- Email: [email protected]
Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
International Journal of Antimicrobial Agents journal homepage: http://www.elsevier.com/locate/ijantimicag
Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital Anong Kiddee a , Kritsada Henghiranyawong b , Jutharak Yimsabai b , Mujarin Tiloklurs b , Pannika R. Niumsup a,c,∗ a
Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University, Phitsanulok 65000, Thailand Clinical Pathology Department, Buddhachinaraj Hospital, Phitsanulok 65000, Thailand c Centre of Excellence in Medical Biotechnology, Faculty of Medical Science, Naresuan University, Phitsanulok 65000, Thailand b
a r t i c l e
i n f o
Article history: Received 28 March 2013 Accepted 16 May 2013 Keywords: Nosocomial spread Extensively drug-resistant Integron Pseudomonas aeruginosa
a b s t r a c t Fifty non-duplicate multiresistant isolates of Pseudomonas aeruginosa from a regional hospital in Northern Thailand were investigated for their antimicrobial susceptibility, presence of class 1 integrons and arrangement of gene cassettes as well as their genetic relationships. All but one isolate were classified as extensively drug-resistant P. aeruginosa (XDR-PA). Forty-one isolates (82%) were found to carry class 1 integrons. Amplification of the variable regions of class 1 integrons revealed seven diverse bands ranging in size from 0.7 kb to 7.0 kb. Sequence analysis of class 1 integron variable regions revealed the presence of several gene cassettes associated with resistance to aminoglycosides (aac, aad and aph), including the aac(3)-Ic cassette reported for the first time in Thailand. Gene cassettes encoding resistance to chloramphenicol (cmlA), -lactams (blaPSE , blaOXA and blaVEB ) and rifampicin (arr) were found. The putative small multidrug resistance protein (smr) and an open-reading frame with unknown function (orfD) were also detected. The aadA6–orfD cassette array was the most common integron found in this study. Integron-positive isolates had higher frequencies of antimicrobial resistance than isolates lacking integrons. Pulsed-field gel electrophoresis (PFGE) demonstrated the occurrence of horizontal gene transfer. Interestingly, a large number of XDR-PA isolates carrying identical integrons clearly exhibited the same PFGE pattern, indicating nosocomial spread of these isolates. The presence of XDR-PA carrying class 1 integrons is implicated in the possible spread of drug-resistant organisms, therefore screening for integron-positive P. aeruginosa might be necessary for protection against nosocomial infection. © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
1. Introduction Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen that is an important cause of various life-threatening infections associated with hospitalisation. Nosocomial infections caused by P. aeruginosa are often difficult to treat because this organism displays resistance to all, or almost all, commercially available antibiotics. Furthermore, the ability of P. aeruginosa to live in many diverse environmental conditions and to survive on minimal nutritional requirements has caused difficulties in the control and eradication of this pathogen [1]. Infections caused by drugresistant P. aeruginosa are associated with significant increases in morbidity and mortality. The rapid increase of multidrug-resistant P. aeruginosa (MDR-PA) during recent years has become a serious therapeutic problem worldwide. According to the National Antimicrobial Resistance Surveillance, Thailand, the rate of ceftazidime
∗ Corresponding author. Tel.: +66 55 964 612; fax: +66 55 964 770. E-mail addresses: [email protected], [email protected] (P.R. Niumsup).
resistance in P. aeruginosa was relatively high during the 6-year surveillance period (2000–2005) [2]. Recently, studies in several hospitals across Thailand showed a high prevalence of carbapenem resistance in P. aeruginosa [3,4]. The mechanisms of resistance in P. aeruginosa have been extensively investigated. These are enzyme production, target mutation, outer membrane impermeability and efflux pump overexpression [1]. However, resistance determinants associated with the presence of integrons have increasingly been reported [5]. Integrons, natural genetic elements capable of capturing gene cassettes by site-specific recombination, are known to contribute to the development of multidrug resistance among several Gram-negative bacteria. Integrons are frequently located on transmissible plasmids or transposons, which facilitate their transfer among bacterial populations [5]. Several reports have demonstrated that integrons play an important role in the carriage and spread of antibiotic resistance genes among bacteria [6–8]. Many different classes of integrons have been identified, however class 1 integrons are the most commonly found in antibiotic-resistant clinical isolates of Gram-negative bacteria including P. aeruginosa. Typically, a class
0924-8579/$ – see front matter © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
2
1 integron is composed of a 5 -conserved segment (5 CS) including an intI1 gene coding for a site-specific integrase, and a 3 CS including the qacE1 and sul1 genes encoding resistance to quaternary ammonium compounds and sulfonamides, respectively. Between 5 CS and 3 CS is found an internal variable region with one or more gene cassettes. Gene cassettes are mobile units composed of a gene, most often an antibiotic resistance gene, and a recombination site, the 59-base element. Several resistance gene cassettes, such as aminoglycoside-modifying enzymes (aac, aad and aphA) and extended spectrum -lactamases (bla), are associated with class 1 integrons in P. aeruginosa that confer resistance to antimicrobial agents [5]. Several studies have shown that integrons are associated with multidrug resistance in P. aeruginosa isolates [7–10]. Although resistance to antimicrobial agents in P. aeruginosa is common in Thailand, published reports on the prevalence of integrons in this organism are relatively limited. In 2002, the blaVEB-1 -carrying class 1 integron was found in ceftazidime-resistant P. aeruginosa isolates collected from a university hospital in Thailand [6]. Recently, the high prevalence of class 1 integrons with a variety of gene cassettes, including blaIMP-14 , blaIMP-15 and blaVIM-2 , in MDR-PA isolates from Thai hospitals has been reported [11,12]. In Buddhachinaraj Hospital (Phitsanulok, Thailand), clinical isolates of P. aeruginosa reveal a high frequency of multidrug resistance. We previously reported the presence of a blaIMP-1 -carrying class 1 integron in two carbapenemresistant P. aeruginosa isolates [13]. This has led to the speculation that there might be more antibiotic resistance genes that are associated with integrons among P. aeruginosa isolates in this hospital. Hence, this study was conducted to investigate the prevalence of class 1 integrons and their associated resistance gene cassettes of multiple antibiotic-resistant P. aeruginosa isolates. The genetic relationship among the integron-positive isolates was also determined. 2. Materials and methods 2.1. Bacterial isolates Between November 2007 and April 2008, 50 non-duplicate P. aeruginosa isolates were collected from various clinical materials at Buddhachinaraj Hospital, which is a 1000-bed teaching hospital in Phitsanulok, Northern Thailand. Isolates were recovered from hospitalised patients (sputum, 34; pus, 7; urine, 1; blood, 1; fluid, 1; wound, 2; and other, 4). Isolates were identified as P. aeruginosa using standard biochemical tests. All isolates were grown on Pseudomonas agar with C N selective supplement (Oxoid Ltd., Basingstoke, UK) throughout the study. 2.2. Antimicrobial susceptibility testing Susceptibility testing was performed by the disk diffusion method on Mueller–Hinton agar (Becton Dickinson and Co., Sparks, MD) and was interpreted in accordance with the recommendations of the Clinical and Laboratory Standards Institute (CLSI) [14]. Eighteen antibiotic discs from four classes of antimicrobial agents including -lactams (ticarcillin, ticarcillin/clavulanic acid, piperacillin, piperacillin/tazobactam, cefoperazone, cefotaxime, ceftriaxone, ceftazidime, cefepime, imipenem, meropenem, aztreonam), fluoroquinolones (ciprofloxacin, ofloxacin, levofloxacin), aminoglycosides (gentamicin, amikacin) and lipopeptide (colistin) were used. All antibiotic discs were purchased from Oxoid Ltd. Isolates showing intermediate results were considered to be resistant. Resistance patterns in P. aeruginosa isolates were classified according to the recently published proposed interim definitions [15]. An isolate was defined as MDR-PA if it was non-susceptible to at least one agent in three or more antipseudomonal antimicrobial
Table 1 Primer sequences used for PCR amplification of class 1 integrons. Primer
Sequence (5 → 3 )
