean ± standard deviations (S.D.). Data were analyzed using analysis of variance (SAS 9.0) and t-test to determine the statistical significance (p < 0.05).
61
Table 1 FTIR spectra of glycyrrhiza polysaccharide-derived fractions (4000–400 cm−1 ) were obtained from solid samples by KBr disc method Vibration mode
Characteristic peak (cm−1 )
Peaks of GP (cm−1 )
O–H stretching vibration C–H stretching vibration C–H bending vibration C–O stretching vibration ␣-Glucopyranose ␣-Isomeric pyranose symmetrical stretch
3600–3200 3000–2800 1400–1200 1200–1000 855–833 766 ± 10
3384 2886 1359, 1280, 1241 1018, 1060, 1148 842 760
cosidic structures are related to O–H stretching (3200–3600 cm−1 ), C–H stretching (2800–3000 cm−1 ), C–H bending vibration (1200–1400 cm−1 ) and C–O stretching (1000–1200 cm−1 ). Due to the presence of bands in the 3384, 2886, 1280, 1148, 1060 and 1018 spectra, the fraction was identified to contain a pyranose ring. The IR spectra (842, 760) also suggested that ␣-glycosidic bond was present in the isolated fraction. 3.2. Effects of GP on NO and iNOS production To investigate the effect of GP on NO and iNOS production, we measured the accumulation of nitrite, the stable end product of NO, in the culture media using Griess reagent. And the production of iNOS was measured using commercially available iNOS kit. The results showed that GP alone increased NO and iNOS production in macrophages by GP (10, 50,100, 200, 400 g/ml) in dose-dependent manner (Fig. 2), with NO levels to 1.66, 2.61, 4.2, 5.12, 5.15-fold and
3. Results 3.1. Isolation of water-soluble polysaccharide from glycyrrhiza The crude polysaccharides were purified by gel permeation using Sephacryl S-400 and Fig. 1 represents the gel permeation profile of ion exchange-purified polysaccharides. A single peak was found according to the carbohydrate concentration, fractions 11–31 were pooled as purified glycyrrhiza polysaccharide. Comparative analysis of pullulan standards measured by HPLC resulted in a calibration curve that was linear from molecular weight (Log Mol Wt = 1.44e + 001 − 5.53e − 001 T1 , where T is retention time), with a correlation coefficient is 0.982196. Using this calibration, the molecular weight of purified GP was approximately 11 kDa. The yields of crude and purified polysaccharide were approximately 4.25 and 0.87%, respectively. IR spectrum of the isolated polysaccharides is presented in Table 1. The attributes of the main absorption characteristics of gly-
Fig. 1. Gel permeation of extracted polysaccharide by chromatography on a column of Sephacryl S-400 HR (column dimension: 3.5 cm × 100 cm, flow rate = 0.5 ml/min, fraction size = 5 ml). Carbohydrate was estimated from each fraction by phenol sulfuric acid method.
Fig. 2. Effects of GP on NO (A) and iNOS (B) in macrophages or LPS-treated macrophages. Unfilled bars represent NO/iNOS inducing activity of macrophages were cultured with GP alone for 48 h. Filled bars represent NO/iNOS inducing activity of macrophages were pre-cultured with LPS (2 g/ml) for 6 h followed by GP (0–400 g/ml) for another 48 h. The data represent the means of triplicates, *p < 0.05 compared with control.
62
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
Fig. 3. Effects of GP on NO (A) and iNOS (B) and simultaneously with LPS (2 g/ml) in macrophages. The data represent the means of triplicates, *p < 0.05 compared with control.
Fig. 4. Production of NO (A) and iNOS (B) in macrophages treated with GP plus IFN-␥ for 48 h. The data represent the means of triplicates, *p < 0.05 compared with control.
iNOS to 1.76, 3.42, 3.74, 5.41, 5.43-fold respectively as compared to the control group. At the same time, the amount of NO and iNOS was produced in response to 50 g/ml of GP was similar to that induced by LPS (2 g/ml). Less than 10 g/ml of GP was showed slightly effective and, in some cases, ineffective (data not shown) to NO and iNOS production. The differences of NO and iNOS production between GP (>50 g/ml) treatments and the controls were statistically significant (p < 0.05). Pre-treatment with LPS significantly increased NO and iNOS production as compared to that of GP alone.
exposed to GP (100 g/ml) simultaneously. Similar trends were obtained for NO and iNOS production in macrophages treated with 10–400 g/ml doses of GP when exposed to IFN-␥ (100 U/ml) simultaneously.
