Novel amplification targets for rapid detection and differentiation of Xylella fastidiosa subspecies fastidiosa and multiplex in plant and insect tissues

Journal of Microbiological Methods 155 (2018) 8–18

Contents lists available at ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

Novel amplification targets for rapid detection and differentiation of Xylella fastidiosa subspecies fastidiosa and multiplex in plant and insect tissues

T

⁎

Lindsey P. Burbank , Brandon C. Ortega Agricultural Research Service, United States Department of Agriculture, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave, Parlier, CA 936489757, USA

A R T I C LE I N FO

A B S T R A C T

Keywords: Xylella fastidiosa TaqMan LAMP Subspecies identification

Xylella fastidiosa is an insect-transmitted bacterial plant pathogen which causes a variety of economically important diseases worldwide. Molecular identification of X. fastidiosa is used for quarantine screening, surveillance, and research applications; many of which require subspecies level differentiation of pathogen isolates. This study describes quantitative PCR (qPCR) and isothermal amplification assays which can rapidly identify X. fastidiosa isolates belonging to the fastidiosa and multiplex subspecies. The TaqMan qPCR primers described here are used to differentiate X. fastidiosa strains by subspecies in plant and insect tissue in a single reaction, with the inclusion of a general amplification control probe to identify potential false negative samples. This TaqMan qPCR protocol can identify between 103 and 104 cfu/ml concentrations of X. fastidiosa at the subspecies level in a variety of sample types. Additionally, loop-mediated isothermal amplification (LAMP) targets were designed for faster detection of X. fastidiosa subspecies fastidiosa and multiplex, applicable to a field setting. These assays are effective for strain differentiation in artificially and naturally inoculated plant material, and in field collected insect vectors.

1. Introduction The bacterial pathogen Xylella fastidiosa infects hundreds of plant species, and is the cause of several devastating epidemics both in the United States and worldwide (Almeida and Nunney, 2015; Bucci, 2018; Hopkins and Purcell, 2002; Rapicavoli et al., 2018; Sicard et al., 2018). Four different subspecies of X. fastidiosa (subspecies fastidiosa, multiplex, pauca and sandyii) have been well characterized based on host range and sequence analysis (Schaad et al., 2004; Schuenzel et al., 2005). Two additional subspecies (morus and tashke) have been proposed, but not well studied to date (Bucci, 2018; Nunney et al., 2014; Randall et al., 2009). Strains of X. fastidiosa subsp. multiplex are believed to be native to North America, and are known for causing leaf scorch diseases of hardwood trees and ornamental plants, in addition to infecting peach, almond, and blueberry crops (Hernandez-Martinez et al., 2007; Schuenzel et al., 2005). The first report of subspecies fastidiosa, causing Pierce's disease of grapes in California was in the 1880s, and the problem has persisted ever since with significant impacts on the wine and table grape industries (Nunney et al., 2010; Pierce, 1892; Tumber et al., 2014). Pierce's disease also is widespread across the southern United States, limiting the cultivation of susceptible Vitis vinifera in these areas (Hopkins and Purcell, 2002). Subspecies sandyii, is mainly found in

⁎

oleander, causing leaf scorch and dieback in ornamental plantings (Schuenzel et al., 2005). Although not present in North America, X. fastidiosa subsp. pauca has had serious agricultural impacts worldwide, both as a pathogen of citrus and coffee in South America, and more recently as the cause of olive quick decline syndrome in Italy (Lee et al., 1993; Saponari et al., 2017). Additional recent introductions of X. fastidiosa in Europe have led to restrictive quarantine regulations on imported plant material, and increased surveillance for X. fastidiosa globally (Denancé et al., 2017; Loconsole et al., 2016; Olmo et al., 2017). Testing of imported ornamental plants in Europe revealed the presence of several different X. fastidiosa subspecies and sequence types carried by a single host plant species (Coffea arabica) (Bergsma-Vlami et al., 2017), as well as evidence for new recombinant sequence types (Jacques et al., 2016). These recent introductions and interceptions highlight the importance of molecular identification of X. fastidiosa strains in a variety of settings. Molecular detection methods for X. fastidiosa including a range of PCR and isothermal amplification techniques have been developed for research and quarantine applications (Baldi and La Porta, 2017). However, many of these methods do not differentiate between subspecies of the pathogen (Francis et al., 2006; Harper et al., 2010; Harper et al., 2013; Hernandez-Martinez et al., 2006; Minsavage et al., 1994),

Corresponding author. E-mail address: [email protected] (L.P. Burbank).

https://doi.org/10.1016/j.mimet.2018.11.002 Received 17 August 2018; Received in revised form 29 October 2018; Accepted 3 November 2018 Available online 05 November 2018 0167-7012/ Published by Elsevier B.V.