Estimated product size (bp)
Reference
Int1F Int1R qacE1F qacE1R sul1F sul1R In5 CS In3 CS
GCATCCTCGGTTTTCTGG GGTGTGGCGGGCTTCGTG ATCGCAATAGTTGGCGAAGT CAAGCTTTTGCCCATGAAGC CTTCGATGAGAGCCGGCGGC GCAAGGCGGAAACCCGCGCC GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA
457
[16]
236
[17]
437
[17]
Variable
[18]
categories, and as extensively drug-resistant P. aeruginosa (XDRPA) if it was non-susceptible to at least one agent in all but two or less antipseudomonal antimicrobial categories. 2.3. Detection of integrons and gene cassettes All isolates were screened for the presence of class 1 integrons by PCR using specific primers located on an integrase gene, intI1 (Table 1). All of the intI1-positive isolates were investigated for the presence of typical 3 CS using primers for qacE1 and sul1 genes (Table 1). Amplification was performed in a 50 L mixture containing 10 M of each primer, 1.5 mM MgCl2 , 200 M dNTPs and 1 U Platinum Taq Polymerase together with its reaction buffer (Invitrogen, Carlsbad, CA). A portion of the bacterial colony was added to provide the DNA template. Cell lysis and DNA amplification were performed in a Hybaid PCR Sprint Thermal Cycler (Thermo Scientific, Basingstoke, UK) using the following conditions: initial denaturation at 94 ◦ C for 5 min, followed by 35 cycles of denaturation at 94 ◦ C for 1 min, annealing at 48 ◦ C for 45 s and extension at 72 ◦ C for 1 min, and a final extension at 72 ◦ C for 5 min. Class 1 integron variable regions were amplified using primers In5 CS and In3 CS (Table 1). PCR amplification was carried out as described above, with the exception that the PCR extension time was extended to 5 min. Amplicons were separated by agarose gel electrophoresis, stained with 0.5 g/mL ethidium bromide and visualised using an ultraviolet transilluminator (Gel Documentation Systems; Bio-Rad Laboratories Inc., Hercules, CA). 2.4. Restriction fragment length polymorphisms (RFLPs) PCR amplicons were digested by SmaI, EcoRI, SacI and HindIII restriction enzymes (Fermentas, Hanover, MD) and the products were analysed by agarose gel electrophoresis. Amplicons with identical digested profiles were considered to contain the same gene cassettes. One representative of each RFLP type was randomly selected for DNA sequencing. 2.5. DNA sequencing and analysis of sequence data Selected PCR products were analysed by DNA sequencing. The amplicons were purified using a DNA purification kit (GF-1 Nucleic Acid Extraction Kit; Vivantis Inc., Chino, CA) and were sent to a commercial facility for sequencing (First BASE Laboratories Sdn Bhd, Selangor, Malaysia). Sequences were compared with those available in the GenBank database using the BLAST algorithm available on the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov). 2.6. Pulsed-field gel electrophoresis (PFGE) Investigation of the genetic relationship among P. aeruginosa isolates was performed by PFGE according to Xiong et al. [19]. Briefly, isolates were grown overnight in Luria–Bertani broth
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
3
Table 2 Susceptibilities of 50 Pseudomonas aeruginosa isolates to 18 antimicrobial agents tested and their association with the presence of class 1 integrons. Antibiotic
TIC TIM PIP TZP CFP CTX CRO CAZ FEP IPM MEM ATM CIP OFX LEV GEN AMK COL
P. aeruginosa isolates (n = 50)
Integron-positive isolates (n = 41)
Integron-negative isolates (n = 9)
S (%)
R (%)
S (%)
R (%)
S (%)
R (%)a
6 (12.0) 1 (2.0) 15 (30.0) 40 (80.0) 3 (6.0) 0 (0) 0 (0) 6 (12.0) 2 (4.0) 4 (8.0) 0 (0) 5 (10.0) 5 (10.0) 4 (8.0) 4 (8.0) 9 (18.0) 19 (38.0) 50 (100)
44 (88.0) 49 (98.0) 35 (70.0) 10 (20.0) 47 (94.0) 50 (100) 50 (100) 44 (88.0) 48 (96.0) 46 (92.0) 50 (100) 45 (90.0) 45 (90.0) 46 (92.0) 46 (92.0) 41 (82.0) 31 (62.0) 0 (0)
0 (0) 0 (0) 9 (22.0) 35 (85.4) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 4 (9.8) 0 (0) 0 (0) 1 (2.4) 1 (2.4) 1 (2.4) 1 (2.4) 15 (36.6) 41(100)
41 (100) 41 (100) 32 (78.0) 6 (14.6) 41 (100) 41 (100) 41 (100) 41 (100) 41 (100) 37 (90.2) 41 (100) 41 (100) 40 (97.6) 40 (97.6) 40 (97.6) 40 (97.6) 26 (63.4) 0 (0)
6 (66.7) 1 (11.1) 6 (66.7) 5 (55.6) 3 (33.3) 0 (0) 0 (0) 6 (66.7) 2 (22.2) 0 (0) 0 (0) 5 (55.6) 4 (44.4) 3 (33.3) 3 (33.3) 8 (88.9) 8 (88.9) 9 (100)
3 (33.3) 8 (88.9) 3 (33.3) 4 (44.4) 6 (66.7) 9 (100) 9 (100) 3 (33.3) 7 (77.8) 9 (100) 9 (100) 4 (44.4) 5 (55.6) 6 (66.7) 6 (66.7) 1 (11.1) 1 (11.1) 0 (0)
S, susceptible; R, resistant (including intermediate isolates); TIC, ticarcillin; TIM, ticarcillin/clavulanic acid; PIP, piperacillin; TZP, piperacillin/tazobactam; CFP, cefoperazone; CTX, cefotaxime; CRO, ceftriaxone; CAZ, ceftazidime; FEP, cefepime; IPM, imipenem; MEM, meropenem; ATM, aztreonam; CIP, ciprofloxacin; OFX, ofloxacin; LEV, levofloxacin; GEN, gentamicin; AMK, amikacin; COL, colistin.
(Becton Dickinson and Co.) and the turbidity was adjusted to 1.3–1.4 at 625 nm. Cultures were then embedded in 2% lowmelting-point agarose. Embedded bacterial plugs were incubated with lysozyme in lysis solution [1 M NaCl, 0.1 M ethylene diamine tetra-acetic acid (EDTA), 10 mM Tris–HCl, 0.2% sodium deoxycholate and 0.5% sarkosyl] at 37 ◦ C for 1 h and 15 U/mg proteinase K in ES solution (0.25 M EDTA pH 8.0 and 1% sarkosyl) at 50 ◦ C for 24 h. Chromosomal DNA was digested with SpeI (Fermentas) at 37 ◦ C for 16 h. DNA was electrophoresed through 1% Pulsed Field Certified agarose in 0.5× TBE (Tris–borate–EDTA) running buffer using a CHEF Mapper® XA System (Bio-Rad Laboratories). Saccharomyces cerevisiae chromosomal DNA (Bio-Rad Laboratories) was used as a molecular size standard. Banding patterns were interpreted by visual inspection of a photograph of the ethidium bromide-stained gel and were classified in accordance with the criteria defined by Tenover et al. [20]. PFGE patterns were designated by a capital letter. Isolates with indistinguishable banding patterns were assigned to the same PFGE pattern. When there was a difference of one to three bands, the isolates were classified as a subtype, which was designated with the same capital letter used for the major type, followed by an Arabic number (e.g. A1, A2, etc.). 3. Results 3.1. Antimicrobial susceptibility of Pseudomonas aeruginosa isolates
for class 1 integrons by amplifying the intI1 gene. All intI1-carrying isolates were also positive for qacE1 and sul1 genes, which are the key signatures for the class 1 integrons, as determined by PCR and sequencing (results not shown). The 41 P. aeruginosa isolates that were positive for intI1 were further analysed for the class 1 integron variable regions by PCR. PCR amplification of class 1 integrons showed several diverse bands ranging in size from 0.7 kb to 7.0 kb. According to the number and size of PCR products, seven different integron profiles (IPs) were observed (Fig. 1; Table 3). Thirty-one isolates carried a single class 1 integron with different-sized variable regions (IP1, IP3, IP5, IP6 and IP7). Ten isolates carried two or more distinct variable regions (IP2 and IP4). PCR-RFLP demonstrated that the variable regions of amplicons with the same size had the same DNA pattern, suggesting that the arrangement of gene cassettes of these PCR amplicons was identical (results not shown). Nucleotide sequence analysis of the class 1 integron variable regions revealed the presence of several gene cassettes (Table 3). The smallest integron (0.7 kb) carried a single aadB gene, whilst the 1.4 kb integron contained aacA7–aacA7 gene cassettes. Most isolates (25/41; 61.0%) had an aadA6–orfD cassette array (1.3 kb integron). When the 2.0 kb, 2.6 kb and 3.0 kb integrons were sequenced, the gene cassettes identified included blaPSE-1 –aadA2, aac-(3)-Ic–smr–cmlA5 and aadB–cmlA6–aadA15, respectively. The largest amplicon of 7.0 kb was found in only one isolate and
All 50 P. aeruginosa isolates were tested for their susceptibility to 18 antimicrobial agents. The percentages of susceptible and resistant isolates are shown in Table 2. All isolates were resistant to cefotaxime, ceftriaxone and meropenem. These isolates also exhibited resistance to ticarcillin, ticarcillin/clavulanic acid, piperacillin, cefoperazone, ceftazidime, cefepime, imipenem, aztreonam, ciprofloxacin, ofloxacin, levofloxacin, gentamicin and amikacin (62–98%). A low resistance rate was observed to piperacillin/tazobactam (20%). All isolates remained susceptible to colistin. Forty-nine isolates and one isolate were classified as XDRPA and MDR-PA, respectively. 3.2. Integrons and characterisation of gene cassettes All P. aeruginosa isolates were investigated for the presence of class 1 integrons by PCR. Of the 50 isolates, 41 (82%) were positive
Fig. 1. PCR amplification products of class 1 integron variable regions using primers In5 CS and In3 CS. M, 1 kb plus ladder (Fermentas, Hanover, MD); lanes 1–7, integron profiles 1–7 from extensively drug-resistant Pseudomonas aeruginosa isolates, respectively.