3.3. Synergistic effects of GP and LPS on NO and iNOS production Macrophages were used to study the synergistic effects of GP plus LPS on NO and iNOS production. As shown in Fig. 3, dose-dependent enhancement of NO and iNOS production was observed in macrophages when treated with 10–400 g/ml GP. Co-incubation of macrophages with GP plus LPS synergistically increased NO and iNOS production, the synergistic effect was maximal in the treatment of 400 g/ml GP. GP, at concentrations <50 g/ml, had no effects on NO and iNOS production (Fig. 3). Increases of NO and iNOS production exposed to combined GP with LPS were lower than those of pretreated with LPS when concentrations of GP was equal (Figs. 2 and 3).
3.5. Effects of GP on the induction of iNOS gene expression mRNA-specific RT-PCR analysis was performed to determine whether the increase in NO synthesis induced by GP was due to the enhancement of iNOS mRNA expression. Macrophages were directly exposed to GP, the expression level of iNOS gene was monitored by RT-PCR analysis. As shown in Fig. 5, unstimulated cells of GP expressed no detectable iNOS mRNA, whereas exposured to GP clearly induced its accumulation. Furthermore, the transcription of iNOS mRNA was dose-dependently activated. The results reflected that the increased production of NO in macrophage was mediated by the expression of the iNOS gene. Control -actin was constitutively expressed and was not affected by the treatment of GP. These results indicate that GP increases the gene expression of iNOS, which is involved in anti-tumor activity. 3.6. Effects of polymyxin B on NO and iNOS production To ensure that the effects of GP were not due to endotoxin contamination, GP was treated with polymyxin B, an inhibitor of
3.4. Synergistic effects of GP and IFN- on NO and iNOS production It has been known that IFN-␥ stimulates the production of NO by macrophages isolated from peritoneal lavage of mouse (Kim and Son, 1996). The concentration-dependent induction of NO and iNOS by IFN-␥ in macrophages was shown in Fig. 4, NO and iNOS production was higher in all treatments of GP plus IFN-␥ than that of the control group. The results showed that a dose-dependent enhancement of NO and iNOS was observed in macrophages treated with 1–100 U/ml doses of IFN-␥ when
Fig. 5. Activation of iNOS mRNA expression by GP in macrophages. Total RNA was extracted and analyzed for the magnitude of iNOS mRNA expression using RT-PCR. Results are presented as amplified products electrophoresed on goldviewna II TMstained agarose gels.
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
Fig. 6. Effects of polymyxin B-treatment. LPS (2 g/ml), GP (100 g/ml), or LPS (2 g/ml) and GP (100 g/ml) mixture was added to polymyxin B-affinity column, incubated overnight at 4 ◦ C, eluted from the column by centrifugation, and then added to the cultures of macrophages (final, 1:80 dilution) for 48 h.
LPS activity, and the immunomodulatory activity was examined in peritoneal macrophages. As shown in Fig. 6, passage of LPS solution (2 g/ml) through polymyxin B-affinity column reduced the production of NO and iNOS almost completely, indicating that polymyxin B-affinity column absorbed LPS almost completely. Passage of GP solution (100 g/ml) through polymyxin B-affinity column, however, did not reduce the production of NO and iNOS in a significant level. To exclude possible interference of the complexforming activity of polymyxin B by unknown substances contained in the GP solution, GP was mixed with LPS, passed through polymyxin B-affinity column, then the production of NO and iNOS in macrophages was examined. As shown in Fig. 6, polymyxin Baffinity column could remove LPS from the mixture of GP and LPS. These results indicate that the immunomodulatory activity of GP was not due to LPS contamination. 4. Discussion and conclusions We demonstrate that treatment with GP, polysaccharide isolated from Glycyrrhiza uralensis Fisch, significantly induces NO production and iNOS transcription in macrophage. The major finding of this study is that GP significantly induced NO production and iNOS expression. Since macrophage activation play a significant role in the host defense mechanism and NO is related to cytolytic function of macrophages against a variety of tumors (Hibbs et al., 1987; Palmer et al., 1988), the increased synthesis of NO by GP might interfere with the growth of tumors. The role of NO in tumoricidal effect was evidenced by the experiments using the inhibitors of NO production. The processing of tumor antigen and the activa-