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

similar bacterial genomes (Thomsen et al., 2017). Sequence target analysis was run with either four (subspecies fastidiosa) or five (subspecies multiplex) published genomes as the positive set, and the alternate subspecies genome set as exclusion criteria. Three strains from subspecies pauca were included in the exclusion set of genomes for both fastidiosa and multiplex targets to increase specificity. TaqMan PCR primer and probe sequences were generated directly in the RUCS output files (Primer3 option) (Thomsen et al., 2017). For LAMP targets, 300–800 base pair sequence regions identified as distinctive were taken from the RUCS output files and used as template for LAMP primer design with PrimerExplorer software (Eiken Genome). All primer and probe sequences are listed in Table 2. Alignment of DNA target regions and primer binding sites is shown in Fig. 1 (qPCR targets) and Fig. 2 (LAMP targets). Target sequences in FASTA format are provided in Supplemental Fig. S1. In qPCR assays, previously described primers and probe targeting the eukaryotic 18S gene (Ioos et al., 2012) were incorporated as an internal control (Table 2).

or rely on small genetic differences in known genes (Rodrigues et al., 2003). Multi-locus sequence typing continues to be the gold standard for X. fastidiosa identification down to the subspecies level (Nunney et al., 2012; Scally et al., 2005; Yuan et al., 2010), but this method is not realistic for largescale screening scenarios. Subspecies-specific qPCR detection targets have been developed for oleander leaf scorch strains (subspecies sandyii) (Guan et al., 2013) and for strains causing citrus variegated chlorosis (subspecies pauca) (Li et al., 2013). In areas such as California, subspecies fastidiosa and multiplex are found in agricultural settings, often in close proximity (Chen et al., 2005). However, reliable and high throughput molecular assays that differentiate subspecies multiplex and fastidiosa are not currently available. Isothermal amplification methods such as LAMP (Notomi et al., 2000) have gained popularity for molecular detection of pathogens, in part because of reduced equipment and technical requirements that make field application more feasible. Protocols for general (non-subspecies specific) detection of X. fastidiosa using LAMP have been developed and deployed in the field for real-time testing of plant and insect samples in outbreak regions (Harper et al., 2010, Yaseen et al., 2015). LAMP protocols for subspecies identification will further advance the ability to rapidly screen for new X. fastidiosa outbreaks in the field. This study describes a multiplex TaqMan PCR assay for sensitive detection and differentiation of X. fastidiosa subspecies fastidiosa and multiplex in a single reaction, with the inclusion of an internal control probe to reduce the rate of false negative results. In addition, subspecies-specific LAMP assays were developed with potential to be adapted for rapid testing in a field setting.

2.2. Bacterial, plant, and insect sample sources and DNA extraction procedures For optimization of PCR and LAMP assays, subspecies fastidiosa and multiplex strains were grown in pure culture using PD3 medium (Davis et al., 1981) at 28 °C. Bacterial genomic DNA was extracted after 5–7 days of growth using DNeasy Blood and Tissue Kit (Qiagen) following the manufacturer's instructions. Bacterial cells were harvested off PD3 plates and suspended in 1XPBS at a concentration of OD600 = 0.2–0.5. One ml of this cell suspension was centrifuged at 9000 rpm for 5 min and entire cell pellet was used for DNA extraction. Uninfected plant material was obtained from greenhouse-grown grapevines (Vitis vinifera cv. Chardonnay) and almonds (Prunus dulcis cv. Butte). From grapes, three petioles were collected from each vine and combined in a single DNA extraction. From almonds, three mature leaves were collected from each plant and the midribs were excised and used for DNA extraction. Fresh plant tissue was ground in extraction buffer (20 mM EDTA, 350 mM sorbitol, 100 mM Tris-HCl, 2.5% polyvinylpyrrolidone) and total DNA was obtained using CTAB lysis buffer