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
ARTICLE IN PRESS
G Model ANTAGE-4115; No. of Pages 6
A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
4
Table 3 Integron profiles (IPs) and pulsed-field gel electrophoresis (PFGE) patterns found in extensively drug-resistant Pseudomonas aeruginosa (XDR-PA) isolates. IP
No. of isolates (N = 41)
1 2
2 5
3 4
25 5
5 6 7 a b
2a 1 1
Approximate size of integron (bp)
Gene cassette array
PFGE patterns (no. of isolates)
0.7 0.7 1.4 2.6 1.3 1.4 2.6 2.0 3.0 7.0
aadB aadB aacA7–aacA7b aac(3)-Ic–smr–cmlA5b aadA6–orfD aacA7–aacA7 aac(3)-Ic–smr–cmlA5b blaPSE-1 –aadA2 aadB–cmlA6–aadA15b tnpA–blaVEB-2 –aadB–arr-2–cmlA5–blaOXA-10 –aadA1
G (2) A1 (1), A2 (1), A3 (1), A4 (2)
B2 (25) B1 (1), C1 (2), C2 (1), E (1) H (1), I (1) F (1) D (1)
One isolate was classified as multidrug-resistant P. aeruginosa. Gene cassette arrays identified for the first time.
Fig. 2. Representative DNA macrorestriction profiles of the extensively drugresistant Pseudomonas aeruginosa (XDR-PA) isolates. Chromosomal DNA was prepared and digested with SpeI (Fermentas, Hanover, MD) and was subjected to pulsed-field gel electrophoresis (PFGE). M, Saccharomyces cerevisiae chromosomal DNA (Bio-Rad Laboratories Inc., Hercules, CA); lanes 1–25, 25 XDR-PA isolates carrying aadA6–orfD cassette array (PFGE pattern B2).
contained the tnpA–blaVEB-2 –aadB–arr-2–cmlA5–blaOXA-10 –aadA1 array. 3.3. Antimicrobial susceptibility of integron-positive and -negative Pseudomonas aeruginosa isolates Comparison of antimicrobial susceptibility among P. aeruginosa isolates revealed that the integron-positive isolates had higher frequencies of resistance to 12 antimicrobial agents tested, including ticarcillin, ticarcillin/clavulanic acid, piperacillin, cefoperazone, ceftazidime, cefepime, aztreonam, ciprofloxacin, ofloxacin, levofloxacin, gentamicin and amikacin (Table 2). In addition, the integron-carrying isolates showed resistance to multiple antimicrobial classes whose resistant genes were not encoded in the class 1 integrons. 3.4. Pulsed-field gel electrophoresis analysis To determine the genetic relationships between the integroncarrying P. aeruginosa isolates, PFGE was performed. PFGE patterns obtained after SpeI digestion revealed the presence of nine patterns (A–I) (Table 3). The predominant clone, represented by 25 (61.0%) of the 41 isolates, belonged to pattern B2 (Fig. 2). Interestingly, most XDR-PA isolates that harboured the same integron showed an identical PFGE pattern as follows: IP1-carrying isolates (PFGE pattern G); IP2-carrying isolates (PFGE pattern A4); IP3-carrying isolates (PFGE pattern B2); and IP4-carrying isolates (PFGE pattern C1). In addition, isolates that shared the same IP exhibited different PFGE patterns, such as those carrying IP2, IP4 or IP5. 4. Discussion The emergence of multiresistant clinical isolates of P. aeruginosa is increasingly reported and has become an emerging challenge
to healthcare workers. In this study, the majority of isolates were resistant to several antimicrobial agents tested, consistent with those previously reported from Thailand [4,11,12]. All isolates but one were considered as XDR-PA, which may lead to difficulty in the treatment of P. aeruginosa infection. The exceptionally high rate of XDR-PA found in this work could be due to the frequent and inappropriate use of antibiotics in Thailand [21]. However, all isolates remained susceptible to colistin, which has been shown to be a safe and effective treatment of infection caused by multiresistant P. aeruginosa in Thai patients [22]. Class 1 integrons have been associated with various antibiotic resistance genes and constituted an important role in the development of antimicrobial resistance. In this study, the presence of typical class 1 integrons was detected in 41 isolates (82%), indicating a high prevalence of class 1 integrons in antibiotic-resistant P. aeruginosa isolates in this hospital. Of these, 40 isolates were XDRPA and 1 isolate was classified as MDR-PA (Table 3). This result is slightly higher than that recently reported from Thailand, in which class 1 integrons were detected in 69.3% of P. aeruginosa isolates collected from the largest university hospital in Bangkok [12]. However, this figure is much higher compared with early reports of P. aeruginosa isolates carrying class 1 integrons, such as 38–40.8% in China [9,10,23], 44% in the Czech Republic [7], 46.4% in Spain [24] and 60% in Malaysia [25]. In this study, seven different profiles of class 1 integrons were detected. Nucleotide sequence analysis of class 1 integron variable regions revealed the presence of several gene cassettes associated with resistance to a variety of aminoglycosides (aac, aad and aph), chloramphenicol (cmlA), -lactams (blaPSE , blaOXA and blaVEB ) and rifampicin (arr). The putative small multidrug resistance protein (smr) and an open-reading frame with unknown function (orfD) were also detected. The aadA6–orfD cassette array (1.3 kb) was the most prevalent integron in XDR-PA isolates in this study. It was also the most prevalent gene cassette array in P. aeruginosa in Nanjing, China [9] and has been detected in P. aeruginosa from other countries including Thailand [12,26]. The gene cassettes identified in this study were not novel. Four cassette arrays (aadB, aadA6–orfD, blaPSE-1 –aadA2 and tnpA–blaVEB-2 –aadB–arr2–cmlA5–blaOXA-10 –aadA1) were previously found in clinical isolates of Gram-negative bacteria, including MDR-PA, in Thailand [6,12,27]. According to the database in GenBank, the organisations of three cassette arrays (aacA7–aacA7, aac(3)-Ic–smr–cmlA5 and aadB–cmlA6–aadA15) were detected for the first time. Association between aac, aad, aph, bla, cmlA and arr genes and class 1 integrons in P. aeruginosa has frequently been described [6–10,23,24,26]. However, the presence of aac(3)-Ic is interesting. This gene encodes for the aminoglycoside 3-N-acetyltransferase, which confers resistance to gentamicin. According to previously published studies, there have been few reports on the aac(3)-Ic gene. One was the first detection of this gene, which resided as a gene cassette in a
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
class 1 integron, from a MDR-PA isolate from Italy in 2003 [28]. Later, it was found, also as a gene cassette in a class 1 integron, in P. aeruginosa from Turkey, Australia and Malaysia [8,29,30]. To our knowledge, this is the first detection of aac(3)-Ic in Thailand. In addition, the arrangement of the class 1 integron containing aac(3)Ic found in this study [aac(3)-Ic–smr–cmlA5] was similar to that found in Turkey, Australia and Malaysia [aac(3)-Ic–cmlA5]; only one additional smr gene was found. It is possible that the new cassette array could be formed by capturing the smr gene and integrating it into the aac(3)-Ic–cmlA5 array. The presence of aac(3)-Ic in 10 XDRPA isolates in this study (Table 3) is of concern and suggests the international spread of this gene, possibly by means of travelling. Multiresistance does not necessarily correlate with integron presence. This observation may be explained by the fact that nine P. aeruginosa isolates lacking class 1 integrons showed the XDR phenotype. Furthermore, many isolates exhibited resistance to antimicrobial agents whose resistant genes are not part of gene cassettes within the integrons. For instance, resistance to carbapenems is often caused by production of metallo--lactamases (MBLs), and the MBL genes are frequently located as gene cassettes in class 1 integrons [5]. In this study, all isolates were resistant to carbapenems, however no MBL genes were detected. Therefore, resistance to carbapenems may have resulted from other mechanisms such as decreased permeability or efflux pump overexpression [1]. To determine whether the P. aeruginosa isolates carrying the same IP were due to the spread of a single clone, all isolates were genotyped by PFGE. Identical integron cassettes were detected in clonally unrelated isolates such as those carrying IP4 or IP5, suggesting the occurrence of horizontal transfer of integrons. Interestingly, most XDR-PA isolates that harboured the same integron were clonally related, particularly IP3-carrying isolates. The apparent nosocomial spread of XDR-PA isolates suggests that there are inadequate infection control practices within the hospital. In conclusion, the presence of class 1 integrons harbouring different gene cassette arrays was found in a large number of XDR-PA isolates in a regional Thai hospital. Since integrons play an important role in the uptake and dissemination of resistance genes, we therefore suggest that resistant surveillance including screening for class 1 integrons might be necessary to control the spread of drug-resistant organisms. Furthermore, nosocomial spread of class 1 integron-carrying XDR-PA isolates was clearly evident. These results emphasise the need for the application of strict prevention strategies, including rigorous infection control and restricted use of antimicrobial agents, within the hospital.