63
tion of T cells by macrophages also possibly helped the retardation of tumor growth. Polysaccharides isolated from natural sources can profoundly affect the immune system and therefore have the potential as immunomodulators with wide clinical applications. For example, polysaccharides extracted from Glycyrrhiza uralensis Fisch can enhance the expression of bax protein and decreases that of bac-2, p53 protein of sarcoma 180 cells (Shi et al., 2005), and exhibits anti-complementary and mitogenic activities (Hiroako et al., 1996). Yang and Yu (1990) reported glycyrrhiza polysaccharide could activate peritoneal macrophages and increased IL-1 production. Crude polysaccharide fraction obtained from the shoot and hairy root of Glycyrrhiza sp. induced nitric oxide production by mice peritoneal macrophages in vitro under aseptic conditions (Nose et al., 1998). The present study utilizing the aqueous extract of glycyrrhiza in macrophages is the first study on the signal pathway for NO synthesis. The major finding of this study is that the GP treatment alone induced NO production and iNOS expression significantly and peaked at the dose of 400 g/ml. Because of the pivotal role of NO and TNF-␥ in the anti-microbial and tumoricidal activity, many studies have been focused on developing therapeutic agents that regulate NO and TNF-␥ production (Poderoso et al., 1999). The results of present study suggested that simultaneously treatment with GP plus LPS/TNF-␥ have increased NO and iNOS production in mice macrophages treated with GP alone. However, the production of NO and iNOS in macrophages treated with LPS prior to adding to GP was higher than that of treatments with GP and LPS simultaneously. Although macrophage activation by GP is quite similar with that by LPS, differences are also observed between GP and LPS. The treatment with LPS/TNF-␥ followed by GP may affect NO and iNOS production. While it abolished LPS/TNF-␥ stimulation of macrophages, GP still may increase NO and iNOS production. NO production specific to IFN-␥ by macrophages, which determined by nitrite accumulation in culture media, have increased linearly at the concentrations of 0–100 U/ml for 48 h. IFN-␥-dependent formation of NO in macrophages results from the induction of iNOS expression (Gregory et al., 1993). This cytokine specificity was consistent with the previous report that peritoneal macrophages released reactive nitrogen intermediates in response to IFN-␥ only (Ding et al., 1988). It was testified that maximal production of NO and iNOS by macrophages was found in the treatment of 400 g/ml GP. It has also been demonstrated that macrophages stimulated by GP produced NO through the expression of iNOS gene, and it is though that the reactive nitrogen intermediates so induced play a significant role in tumoricidal activity (Lorsbach et al., 1993). Furthermore, the induction of NO production and gene expression by activated macrophages can lead to cytotoxic effects on malignant cells (Stuehr and Nathan, 1989; Duerksen-Hughes et al., 1992). In our experimental conditions and detection limits, the GP fraction was significantly active without the concomitant addition of LPS or IFN-␥ in the culture medium. This indicated that the addition of GP to LPS or IFN-␥-activated macrophages stimulated nitrite production via an immunomodulatory action rather than through a non-specific response due to cellular death. Because endotoxin is a strong activator of macrophages and is contaminated in many plant materials, possible contamination of endotoxin is always a matter of concern for the high molecular weight components isolated from plants. The macrophage-activating activity of GP, however, was not due to endotoxin contamination as shown by polymyxin B-treatment experiments. These results showed the possible roles of macrophages in the anti-tumor activity of polysaccharides. The anti-tumor activity of polysaccharides was explained in two points, the first one was the direct tumoricidal action of macrophages. Since NO is related to cytolytic function of macrophages against