2. Materials and methods 2.1. Identification of unique sequences and primer design for PCR and LAMP targets All bacterial genomes used for target design are listed in Table 1. Subspecies specific target sequences were selected using RUCS, a program developed for identifying unique genomic regions in highly

Fig. 1. TaqMan PCR primer binding targets. Consensus sequence of A) XFF (subspecies fastidiosa) TaqMan target region with primer binding sites, and B) XFM (subspecies multiplex) TaqMan target region with primer binding sites. Sequence alignments were conducted with Clustal Omega (Sievers et al., 2011) and images were created with BoxShade (Hoffman and Baron, 2014). 9

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

Fig. 2. LAMP targets and primer binding sites. Consensus sequences of A) XFF LAMP target (subspecies fastidiosa) B) XFM LAMP target (subspecies multiplex) with primer binding sites. Sequence alignments were performed using Clustal Omega (51) and images were created using BoxShade (52).

10

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

Table 1 Bacterial genome sequences used for target design. Strain

Primary host

Location

Subspecies target group

Reference

Temecula 1 Stag's Leap M23 GB514 M12 Dixon BB08–1 Griffin-1 Sy-VA 9a5c J1a12 De Donno

Grape Grape Almond Grape Almond Almond Blueberry Oak Sycamore Citrus Citrus Olive

California, USA California, USA California, USA Texas, USA California, USA California, USA Florida, USA Georgia, USA Virginia, USA Brazil Brazil Italy

fastidiosa fastidiosa fastidiosa fastidiosa multiplex multiplex multiplex multiplex multiplex pauca⁎ pauca⁎ pauca⁎

(Van Sluys et al., 2003) (Chen et al., 2016) (Chen et al., 2010) (Schreiber et al., 2010) (Chen et al., 2010) (Hendson et al., 2001) (Oliver et al., 2015) (Chen et al., 2013) (Guan et al., 2014) (Simpson et al., 2000) (Monteiro et al., 2001) (Giampetruzzi et al., 2017)

⁎

Strains characterized as subspecies pauca which are not found in North America were included in the exclusion criteria for both target groups.

2.4. Optimization of TaqMan PCR conditions

(50 mM EDTA, 2 M NaCl, 2%CTAB, 200 mM Tris-HCl) followed by two extractions, the first with chloroform:isoamyl alcohol (24:1) and the second with phenol:chloroform:isoamyl alcohol (25:24:1). Following chemical extraction, nucleic acid was precipitated with isopropanol, washed two times with 70%, and resuspended in sterile dH2O. Uninfected insects came from a laboratory-reared colony of glassywinged sharpshooters (GWSS). All insect samples were stored at −20 °C and dissected prior to DNA extraction to utilize only the part of the head containing the cibarium and precibarium (where X. fastidiosa would be found if present), and to reduce PCR inhibitors in the sample. Total DNA was extracted from insects using a DNeasy Blood and Tissue Kit (Qiagen) after grinding in liquid nitrogen. Infected plant material was obtained from artificially inoculated grapevines and almonds, and from naturally infected grapevines collected from Kern County, California. Field collected GWSS came from the same vineyards in Kern County, California where infected grape samples were obtained.

TaqMan PCR was performed using Taq DNA polymerase core kit (Qiagen) with 2.5 mM MgCl2, 400 μM dNTPs, 0.4 μM primers, and 0.3 μM probes in a 25 μl reaction (Supplemental Fig. S2). For PCR optimization, template DNA was quantified using a Nanodrop spectrophotometer and template DNA dilutions ranging from 100 ng-1 pg were used to assess reaction efficiency (Fig. 3). For multiplex assay optimization, equal quantities of DNA from X. fastidiosa Stag's Leap, Dixon, and clean plant or insect samples were combined prior to making the dilution series. Amplification and fluorescence detection were performed on a BioRad CFX96 thermocycler with an initial melting step of 94 °C for 5 min followed by 40 cycles of 94 °C for 20 s, 60 °C for 30 s (plate read step), and 72 °C for 30 s. The above conditions were chosen based the highest PCR efficiency out of all the reaction conditions tested. During optimization, primer concentrations of 0.1-1 μM and probe concentrations of 0.05–0.5 μM were tested across a range of annealing temperatures from 58 to 65 °C.