[3]
[4]
[5] [6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
Acknowledgments [21]
The authors are grateful to the staff of the Clinical Pathology Department at Buddhachinaraj Hospital (Phitsanulok, Thailand) for their help in collection of P. aeruginosa isolates. The authors would like to thank staff at the Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University (Phitsanulok) for their technical assistance. Funding: This study was supported by the National Research Council of Thailand through the Annual Research Fund of Naresuan University. Competing interests: None declared. Ethical approval: Not required.
[22]
[23]
[24]
[25]
[26]
References ˜ C, Hancock RE. Pseudomonas aeruginosa: [1] Breidenstein EB, de la Fuente-Núnez all roads lead to resistance. Trends Microbiol 2011;19:419–26. [2] Dejsirilert S, Suankratay C, Trakulsomboon S, Thongmali O, Sawanpanyalert P, Aswapokee N, et al. National Antimicrobial Resistance Surveillance, Thailand
[27]
5
(NARST) data among clinical isolates of Pseudomonas aeruginosa in Thailand from 2000 to 2005. J Med Assoc Thai 2009;92(Suppl.):S68–75. Kiratisin P, Chongthaleong A, Tan TY, Lagamayo E, Roberts S, Garcia J, et al. Comparative in vitro activity of carbapenems against major Gram-negative pathogens: results of Asia-Pacific surveillance from the COMPACT II study. Int J Antimicrob Agents 2012;39:311–16. Khuntayaporn P, Montakantikul P, Mootsikapun P, Thamlikitkul V, Chomnawang MT. Prevalence and genotypic relatedness of carbapenem resistance among multidrug-resistant Pseudomonas aeruginosa in tertiary hospitals across Thailand. Ann Clin Microbiol Antimicrob 2012;11:25. Partridge SR, Tsafnat G, Coiera E, Iredell JR. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev 2009;33:757–84. Girlich D, Naas T, Leelaporn A, Poirel L, Fennewald M, Nordmann P. Nosocomial spread of the integron-located veb-1-like cassette encoding an extendedspectrum -lactamase in Pseudomonas aeruginosa in Thailand. Clin Infect Dis 2002;34:603–11. Nemec A, Krizova L, Maixnerova M, Musilek M. Multidrug-resistant epidemic clones among bloodstream isolates of Pseudomonas aeruginosa in the Czech Republic. Res Microbiol 2010;161:234–42. Kor SB, Choo QC, Chew CH. New integron gene arrays from multiresistant clinical isolates of Enterobacteriaceae and Pseudomonas aeruginosa from hospitals in Malaysia. J Med Microbiol 2013;62:412–20. Gu B, Tong M, Zhao W, Liu G, Ning M, Pan S, et al. Prevalence and characterization of class 1 integrons among Pseudomonas aeruginosa and Acinetobacter baumannii isolates from patients in Nanjing, China. J Clin Microbiol 2007;45:241–3. Chen J, Su Z, Liu Y, Wang S, Dai X, Li Y, et al. Identification and characterization of class 1 integrons among Pseudomonas aeruginosa isolates from patients in Zhenjiang, China. Int J Infect Dis 2009;13:717–21. Piyakul C, Tiyawisutsri R, Boonbumrung K. Emergence of metallo--lactamase IMP-14 and VIM-2 in Pseudomonas aeruginosa clinical isolates from a tertiarylevel hospital in Thailand. Epidemiol Infect 2012;140:539–41. Poonsuk K, Tribuddharat C, Chuanchuen R. Class 1 integrons in Pseudomonas aeruginosa and Acinetobacter baumannii isolated from clinical isolates. Southeast Asian J Trop Med Public Health 2012;43:376–84. Boonkerd N, Pibalpakdi P, Tiloklurs M, Niumsup PR. Class 1 integron containing metallo--lactamase gene blaIMP-1 in carbapenem-resistant Pseudomonas aeruginosa in Thailand. J Infect Chemother 2009;15:257–61. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; seventeenth informational supplement. Document M100-S17. Wayne, PA: CLSI; 2007. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268–81. Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, et al. PCR typing of genetic determinants for metallo--lactamases and integrases carried by Gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol 2003;41:5407–13. Di Conza J, Ayala JA, Power P, Mollerach M, Gutkind G. Novel class 1 integron (InS21) carrying blaCTX-M-2 in Salmonella enterica serovar Infantis. Antimicrob Agents Chemother 2002;46:2257–61. Lévesque C, Piché L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995;39:185–91. Xiong Z, Zhu D, Wang F, Zhang Y, Okamoto R, Inoue M. Investigation of extended-spectrum -lactamase in Klebsiellae pneumoniae and Escherichia coli from China. Diagn Microbiol Infect Dis 2002;44:195–200. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsedfield gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. Rattanaumpawan P, Sutha P, Thamlikitkul V. Effectiveness of drug use evaluation and antibiotic authorization on patients’ clinical outcomes, antibiotic consumption, and antibiotic expenditures. Am J Infect Control 2010;38: 38–43. Koomanachai P, Tiengrim S, Kiratisin P, Thamlikitkul V. Efficacy and safety of colistin (colistimethate sodium) for therapy of infections caused by multidrugresistant Pseudomonas aeruginosa and Acinetobacter baumannii in Siriraj Hospital, Bangkok, Thailand. Int J Infect Dis 2007;11:402–6. Xu H, Su Z, Wang S, Dai X, Chen J, Kong F, et al. Four novel resistance integron gene-cassette occurrences in bacterial isolates from Zhenjiang, China. Curr Microbiol 2009;59:113–17. ˜ M. Class Ruiz-Martínez L, López-Jiménez L, Fusté E, Vinuesa T, Martínez JP, Vinas 1 integrons in environmental and clinical isolates of Pseudomonas aeruginosa. Int J Antimicrob Agents 2011;38:398–402. Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo--lactamase-positive Pseudomonas aeruginosa in Malaysia. J Med Microbiol 2011;60:988–94. Shahcheraghi F, Badmasti F, Feizabadi MM. Molecular characterization of class 1 integrons in MDR Pseudomonas aeruginosa isolated from clinical settings in Iran, Tehran. FEMS Immunol Med Microbiol 2010;58:421–5. Dalsgaard A, Forslund A, Serichantalergs O, Sandvang D. Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand. Antimicrob Agents Chemother 2000;44: 1315–21.
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
[28] Riccio ML, Docquier JD, Dell’Amico E, Luzzaro F, Amicosante G, Rossolini GM. Novel 3-N-aminoglycoside acetyltransferase gene, aac(3)-Ic, from a Pseudomonas aeruginosa integron. Antimicrob Agents Chemother 2003;47: 1746–8. [29] Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1
metallo--lactamase gene in a university hospital in Turkey. Microb Drug Resist 2007;13:191–8. [30] Roy Chowdhury P, Merlino J, Labbate M, Cheong EY, Gottlieb T, Stokes HW. Tn6060, a transposon from a genomic island in a Pseudomonas aeruginosa clinical isolate that includes two class 1 integrons. Antimicrob Agents Chemother 2009;53:5294–6.