64
A. Cheng et al. / Journal of Ethnopharmacology 118 (2008) 59–64
a variety of tumors (Hibbs et al., 1987; Palmer et al., 1988), the increased synthesis of NO might interfere with the growth of tumors. This was further evidenced by the results of experiments using the inhibitors of NO production (Yim et al., 1993; Farias-Eisner et al., 1994; Xie et al., 1995). The other one was related to the indirect actions of macrophages. For example, the augmented processing of tumor antigen and the lymphokine mediated helper T cells activation by macrophages also possibly helped the retardation of tumor growth. In summary, these experiments demonstrate that GP stimulates macrophages to produce NO through the induction of iNOS gene expression. Due to the critical role that NO release plays in cytolytic function of macrophages, the activation effects of GP on iNOS suggest that this compound may represent useful immunopotentiating agents. References Arase, Y., Ikeda, K., Murashima, N., Chayama, K., Tsubota, A., Koida, I., Suzuki, Y., Saitoh, S., Kobayashi, M., Kumada, H., 1997. The long-term efficacy of glycyrrhizin in chronic hepatitis C patients. Cancer 79, 1494–1500. Ding, A.H., Nathan, C.F., Stuehr, D.J., 1988. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidences for independent production. Journal of Immunology 141, 2407–2412. Duerksen-Hughes, P.J., Day, D., Laster, S.M., Zachariades, N.A., Aquino, L., Gooding, L.R., 1992. Both tumor necrosis factor and nitric oxide participate in lysis of simian virus 40-transformed cells by activated macrophages. Journal of Immunology 149, 2114–2122. Farias-Eisner, R., Sherman, M.P., Aeberhard, E., Chaudhuri, G., 1994. Nitric oxide is an important mediator for tumoricidal activity in vivo. Proceedings of the National Academy of Sciences (USA) 91, 9407–9411. Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum, S.R., 1982. Analysis of nitrate, nitrite, and [15 N] nitrate in biological fluids. Analytical Biochemistry 126, 131–138. Gregory, S.H., Wing, E.J., Hoffman, R.A., Simmons, R.L., 1993. Reactive nitrogen intermediates suppress the primary immunologic response to Listeria. Journal of Immunology 150, 2901–2909. Hibbs Jr., J.B., Taintor, R.R., Vavrin, Z., 1987. Macrophage cytotoxicity: role for l-arginine deiminase and imino nitrogen oxidation to nitrite. Science 235, 473–479. Hiroako, K., Norito, T., Zhao, J.F., Hideki, K., Haruki, Y., 1996. Pectic polysaccharides from roots of Glycyrrhiza uralensis: possible contribution of neutral oligosaccharides in the galacturonase-resistant region to anti-complementary and mitogenic activities. Plant Medicine 62, 14–19. Im, S.A., Kim, K., Lee, C.K., 2006. Immunomodulatory activity of polysaccharides isolated from Salicornia herbacea. International Immunopharmacology 6, 1451–1458. Jun, C.D., Choi, B.M., Kim, H.M., Chung, H.T., 1995. Involvement of protein kinase C during taxol-induced activation of murine peritoneal macrophages. Journal of Immunology 154, 6541–6547. Kim, Y.M., Son, K., 1996. A nitric oxide production bioassay for interferon-␥. Journal of Immunology Methods 198, 203–209. Kim, Y.H., Woo, K.J., Lim, J.H., Kim, S., Lee, T.J., Jung, E.M., Lee, J.M., Park, J.W., Kwon, T.K., 2005. ␥-Hydroxyquinoline inhibits iNOS expression and nitric oxide production by down-regulating LPS-induced activity of NF-B and C/EB in Raw 264.7 cells. Biochemical and Biophysical Research Communications 329, 591–597. Knight, J.A., 2000. Free radicals, antioxidants, and the immune system. Annual Clinic Laboratory Science 30, 145–158. Lorsbach, R.B., Murphy, W.J., Lowenstein, C.J., Snyder, S.H., Russell, S.W., 1993. Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor
cell killing. Molecular basis for the synergy between interferon-gamma and lipopolysaccharide. Journal of Biological Chemistry 268, 1908–1913. MacMicking, J., Xie, Q.W., Nathan, C., 1997. Nitric oxide and macrophage function. Annual Review of Immunology 15, 323–350. Moretˇao, M.P., Buchi, D.F., Gorin, P.A.J., Iacomini, M., Oliveira, M.B.M, 2003. Effect of an acidic heteropolysaccharide (ARAGAL) from the gum of Anadenanthera colubrina (Angico branco) on peritoneal macrophage functions. Immunology Letters 89, 175–185. Mayer, B., Hemmens, B., 1997. Biosynthesis and action of nitric oxide in mammalian cells. Trends in Biochemical Science 22, 477–481. Messmer, U.K., Ankarcrona, M., Nicotera, P., Brune, B., 1994. p53 expression in nitric oxide-induced apoptosis. FEBS Letters 355, 23–29. Muriel, P., 2000. Regulation of nitric oxide synthesis in the liver. Journal of Applied Toxicology 20, 189–195. Nathan, C., Xie, Q.W., 1994. Nitric oxide synthases: roles, tolls and controls. Cell 78, 915–918. Nose, M., Terawaki, K., Oguri, K., Ogihara, Y., Yoshimatsu, K., Shimomura, K., 1998. Activation of macrophages by crude polysaccharide fractions obtained from shoots of Glycyrrhiza glabra and hairy roots of Glycyrrhiza uralensis in vitro. Chemical Pharmacology Bulletin 21, 1110–1111. Palmer, R.M., Ashton, D.S., Moncada, S., 1988. Vascular endothelial cells synthesize nitric oxide from l-arginine. Nature 333, 664–670. Poderoso, J.J., Carreras, M.C., Schopfer, F., Lisdero, C.L., Riobo, N.A., Giulivi, C., Boveris, A.D., Boveris, A., Cadenas, E., 1999. The reaction of nitric oxide with ubiquinol: kinetic properties and biological significance. Free Radical Biology and Medicine 26, 925–935. Shi, Y.R., Wei, S.Y., Yang, Y., Niu, R.F., Song, F., 2005. Detecting induced apoptosis effect of the glycyrrhizia polysaccharide with flow cytometer (FCM). Modern Apparatus 4, 30–31. Shimizu, N., Tomoda, M., Takada, K., Gonda, R., 1992. The core structure and immunological activities of glycyrrhizan UA, the main polysaccharide from the root of Glycyrrhiza uralensis. Chemical Pharmacology Bulletin (Tokyo) 40, 2125–2128. Song, Y.S., Park, E.H., Hur, G.M., Ryu, Y.S., Kim, Y.M., Jin, C., 2002. Ethanol extract of propolis inhibits nitric oxide synthase gene expression and enzyme activity. Journal of Ethnopharmacology 80, 155–171. Sosroseno, W., Barid, I., Herminajeng, E., Susilowati, H., 2002. Nitric oxide production by a murine macrophage cell line (RAW264.7) stimulated with lipopolysaccharide from Actinobacillus action mycetemcomitans. Oral Microbiology Immunology 17, 72–78. Stuehr, D.J., Nathan, C.F., 1989. Nitric oxide: a macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. Journal of Experimental Medicine 169, 1543–1555. Sun, R.G., Zhang, J., 2006. A study of helical structure of glycyrrhiza polysaccharides by atomic force microscope. Acta Chimica Sinica 64, 2467–2472. Takada, K., Tomoda, M., Shimizu, N., 1992. Core structure of glycyrrhiza GA, the main polysaccharide from the stolon of Glycyrrhiza glabra var. glandulifera; anti-complementary and alkaline phosphatase-inducing activities of the polysaccharide and its degradation products. Chemical Pharmacology Bulletin 40, 2487–2490. Takahara, T., Watanabe, A., 1994. Effects of glycyrrhizin on hepatitis B surface antigen: a biochemical and morphological study. Journal of Hepatology 21, 601–609. Wang, C., Xi, G.R., Shi, Y.R., Zhang, L.H., 2003. Study on the anti-tumor effect in vivo of glycyrrhiza polysaccharide and its mechanism. Chinese Journal of Clinical Oncology 8, 85–87. Wang, Y.W., Zhang, H.B., Lv, J., Shi, Y.R., He, M., Wang, S.S., Ding, Y.F., 2000. Inhibition of glycyrrhiza polysaccharides (GPS) on virus. Acta Scientiarum Naturalium Universitatis Nankaiensis 33, 46–48. Xie, K., Huang, S., Dong, Z., Juang, S.H., Gutman, M., Xie, Q.W., 1995. Transfection with the inducible nitric oxide synthase gene suppresses tumorigenicity and abrogates metastasis by K-1735 murine melanoma cells. Journal of Experimental Medicine 181, 1333–1343. Yang, G., Yu, Y., 1990. Immunopotentiating effect of traditional Chinese drugs–ginsenoside and glycyrrhiza polysaccharide. Proceedings of the Chinese Academy of Medical Sciences, Peking Union Medical College 5, 188–193. Yim, C.Y., Bastian, N.R., Smith, J.C., Hibbs Jr., J.B., Samlowski, W.E., 1993. Macrophage nitric oxide synthesis delays progression of ultraviolet light-induced murine skin cancers. Cancer Research 53, 5507–5518.