2.3. Plant inoculations and sampling procedures

2.5. LAMP reaction conditions

One-year-old grapevines (Vitis vinifera cv Chardonnay) were grown in two-gallon pots in a temperature-controlled greenhouse. Grapevines were pruned to a single cane, and maintained at 10 h of light, 14 h dark throughout the inoculation and disease process. For inoculation, X. fastidiosa Stag's Leap was grown for 5 days on PD3 medium and harvested in 1XPBS. Inoculum was normalized to OD600 = 0.25 (approximately 1 × 108 cfu/ml). Plants were inoculated using a pinprick method, where two 25 μl drops were placed on the side of the grapevine stem and the stem was pierced through the drops with a 20-gauge needle to allow the inoculum to be taken up into the xylem. Plants were inoculated in early June and sampled for testing 12 weeks later when symptoms were present. Sampling consisted of taking three petioles from each plant, one from 6 in. above the inoculation point, one from halfway up the cane, and one from the top of the cane. Petioles from a single vine were pooled for DNA extraction and testing. Almond seedlings were grown in 5-gal tree pots under the same growth conditions and inoculated with X. fastidiosa Dixon using the same method described above. For sampling, three leaves where selected from different parts of the plant and the midvein of the leaf was excised using a sterile razor blade. Samples from a single plant were pooled together for DNA extraction and testing. Naturally infected grapevines were sampled in late August in Kern County, CA when Pierce's disease symptoms were visible. For each plant sampled, three petioles were collected from different locations on vine the exhibited scorching symptoms. Samples from a single vine were pooled for DNA extraction and testing. Presence of X. fastidiosa in field grapevines was confirmed by isolating the bacterium from the same vines that were sampled.

Fluorescent LAMP assays were performed using a WarmStart LAMP assay kit (New England Biolabs) with 5–10 ng of template DNA. Fluorescence was detected using a BioRad CFX96 thermocycler using FAM channel over the course of 30 min at 65 °C (Fig. 4A). Colorimetric LAMP assays were performed using the Colorimetric LAMP assay kit (New England Biolabs) with 5–10 ng template DNA. Colorimetric assays were incubated at 65 °C for 30 min, and a positive reaction was indicated by a color change from pink to yellow (Fig. 4B). During initial optimization LAMP assays were run up to 60 min, but positive or negative results did not change after extended incubation. Primer concentrations for all LAMP assays were as follows: 1.6 μM FIP and BIP primers, 0.4 μM LF and LB primers, 0.2 μM F3 and B3 primers, based on LAMP kit recommendations. 2.6. Preparation of X. fastidiosa quantification standards For quantification of X. fastidiosa in unknown samples and for calculation of detection limits, standards were prepared using DNA from known quantities of X. fastidiosa cells. Cells of X. fastidiosa Stag's Leap (subspecies fastidiosa) and Dixon (subspecies multiplex) were grown for 5–7 days on PD3 plates at 28 °C and harvested with 1XPBS. Cells were then resuspended at a concentration of OD600 = 0.25 corresponding to 108 cfu/ml. Cell concentration correlation with optical density readings was initially confirmed by dilution plating. One ml of 108 cfu/ml cell suspension was used for DNA extraction and then diluted to make a range of standard concentrations from 107 to 102 cfu/ml. For mixed standards, equal volumes of Stag's Leap, Dixon, and plant or insect DNA preps were combined prior to dilution. 11