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
ARTICLE IN PRESS International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
International Journal of Antimicrobial Agents journal homepage: http://www.elsevier.com/locate/ijantimicag
Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital Anong Kiddee a , Kritsada Henghiranyawong b , Jutharak Yimsabai b , Mujarin Tiloklurs b , Pannika R. Niumsup a,c,∗ a
Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University, Phitsanulok 65000, Thailand Clinical Pathology Department, Buddhachinaraj Hospital, Phitsanulok 65000, Thailand c Centre of Excellence in Medical Biotechnology, Faculty of Medical Science, Naresuan University, Phitsanulok 65000, Thailand b
a r t i c l e
i n f o
Article history: Received 28 March 2013 Accepted 16 May 2013 Keywords: Nosocomial spread Extensively drug-resistant Integron Pseudomonas aeruginosa
a b s t r a c t Fifty non-duplicate multiresistant isolates of Pseudomonas aeruginosa from a regional hospital in Northern Thailand were investigated for their antimicrobial susceptibility, presence of class 1 integrons and arrangement of gene cassettes as well as their genetic relationships. All but one isolate were classified as extensively drug-resistant P. aeruginosa (XDR-PA). Forty-one isolates (82%) were found to carry class 1 integrons. Amplification of the variable regions of class 1 integrons revealed seven diverse bands ranging in size from 0.7 kb to 7.0 kb. Sequence analysis of class 1 integron variable regions revealed the presence of several gene cassettes associated with resistance to aminoglycosides (aac, aad and aph), including the aac(3)-Ic cassette reported for the first time in Thailand. Gene cassettes encoding resistance to chloramphenicol (cmlA), -lactams (blaPSE , blaOXA and blaVEB ) and rifampicin (arr) were found. The putative small multidrug resistance protein (smr) and an open-reading frame with unknown function (orfD) were also detected. The aadA6–orfD cassette array was the most common integron found in this study. Integron-positive isolates had higher frequencies of antimicrobial resistance than isolates lacking integrons. Pulsed-field gel electrophoresis (PFGE) demonstrated the occurrence of horizontal gene transfer. Interestingly, a large number of XDR-PA isolates carrying identical integrons clearly exhibited the same PFGE pattern, indicating nosocomial spread of these isolates. The presence of XDR-PA carrying class 1 integrons is implicated in the possible spread of drug-resistant organisms, therefore screening for integron-positive P. aeruginosa might be necessary for protection against nosocomial infection. © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
1. Introduction Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen that is an important cause of various life-threatening infections associated with hospitalisation. Nosocomial infections caused by P. aeruginosa are often difficult to treat because this organism displays resistance to all, or almost all, commercially available antibiotics. Furthermore, the ability of P. aeruginosa to live in many diverse environmental conditions and to survive on minimal nutritional requirements has caused difficulties in the control and eradication of this pathogen [1]. Infections caused by drugresistant P. aeruginosa are associated with significant increases in morbidity and mortality. The rapid increase of multidrug-resistant P. aeruginosa (MDR-PA) during recent years has become a serious therapeutic problem worldwide. According to the National Antimicrobial Resistance Surveillance, Thailand, the rate of ceftazidime
∗ Corresponding author. Tel.: +66 55 964 612; fax: +66 55 964 770. E-mail addresses: [email protected], [email protected] (P.R. Niumsup).
resistance in P. aeruginosa was relatively high during the 6-year surveillance period (2000–2005) [2]. Recently, studies in several hospitals across Thailand showed a high prevalence of carbapenem resistance in P. aeruginosa [3,4]. The mechanisms of resistance in P. aeruginosa have been extensively investigated. These are enzyme production, target mutation, outer membrane impermeability and efflux pump overexpression [1]. However, resistance determinants associated with the presence of integrons have increasingly been reported [5]. Integrons, natural genetic elements capable of capturing gene cassettes by site-specific recombination, are known to contribute to the development of multidrug resistance among several Gram-negative bacteria. Integrons are frequently located on transmissible plasmids or transposons, which facilitate their transfer among bacterial populations [5]. Several reports have demonstrated that integrons play an important role in the carriage and spread of antibiotic resistance genes among bacteria [6–8]. Many different classes of integrons have been identified, however class 1 integrons are the most commonly found in antibiotic-resistant clinical isolates of Gram-negative bacteria including P. aeruginosa. Typically, a class
0924-8579/$ – see front matter © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
2
1 integron is composed of a 5 -conserved segment (5 CS) including an intI1 gene coding for a site-specific integrase, and a 3 CS including the qacE1 and sul1 genes encoding resistance to quaternary ammonium compounds and sulfonamides, respectively. Between 5 CS and 3 CS is found an internal variable region with one or more gene cassettes. Gene cassettes are mobile units composed of a gene, most often an antibiotic resistance gene, and a recombination site, the 59-base element. Several resistance gene cassettes, such as aminoglycoside-modifying enzymes (aac, aad and aphA) and extended spectrum -lactamases (bla), are associated with class 1 integrons in P. aeruginosa that confer resistance to antimicrobial agents [5]. Several studies have shown that integrons are associated with multidrug resistance in P. aeruginosa isolates [7–10]. Although resistance to antimicrobial agents in P. aeruginosa is common in Thailand, published reports on the prevalence of integrons in this organism are relatively limited. In 2002, the blaVEB-1 -carrying class 1 integron was found in ceftazidime-resistant P. aeruginosa isolates collected from a university hospital in Thailand [6]. Recently, the high prevalence of class 1 integrons with a variety of gene cassettes, including blaIMP-14 , blaIMP-15 and blaVIM-2 , in MDR-PA isolates from Thai hospitals has been reported [11,12]. In Buddhachinaraj Hospital (Phitsanulok, Thailand), clinical isolates of P. aeruginosa reveal a high frequency of multidrug resistance. We previously reported the presence of a blaIMP-1 -carrying class 1 integron in two carbapenemresistant P. aeruginosa isolates [13]. This has led to the speculation that there might be more antibiotic resistance genes that are associated with integrons among P. aeruginosa isolates in this hospital. Hence, this study was conducted to investigate the prevalence of class 1 integrons and their associated resistance gene cassettes of multiple antibiotic-resistant P. aeruginosa isolates. The genetic relationship among the integron-positive isolates was also determined. 2. Materials and methods 2.1. Bacterial isolates Between November 2007 and April 2008, 50 non-duplicate P. aeruginosa isolates were collected from various clinical materials at Buddhachinaraj Hospital, which is a 1000-bed teaching hospital in Phitsanulok, Northern Thailand. Isolates were recovered from hospitalised patients (sputum, 34; pus, 7; urine, 1; blood, 1; fluid, 1; wound, 2; and other, 4). Isolates were identified as P. aeruginosa using standard biochemical tests. All isolates were grown on Pseudomonas agar with C N selective supplement (Oxoid Ltd., Basingstoke, UK) throughout the study. 2.2. Antimicrobial susceptibility testing Susceptibility testing was performed by the disk diffusion method on Mueller–Hinton agar (Becton Dickinson and Co., Sparks, MD) and was interpreted in accordance with the recommendations of the Clinical and Laboratory Standards Institute (CLSI) [14]. Eighteen antibiotic discs from four classes of antimicrobial agents including -lactams (ticarcillin, ticarcillin/clavulanic acid, piperacillin, piperacillin/tazobactam, cefoperazone, cefotaxime, ceftriaxone, ceftazidime, cefepime, imipenem, meropenem, aztreonam), fluoroquinolones (ciprofloxacin, ofloxacin, levofloxacin), aminoglycosides (gentamicin, amikacin) and lipopeptide (colistin) were used. All antibiotic discs were purchased from Oxoid Ltd. Isolates showing intermediate results were considered to be resistant. Resistance patterns in P. aeruginosa isolates were classified according to the recently published proposed interim definitions [15]. An isolate was defined as MDR-PA if it was non-susceptible to at least one agent in three or more antipseudomonal antimicrobial
Table 1 Primer sequences used for PCR amplification of class 1 integrons. Primer