Sequence

TCAACGTGCAGAGATCAGAGG CGCAACTACATCAGTCAAGCG FAM-ACCCATGGCCCAAGACAGCTCGGA-BHQ1 TCAAACGACAACCATGCAACC GAGGGAAAAACCACCAATCGG HEX-TTGGGGCAACACCGTTGACACCGT-BHQ1 GCAAGGCTGAAACTTAAAGGAA CCACCACCCATAGAATCAAGA Cy5-ACGGAAGGGCACCACCAGGAGT-BHQ-2 CACGGCTGGTAACGGAAGA GGGTTGCGTGGTGAAATCAAG FAM -TCGCATCCCGTGGCTCAGTCC-BHQ-1 CGGAACTTCCGAGGAGCA TGATGTGGTTTCCCAAGCAG GCTCTTGTAGTCGTTCCCCCGAAGATTCTCCGCTTCTGCC ACTTCACAGAGCTGTGTTGGCCTGGGTGGTGGCTATGTAGC GCAAGCGCCAGCACGTT TGGACGAAAAAGCACTTCGTCTG CCTGTTGCAAGTGCCTGTT ACTGCCCTGGTAGGGGATA ACCTCTGCCTTGCCCAAGCTTCCGGCAAAAGGCGTCTCG TCAGGTTCTGGTGCCCGCGGATGAGGAAGGTGCATTGA AGCGCGGCTCACATCA ACAAACGCCACCCACAGC CCGTTGGAAAACAGATGGGA GAGACTGGCAAGCGTTTGA ACCCCGACGAGTATTACTGGGTTTTTCGCTACCGAGAACCACAC GCGCTGCGTGGCACATAGATTTTTGCAACCTTTCCTGGCATCAA TGCAAGTACACACCCTTGAAG TTCCGTACCACAGATCGCT TTGCTGGTCCTGCGGTGTTG CCTCGGGTCATCACATAAGGC TTTGGTGATTGAGCCGAGGGT CCATAAACGGCCGCTTTC CATTATTGCCGGATTGTTAGG GCGGGAAACATTACCAAGC TTGGGTGTGGGTACGTTGCTG CGCTGCCTCGTAAACCGTTGT CTGCCATTCGTTGAAGTACCT CGTCCTCCCAATAAGCCT CAATGAAGATTCACGGCAATA ATAGTTAATGGCTCCGCTATG GGCGGCGGTAAGGTTG GCGTATGTCTGTGCGGTGTGC

Primer

Xff-fwd Xff-rev Xff-P Xfm-fwd Xfm-rev Xfm-P 18s-fwd 18s-rev 18s-P Xf-fwd Xf-rev Xf-P Xff-F3 Xff-B3 Xff-FIP Xff-BIP Xff-LF Xff-LB Xfm-F3 Xfm-B3 Xfm-FIP Xfm-BIP Xfm-LF Xfm-LB XF-F3 XF-B3 XF-FIP XF-BIP XF-LF XF-LB lacF-fwd lacF-rev rfbD-fwd rfbD-rev nuoL-fwd nuoL-rev gltT-fwd gltT-rev petC-fwd petC-rev pilU-fwd pilU-rev cysG-fwd cysG-rev

Table 2 Primer sequences using in this study.

Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668951..1669047 Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668951..1669047 Subspecies fastidiosa target GenBank Accession #AE009442.1, region 1668951..1669047 Subspecies multiplex target, GenBank Accession # CP000941.1, region 568125..568223 Subspecies multiplex target, GenBank Accession # CP000941.1, region 568125..568223 Subspecies multiplex target, GenBank Accession # CP000941.1, region 568125..568223 Eukaryotic ribosomal RNA Eukaryotic ribosomal RNA Eukaryotic ribosomal RNA General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668235..1668792 Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668235..1668792 Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668235..1668792 Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668235..1668792 Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668235..1668792 Subspecies fastidiosa target, GenBank Accession #AE009442.1, region 1668235..1668792 Subspecies multiplex target, GenBank Accession #CP000941.1, region 1825757..1826268 Subspecies multiplex target, GenBank Accession #CP000941.1, region 1825757..1826268 Subspecies multiplex target, GenBank Accession #CP000941.1, region 1825757..1826268 Subspecies multiplex target, GenBank Accession #CP000941.1, region 1825757..1826268 Subspecies multiplex target, GenBank Accession #CP000941.1, region 1825757..1826268 Subspecies multiplex target, GenBank Accession #CP000941.1, region 1825757..1826268 General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene General X. fastidiosa target, rimM gene lacF, ABC transporter sugar permease lacF, ABC transporter sugar permease rfbD, dTDP-4-dehydrorhamnose-3 rfbD, dTDP-4-dehydrorhamnose-3 nuoL, NADH-ubiquinone oxidoreductase, NQO12 subunit nuoL, NADH-ubiquinone oxidoreductase, NQO12 subunit gltT, Glutamate symport protein gltT, Glutamate symport protein petC, Ubiquinol cytochrome c oxidoreductase, cytochrome c1 petC, Ubiquinol cytochrome c oxidoreductase, cytochrome c1 pilU, Twitching motility protein pilU, Twitching motility protein cysG, siroheme synthase cysG, siroheme synthase

Amplification target TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR TaqMan qPCR LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP LAMP PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA PCR, MLSA

Assay Type

This study This study This study This study This study This study (Ioos et al., 2012) (Ioos et al., 2012) (Ioos et al., 2012) (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) This study This study This study This study This study This study This study This study This study This study This study This study (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) (Harper et al., 2010, Harper et al., 2013) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005) (Nunney et al., 2014, Scally et al., 2005) (Nunney et al., 2014, Scally et al., 2005) (Scally et al., 2005) (Scally et al., 2005)

Source

L.P. Burbank, B.C. Ortega

Journal of Microbiological Methods 155 (2018) 8–18

12

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

Fig. 3. Optimization of TaqMan primer-probe combinations. Standard curves made from ten-fold dilutions of purified genomic DNA were used to validate primer-probe combinations and PCR conditions. Representative PCR runs are shown with optimized conditions. Template concentrations ranged from 100 ng – 1 pg and each dilution was run in triplicate. A) Duplex PCR with XFF (FAM) and XFM (HEX) probes. For FAM probe: efficiency = 96.6%, R2 = 1.000, slope = 3.407. For HEX probe: efficiency = 97.6% R2 = 1.000, slope = 3.382. B) Multiplex PCR with XFF (FAM), XFM (HEX), and 18S (CY5) probes and X. fastidiosa/plant DNA template. For FAM probe: efficiency = 99.1%, R2 = 1.000, slope = −3.345. For HEX probe: efficiency = 98.5% R2 = 1.000, slope = −3.359. For CY5 probe: efficiency = 99.2%, R2 = 0.999, slope = −3.341. C) Multiplex PCR with XFF (FAM), XFM (HEX), and 18S (CY5) probes and X. fastidiosa/insect DNA template. For FAM probe: efficiency = 87.7%, R2 = 0.990, slope = −3.656. For HEX probe: efficiency = 93.9% R2 = 1.000, slope = −3.478. For CY5 probe: efficiency = 85.3%, R2 = 0.769, slope = −3.733 D) 18S (CY5) probe in the multiplex assay shown separately and to scale for the lower fluorescence intensity of the fluorophore.

2.7. Specificity and limit of detection To evaluate specificity, full target sequences were subjected to a nucleotide BLAST search against both the ‘whole-genome shotgun contig’ and ‘Nucleotide collection’ databases. Chosen target sequences returned 100% identity only to the intended target subspecies strains. Mismatches are located in the primer and probe binding regions (Fig.1, Fig. 2). TaqMan and LAMP primers also were empirically tested for specificity against eight different strains of X. fastidiosa as well as six other bacterial species (Table 3). Bacterial genera chosen for specificity are known to colonize the same hosts as X. fastidiosa. Target concentrations that produced a positive result in 95% of replicates was considered the limit of detection (LOD). For TaqMan qPCR assays, LOD was determined from at least 8 separate detection runs with each template concentration run in triplicate (n = 24), and a Ct cutoff of 35 cycles. Average Ct values for different standard concentrations are shown in Table 4. LOD for LAMP assays was determined in a similar matter, except that any amplification after 30 min was considered a positive result, and no quantitative information was obtained. 2.8. Multi-locus sequence analysis of unknown strains Seven different gene sequences, previously described for multi-locus sequence analysis in X. fastidiosa were amplified from purified genomic DNA of X. fastidiosa strains Bakersfield-1 and Ornamental Plum using Ex Taq DNA polymerase (Takara Bio). Amplicons were gel purified and cloned into vector pCR8/GW/TOPO (Life Technologies) for Sanger sequencing. Sequencing was performed using Applied Biosystems BigDye sequencing Kit (ThermoFisher Scientific). Concatenated sequences for all seven genes were used for molecular phylogenetic analysis using MEGAX software (Kumar et al., 2018) with the following parameters: Maximum Likelihood method using the Tamura 3-parameter model (Tamura, 1992). The tree with the highest log likelihood was used (Fig. 5). Tree is drawn to scale, with branch lengths measured in the number of substitutions per site and known subspecies groups are indicated on the tree. 2.9. Comparison with established general detection protocols for X. fastidiosa For comparison, plant and insect sample sets were tested using previously established X. fastidiosa general detection assays published by (Harper et al., 2010). The Harper TaqMan PCR assay was conducted as follows. Two μl of template DNA was added to Applied Biosystems TaqMan™ Fast Universal PCR Master Mix, No AmpErase™ UNG (Life Technologies) with 0.3 μM primers, 0.1 μM probe, and 0.3 μM molecular grade BSA. Reactions were run at 50 °C for 2 min, 95 °C for 13