Sequence (5 → 3 )
Estimated product size (bp)
Reference
Int1F Int1R qacE1F qacE1R sul1F sul1R In5 CS In3 CS
GCATCCTCGGTTTTCTGG GGTGTGGCGGGCTTCGTG ATCGCAATAGTTGGCGAAGT CAAGCTTTTGCCCATGAAGC CTTCGATGAGAGCCGGCGGC GCAAGGCGGAAACCCGCGCC GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA
457
[16]
236
[17]
437
[17]
Variable
[18]
categories, and as extensively drug-resistant P. aeruginosa (XDRPA) if it was non-susceptible to at least one agent in all but two or less antipseudomonal antimicrobial categories. 2.3. Detection of integrons and gene cassettes All isolates were screened for the presence of class 1 integrons by PCR using specific primers located on an integrase gene, intI1 (Table 1). All of the intI1-positive isolates were investigated for the presence of typical 3 CS using primers for qacE1 and sul1 genes (Table 1). Amplification was performed in a 50 L mixture containing 10 M of each primer, 1.5 mM MgCl2 , 200 M dNTPs and 1 U Platinum Taq Polymerase together with its reaction buffer (Invitrogen, Carlsbad, CA). A portion of the bacterial colony was added to provide the DNA template. Cell lysis and DNA amplification were performed in a Hybaid PCR Sprint Thermal Cycler (Thermo Scientific, Basingstoke, UK) using the following conditions: initial denaturation at 94 ◦ C for 5 min, followed by 35 cycles of denaturation at 94 ◦ C for 1 min, annealing at 48 ◦ C for 45 s and extension at 72 ◦ C for 1 min, and a final extension at 72 ◦ C for 5 min. Class 1 integron variable regions were amplified using primers In5 CS and In3 CS (Table 1). PCR amplification was carried out as described above, with the exception that the PCR extension time was extended to 5 min. Amplicons were separated by agarose gel electrophoresis, stained with 0.5 g/mL ethidium bromide and visualised using an ultraviolet transilluminator (Gel Documentation Systems; Bio-Rad Laboratories Inc., Hercules, CA). 2.4. Restriction fragment length polymorphisms (RFLPs) PCR amplicons were digested by SmaI, EcoRI, SacI and HindIII restriction enzymes (Fermentas, Hanover, MD) and the products were analysed by agarose gel electrophoresis. Amplicons with identical digested profiles were considered to contain the same gene cassettes. One representative of each RFLP type was randomly selected for DNA sequencing. 2.5. DNA sequencing and analysis of sequence data Selected PCR products were analysed by DNA sequencing. The amplicons were purified using a DNA purification kit (GF-1 Nucleic Acid Extraction Kit; Vivantis Inc., Chino, CA) and were sent to a commercial facility for sequencing (First BASE Laboratories Sdn Bhd, Selangor, Malaysia). Sequences were compared with those available in the GenBank database using the BLAST algorithm available on the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov). 2.6. Pulsed-field gel electrophoresis (PFGE) Investigation of the genetic relationship among P. aeruginosa isolates was performed by PFGE according to Xiong et al. [19]. Briefly, isolates were grown overnight in Luria–Bertani broth
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
3
Table 2 Susceptibilities of 50 Pseudomonas aeruginosa isolates to 18 antimicrobial agents tested and their association with the presence of class 1 integrons. Antibiotic
TIC TIM PIP TZP CFP CTX CRO CAZ FEP IPM MEM ATM CIP OFX LEV GEN AMK COL
P. aeruginosa isolates (n = 50)
Integron-positive isolates (n = 41)
Integron-negative isolates (n = 9)
S (%)
R (%)
S (%)
R (%)
S (%)
R (%)a
6 (12.0) 1 (2.0) 15 (30.0) 40 (80.0) 3 (6.0) 0 (0) 0 (0) 6 (12.0) 2 (4.0) 4 (8.0) 0 (0) 5 (10.0) 5 (10.0) 4 (8.0) 4 (8.0) 9 (18.0) 19 (38.0) 50 (100)
44 (88.0) 49 (98.0) 35 (70.0) 10 (20.0) 47 (94.0) 50 (100) 50 (100) 44 (88.0) 48 (96.0) 46 (92.0) 50 (100) 45 (90.0) 45 (90.0) 46 (92.0) 46 (92.0) 41 (82.0) 31 (62.0) 0 (0)
0 (0) 0 (0) 9 (22.0) 35 (85.4) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 4 (9.8) 0 (0) 0 (0) 1 (2.4) 1 (2.4) 1 (2.4) 1 (2.4) 15 (36.6) 41(100)
41 (100) 41 (100) 32 (78.0) 6 (14.6) 41 (100) 41 (100) 41 (100) 41 (100) 41 (100) 37 (90.2) 41 (100) 41 (100) 40 (97.6) 40 (97.6) 40 (97.6) 40 (97.6) 26 (63.4) 0 (0)
6 (66.7) 1 (11.1) 6 (66.7) 5 (55.6) 3 (33.3) 0 (0) 0 (0) 6 (66.7) 2 (22.2) 0 (0) 0 (0) 5 (55.6) 4 (44.4) 3 (33.3) 3 (33.3) 8 (88.9) 8 (88.9) 9 (100)
3 (33.3) 8 (88.9) 3 (33.3) 4 (44.4) 6 (66.7) 9 (100) 9 (100) 3 (33.3) 7 (77.8) 9 (100) 9 (100) 4 (44.4) 5 (55.6) 6 (66.7) 6 (66.7) 1 (11.1) 1 (11.1) 0 (0)
S, susceptible; R, resistant (including intermediate isolates); TIC, ticarcillin; TIM, ticarcillin/clavulanic acid; PIP, piperacillin; TZP, piperacillin/tazobactam; CFP, cefoperazone; CTX, cefotaxime; CRO, ceftriaxone; CAZ, ceftazidime; FEP, cefepime; IPM, imipenem; MEM, meropenem; ATM, aztreonam; CIP, ciprofloxacin; OFX, ofloxacin; LEV, levofloxacin; GEN, gentamicin; AMK, amikacin; COL, colistin.
(Becton Dickinson and Co.) and the turbidity was adjusted to 1.3–1.4 at 625 nm. Cultures were then embedded in 2% lowmelting-point agarose. Embedded bacterial plugs were incubated with lysozyme in lysis solution [1 M NaCl, 0.1 M ethylene diamine tetra-acetic acid (EDTA), 10 mM Tris–HCl, 0.2% sodium deoxycholate and 0.5% sarkosyl] at 37 ◦ C for 1 h and 15 U/mg proteinase K in ES solution (0.25 M EDTA pH 8.0 and 1% sarkosyl) at 50 ◦ C for 24 h. Chromosomal DNA was digested with SpeI (Fermentas) at 37 ◦ C for 16 h. DNA was electrophoresed through 1% Pulsed Field Certified agarose in 0.5× TBE (Tris–borate–EDTA) running buffer using a CHEF Mapper® XA System (Bio-Rad Laboratories). Saccharomyces cerevisiae chromosomal DNA (Bio-Rad Laboratories) was used as a molecular size standard. Banding patterns were interpreted by visual inspection of a photograph of the ethidium bromide-stained gel and were classified in accordance with the criteria defined by Tenover et al. [20]. PFGE patterns were designated by a capital letter. Isolates with indistinguishable banding patterns were assigned to the same PFGE pattern. When there was a difference of one to three bands, the isolates were classified as a subtype, which was designated with the same capital letter used for the major type, followed by an Arabic number (e.g. A1, A2, etc.). 3. Results 3.1. Antimicrobial susceptibility of Pseudomonas aeruginosa isolates
for class 1 integrons by amplifying the intI1 gene. All intI1-carrying isolates were also positive for qacE1 and sul1 genes, which are the key signatures for the class 1 integrons, as determined by PCR and sequencing (results not shown). The 41 P. aeruginosa isolates that were positive for intI1 were further analysed for the class 1 integron variable regions by PCR. PCR amplification of class 1 integrons showed several diverse bands ranging in size from 0.7 kb to 7.0 kb. According to the number and size of PCR products, seven different integron profiles (IPs) were observed (Fig. 1; Table 3). Thirty-one isolates carried a single class 1 integron with different-sized variable regions (IP1, IP3, IP5, IP6 and IP7). Ten isolates carried two or more distinct variable regions (IP2 and IP4). PCR-RFLP demonstrated that the variable regions of amplicons with the same size had the same DNA pattern, suggesting that the arrangement of gene cassettes of these PCR amplicons was identical (results not shown). Nucleotide sequence analysis of the class 1 integron variable regions revealed the presence of several gene cassettes (Table 3). The smallest integron (0.7 kb) carried a single aadB gene, whilst the 1.4 kb integron contained aacA7–aacA7 gene cassettes. Most isolates (25/41; 61.0%) had an aadA6–orfD cassette array (1.3 kb integron). When the 2.0 kb, 2.6 kb and 3.0 kb integrons were sequenced, the gene cassettes identified included blaPSE-1 –aadA2, aac-(3)-Ic–smr–cmlA5 and aadB–cmlA6–aadA15, respectively. The largest amplicon of 7.0 kb was found in only one isolate and
All 50 P. aeruginosa isolates were tested for their susceptibility to 18 antimicrobial agents. The percentages of susceptible and resistant isolates are shown in Table 2. All isolates were resistant to cefotaxime, ceftriaxone and meropenem. These isolates also exhibited resistance to ticarcillin, ticarcillin/clavulanic acid, piperacillin, cefoperazone, ceftazidime, cefepime, imipenem, aztreonam, ciprofloxacin, ofloxacin, levofloxacin, gentamicin and amikacin (62–98%). A low resistance rate was observed to piperacillin/tazobactam (20%). All isolates remained susceptible to colistin. Forty-nine isolates and one isolate were classified as XDRPA and MDR-PA, respectively. 3.2. Integrons and characterisation of gene cassettes All P. aeruginosa isolates were investigated for the presence of class 1 integrons by PCR. Of the 50 isolates, 41 (82%) were positive
Fig. 1. PCR amplification products of class 1 integron variable regions using primers In5 CS and In3 CS. M, 1 kb plus ladder (Fermentas, Hanover, MD); lanes 1–7, integron profiles 1–7 from extensively drug-resistant Pseudomonas aeruginosa isolates, respectively.
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
ARTICLE IN PRESS
G Model ANTAGE-4115; No. of Pages 6
A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
4
Table 3 Integron profiles (IPs) and pulsed-field gel electrophoresis (PFGE) patterns found in extensively drug-resistant Pseudomonas aeruginosa (XDR-PA) isolates. IP
No. of isolates (N = 41)
1 2
2 5
3 4
25 5
5 6 7 a b
2a 1 1
Approximate size of integron (bp)
Gene cassette array
PFGE patterns (no. of isolates)
0.7 0.7 1.4 2.6 1.3 1.4 2.6 2.0 3.0 7.0
aadB aadB aacA7–aacA7b aac(3)-Ic–smr–cmlA5b aadA6–orfD aacA7–aacA7 aac(3)-Ic–smr–cmlA5b blaPSE-1 –aadA2 aadB–cmlA6–aadA15b tnpA–blaVEB-2 –aadB–arr-2–cmlA5–blaOXA-10 –aadA1
G (2) A1 (1), A2 (1), A3 (1), A4 (2)
B2 (25) B1 (1), C1 (2), C2 (1), E (1) H (1), I (1) F (1) D (1)
One isolate was classified as multidrug-resistant P. aeruginosa. Gene cassette arrays identified for the first time.
Fig. 2. Representative DNA macrorestriction profiles of the extensively drugresistant Pseudomonas aeruginosa (XDR-PA) isolates. Chromosomal DNA was prepared and digested with SpeI (Fermentas, Hanover, MD) and was subjected to pulsed-field gel electrophoresis (PFGE). M, Saccharomyces cerevisiae chromosomal DNA (Bio-Rad Laboratories Inc., Hercules, CA); lanes 1–25, 25 XDR-PA isolates carrying aadA6–orfD cassette array (PFGE pattern B2).
contained the tnpA–blaVEB-2 –aadB–arr-2–cmlA5–blaOXA-10 –aadA1 array. 3.3. Antimicrobial susceptibility of integron-positive and -negative Pseudomonas aeruginosa isolates Comparison of antimicrobial susceptibility among P. aeruginosa isolates revealed that the integron-positive isolates had higher frequencies of resistance to 12 antimicrobial agents tested, including ticarcillin, ticarcillin/clavulanic acid, piperacillin, cefoperazone, ceftazidime, cefepime, aztreonam, ciprofloxacin, ofloxacin, levofloxacin, gentamicin and amikacin (Table 2). In addition, the integron-carrying isolates showed resistance to multiple antimicrobial classes whose resistant genes were not encoded in the class 1 integrons. 3.4. Pulsed-field gel electrophoresis analysis To determine the genetic relationships between the integroncarrying P. aeruginosa isolates, PFGE was performed. PFGE patterns obtained after SpeI digestion revealed the presence of nine patterns (A–I) (Table 3). The predominant clone, represented by 25 (61.0%) of the 41 isolates, belonged to pattern B2 (Fig. 2). Interestingly, most XDR-PA isolates that harboured the same integron showed an identical PFGE pattern as follows: IP1-carrying isolates (PFGE pattern G); IP2-carrying isolates (PFGE pattern A4); IP3-carrying isolates (PFGE pattern B2); and IP4-carrying isolates (PFGE pattern C1). In addition, isolates that shared the same IP exhibited different PFGE patterns, such as those carrying IP2, IP4 or IP5. 4. Discussion The emergence of multiresistant clinical isolates of P. aeruginosa is increasingly reported and has become an emerging challenge
to healthcare workers. In this study, the majority of isolates were resistant to several antimicrobial agents tested, consistent with those previously reported from Thailand [4,11,12]. All isolates but one were considered as XDR-PA, which may lead to difficulty in the treatment of P. aeruginosa infection. The exceptionally high rate of XDR-PA found in this work could be due to the frequent and inappropriate use of antibiotics in Thailand [21]. However, all isolates remained susceptible to colistin, which has been shown to be a safe and effective treatment of infection caused by multiresistant P. aeruginosa in Thai patients [22]. Class 1 integrons have been associated with various antibiotic resistance genes and constituted an important role in the development of antimicrobial resistance. In this study, the presence of typical class 1 integrons was detected in 41 isolates (82%), indicating a high prevalence of class 1 integrons in antibiotic-resistant P. aeruginosa isolates in this hospital. Of these, 40 isolates were XDRPA and 1 isolate was classified as MDR-PA (Table 3). This result is slightly higher than that recently reported from Thailand, in which class 1 integrons were detected in 69.3% of P. aeruginosa isolates collected from the largest university hospital in Bangkok [12]. However, this figure is much higher compared with early reports of P. aeruginosa isolates carrying class 1 integrons, such as 38–40.8% in China [9,10,23], 44% in the Czech Republic [7], 46.4% in Spain [24] and 60% in Malaysia [25]. In this study, seven different profiles of class 1 integrons were detected. Nucleotide sequence analysis of class 1 integron variable regions revealed the presence of several gene cassettes associated with resistance to a variety of aminoglycosides (aac, aad and aph), chloramphenicol (cmlA), -lactams (blaPSE , blaOXA and blaVEB ) and rifampicin (arr). The putative small multidrug resistance protein (smr) and an open-reading frame with unknown function (orfD) were also detected. The aadA6–orfD cassette array (1.3 kb) was the most prevalent integron in XDR-PA isolates in this study. It was also the most prevalent gene cassette array in P. aeruginosa in Nanjing, China [9] and has been detected in P. aeruginosa from other countries including Thailand [12,26]. The gene cassettes identified in this study were not novel. Four cassette arrays (aadB, aadA6–orfD, blaPSE-1 –aadA2 and tnpA–blaVEB-2 –aadB–arr2–cmlA5–blaOXA-10 –aadA1) were previously found in clinical isolates of Gram-negative bacteria, including MDR-PA, in Thailand [6,12,27]. According to the database in GenBank, the organisations of three cassette arrays (aacA7–aacA7, aac(3)-Ic–smr–cmlA5 and aadB–cmlA6–aadA15) were detected for the first time. Association between aac, aad, aph, bla, cmlA and arr genes and class 1 integrons in P. aeruginosa has frequently been described [6–10,23,24,26]. However, the presence of aac(3)-Ic is interesting. This gene encodes for the aminoglycoside 3-N-acetyltransferase, which confers resistance to gentamicin. According to previously published studies, there have been few reports on the aac(3)-Ic gene. One was the first detection of this gene, which resided as a gene cassette in a
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
class 1 integron, from a MDR-PA isolate from Italy in 2003 [28]. Later, it was found, also as a gene cassette in a class 1 integron, in P. aeruginosa from Turkey, Australia and Malaysia [8,29,30]. To our knowledge, this is the first detection of aac(3)-Ic in Thailand. In addition, the arrangement of the class 1 integron containing aac(3)Ic found in this study [aac(3)-Ic–smr–cmlA5] was similar to that found in Turkey, Australia and Malaysia [aac(3)-Ic–cmlA5]; only one additional smr gene was found. It is possible that the new cassette array could be formed by capturing the smr gene and integrating it into the aac(3)-Ic–cmlA5 array. The presence of aac(3)-Ic in 10 XDRPA isolates in this study (Table 3) is of concern and suggests the international spread of this gene, possibly by means of travelling. Multiresistance does not necessarily correlate with integron presence. This observation may be explained by the fact that nine P. aeruginosa isolates lacking class 1 integrons showed the XDR phenotype. Furthermore, many isolates exhibited resistance to antimicrobial agents whose resistant genes are not part of gene cassettes within the integrons. For instance, resistance to carbapenems is often caused by production of metallo--lactamases (MBLs), and the MBL genes are frequently located as gene cassettes in class 1 integrons [5]. In this study, all isolates were resistant to carbapenems, however no MBL genes were detected. Therefore, resistance to carbapenems may have resulted from other mechanisms such as decreased permeability or efflux pump overexpression [1]. To determine whether the P. aeruginosa isolates carrying the same IP were due to the spread of a single clone, all isolates were genotyped by PFGE. Identical integron cassettes were detected in clonally unrelated isolates such as those carrying IP4 or IP5, suggesting the occurrence of horizontal transfer of integrons. Interestingly, most XDR-PA isolates that harboured the same integron were clonally related, particularly IP3-carrying isolates. The apparent nosocomial spread of XDR-PA isolates suggests that there are inadequate infection control practices within the hospital. In conclusion, the presence of class 1 integrons harbouring different gene cassette arrays was found in a large number of XDR-PA isolates in a regional Thai hospital. Since integrons play an important role in the uptake and dissemination of resistance genes, we therefore suggest that resistant surveillance including screening for class 1 integrons might be necessary to control the spread of drug-resistant organisms. Furthermore, nosocomial spread of class 1 integron-carrying XDR-PA isolates was clearly evident. These results emphasise the need for the application of strict prevention strategies, including rigorous infection control and restricted use of antimicrobial agents, within the hospital.
[3]
[4]
[5] [6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
Acknowledgments [21]
The authors are grateful to the staff of the Clinical Pathology Department at Buddhachinaraj Hospital (Phitsanulok, Thailand) for their help in collection of P. aeruginosa isolates. The authors would like to thank staff at the Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University (Phitsanulok) for their technical assistance. Funding: This study was supported by the National Research Council of Thailand through the Annual Research Fund of Naresuan University. Competing interests: None declared. Ethical approval: Not required.
[22]
[23]
[24]
[25]
[26]
References ˜ C, Hancock RE. Pseudomonas aeruginosa: [1] Breidenstein EB, de la Fuente-Núnez all roads lead to resistance. Trends Microbiol 2011;19:419–26. [2] Dejsirilert S, Suankratay C, Trakulsomboon S, Thongmali O, Sawanpanyalert P, Aswapokee N, et al. National Antimicrobial Resistance Surveillance, Thailand
[27]
5
(NARST) data among clinical isolates of Pseudomonas aeruginosa in Thailand from 2000 to 2005. J Med Assoc Thai 2009;92(Suppl.):S68–75. Kiratisin P, Chongthaleong A, Tan TY, Lagamayo E, Roberts S, Garcia J, et al. Comparative in vitro activity of carbapenems against major Gram-negative pathogens: results of Asia-Pacific surveillance from the COMPACT II study. Int J Antimicrob Agents 2012;39:311–16. Khuntayaporn P, Montakantikul P, Mootsikapun P, Thamlikitkul V, Chomnawang MT. Prevalence and genotypic relatedness of carbapenem resistance among multidrug-resistant Pseudomonas aeruginosa in tertiary hospitals across Thailand. Ann Clin Microbiol Antimicrob 2012;11:25. Partridge SR, Tsafnat G, Coiera E, Iredell JR. Gene cassettes and cassette arrays in mobile resistance integrons. FEMS Microbiol Rev 2009;33:757–84. Girlich D, Naas T, Leelaporn A, Poirel L, Fennewald M, Nordmann P. Nosocomial spread of the integron-located veb-1-like cassette encoding an extendedspectrum -lactamase in Pseudomonas aeruginosa in Thailand. Clin Infect Dis 2002;34:603–11. Nemec A, Krizova L, Maixnerova M, Musilek M. Multidrug-resistant epidemic clones among bloodstream isolates of Pseudomonas aeruginosa in the Czech Republic. Res Microbiol 2010;161:234–42. Kor SB, Choo QC, Chew CH. New integron gene arrays from multiresistant clinical isolates of Enterobacteriaceae and Pseudomonas aeruginosa from hospitals in Malaysia. J Med Microbiol 2013;62:412–20. Gu B, Tong M, Zhao W, Liu G, Ning M, Pan S, et al. Prevalence and characterization of class 1 integrons among Pseudomonas aeruginosa and Acinetobacter baumannii isolates from patients in Nanjing, China. J Clin Microbiol 2007;45:241–3. Chen J, Su Z, Liu Y, Wang S, Dai X, Li Y, et al. Identification and characterization of class 1 integrons among Pseudomonas aeruginosa isolates from patients in Zhenjiang, China. Int J Infect Dis 2009;13:717–21. Piyakul C, Tiyawisutsri R, Boonbumrung K. Emergence of metallo--lactamase IMP-14 and VIM-2 in Pseudomonas aeruginosa clinical isolates from a tertiarylevel hospital in Thailand. Epidemiol Infect 2012;140:539–41. Poonsuk K, Tribuddharat C, Chuanchuen R. Class 1 integrons in Pseudomonas aeruginosa and Acinetobacter baumannii isolated from clinical isolates. Southeast Asian J Trop Med Public Health 2012;43:376–84. Boonkerd N, Pibalpakdi P, Tiloklurs M, Niumsup PR. Class 1 integron containing metallo--lactamase gene blaIMP-1 in carbapenem-resistant Pseudomonas aeruginosa in Thailand. J Infect Chemother 2009;15:257–61. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; seventeenth informational supplement. Document M100-S17. Wayne, PA: CLSI; 2007. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect 2012;18:268–81. Shibata N, Doi Y, Yamane K, Yagi T, Kurokawa H, Shibayama K, et al. PCR typing of genetic determinants for metallo--lactamases and integrases carried by Gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol 2003;41:5407–13. Di Conza J, Ayala JA, Power P, Mollerach M, Gutkind G. Novel class 1 integron (InS21) carrying blaCTX-M-2 in Salmonella enterica serovar Infantis. Antimicrob Agents Chemother 2002;46:2257–61. Lévesque C, Piché L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995;39:185–91. Xiong Z, Zhu D, Wang F, Zhang Y, Okamoto R, Inoue M. Investigation of extended-spectrum -lactamase in Klebsiellae pneumoniae and Escherichia coli from China. Diagn Microbiol Infect Dis 2002;44:195–200. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsedfield gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. Rattanaumpawan P, Sutha P, Thamlikitkul V. Effectiveness of drug use evaluation and antibiotic authorization on patients’ clinical outcomes, antibiotic consumption, and antibiotic expenditures. Am J Infect Control 2010;38: 38–43. Koomanachai P, Tiengrim S, Kiratisin P, Thamlikitkul V. Efficacy and safety of colistin (colistimethate sodium) for therapy of infections caused by multidrugresistant Pseudomonas aeruginosa and Acinetobacter baumannii in Siriraj Hospital, Bangkok, Thailand. Int J Infect Dis 2007;11:402–6. Xu H, Su Z, Wang S, Dai X, Chen J, Kong F, et al. Four novel resistance integron gene-cassette occurrences in bacterial isolates from Zhenjiang, China. Curr Microbiol 2009;59:113–17. ˜ M. Class Ruiz-Martínez L, López-Jiménez L, Fusté E, Vinuesa T, Martínez JP, Vinas 1 integrons in environmental and clinical isolates of Pseudomonas aeruginosa. Int J Antimicrob Agents 2011;38:398–402. Khosravi Y, Tay ST, Vadivelu J. Analysis of integrons and associated gene cassettes of metallo--lactamase-positive Pseudomonas aeruginosa in Malaysia. J Med Microbiol 2011;60:988–94. Shahcheraghi F, Badmasti F, Feizabadi MM. Molecular characterization of class 1 integrons in MDR Pseudomonas aeruginosa isolated from clinical settings in Iran, Tehran. FEMS Immunol Med Microbiol 2010;58:421–5. Dalsgaard A, Forslund A, Serichantalergs O, Sandvang D. Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand. Antimicrob Agents Chemother 2000;44: 1315–21.
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009
G Model ANTAGE-4115; No. of Pages 6 6
ARTICLE IN PRESS A. Kiddee et al. / International Journal of Antimicrobial Agents xxx (2013) xxx–xxx
[28] Riccio ML, Docquier JD, Dell’Amico E, Luzzaro F, Amicosante G, Rossolini GM. Novel 3-N-aminoglycoside acetyltransferase gene, aac(3)-Ic, from a Pseudomonas aeruginosa integron. Antimicrob Agents Chemother 2003;47: 1746–8. [29] Ozgumus OB, Caylan R, Tosun I, Sandalli C, Aydin K, Koksal I. Molecular epidemiology of clinical Pseudomonas aeruginosa isolates carrying IMP-1
metallo--lactamase gene in a university hospital in Turkey. Microb Drug Resist 2007;13:191–8. [30] Roy Chowdhury P, Merlino J, Labbate M, Cheong EY, Gottlieb T, Stokes HW. Tn6060, a transposon from a genomic island in a Pseudomonas aeruginosa clinical isolate that includes two class 1 integrons. Antimicrob Agents Chemother 2009;53:5294–6.
Please cite this article in press as: Kiddee A, et al. Nosocomial spread of class 1 integron-carrying extensively drug-resistant Pseudomonas aeruginosa isolates in a Thai hospital. Int J Antimicrob Agents (2013), http://dx.doi.org/10.1016/j.ijantimicag.2013.05.009