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

Fig. 4. LAMP optimization. A) Fluorescent LAMP optimization with ten-fold dilution sets of Stag's Leap and Dixon genomic DNA and XFF primers B) Fluorescent LAMP optimization with XFM primers. C) Colorimetric LAMP with XFF primers and genomic DNA samples in the following order: 1 = Stag's Leap, 2 = Temecula-1, 3 = M23, 4 = Bakersfield-1, 5 = Dixon, 6 = M12, 7 = BB08–1, 8 = Ornamental Plum, 9 = Xanthomonas campestris, 10 = Pseudomonas syringae, 11 = negative control D) Colorimetric LAMP with XFM primers and samples same as above. 14

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

Table 3 Target specificity of TaqMan and LAMP assays. Strain

Subspecies

Average Ct (Xff)

Average Ct (Xfm)

Xff LAMP

Xfm LAMP

Stag's Leap Dixon Temecula-1 M23 BB08–1 M12 Bakersfield-1 Ornamental Plum Xanthomonas campestris 8004 Pseudomonas syringae DC300 Agrobacterium tumefasciens Bacillus megatarium Pantoea stewarii DC283 Pseudomonas flourescens

fastidiosa multiplex fastidiosa fastidiosa multiplex multiplex fastidiosa multiplex N/A

20.8 – 20.2 23.7 – – 21.6 – 40*

– 20.7 ± – – 20.3 ± 20.5 ± – 19.4 ± 39.7*

+ – + + – – + – –

– + – – + + – + –

N/A N/A N/A N/A N/A

– – – – –

– – – – –

– – – – –

± 0.16 ± 0.08 ± 0.2

± 0.11

0.16

0.1 0.19 0.13

39.3* – – – –

Average Ct values were calculated from six separate PCR runs, each including three technical replicates (n = 18, Mean ± SD)*Late amplification in one replicate of the 18 total.

Colorimetric LAMP assay kit (New England Biolabs). Primer concentrations for Harper et al. LAMP assay were 0.1 μM (F3 and B3 primers), 1.0 μM (FIP and BIP primers), and 0.5 μM (LF and LB primers) based on modifications published by (Yaseen et al., 2015).

Table 4 TaqMan detectable range of Ct values. Probe

Ct (Mean ± SD)⁎

Concentration (cfu/ml)

XFF (FAM) XFF (FAM) XFF (FAM) XFF (FAM) XFF (FAM) XFM (HEX) XFM (HEX) XFM (HEX) XFM (HEX) XFM (HEX)

17.03 20.41 24.04 27.72 32.72 16.29 19.81 23.31 26.78 30.94

107 106 105 104 103 107 106 105 104 103

⁎

± ± ± ± ± ± ± ± ± ±

0.30 0.31 0.39 0.60 1.28 0.33 0.82 0.86 0.80 1.54

3. Results 3.1. Genomic targets for detection Target sequences were chosen based on 100% identity within the positive target group and several mismatches in each primer and probe in the non-target genome set (Fig. 1). Alignment of excluded subspecies is shown in Supplemental Fig. S3. The TaqMan qPCR target for subspecies fastidiosa is a 97 bp sequence in the center of a hypothetical protein open reading frame (GenBank Accession #AE009442.1, region 1668951..1669047). This gene target is of unknown function and has no identified conserved protein domains. The LAMP target for subspecies fastidiosa is a 558 bp sequence in the same genomic region (GenBank Accession #AE009442.1, region 1668235..1668792). Subspecies multiplex target for TaqMan qPCR is 99 bp overlapping the 3′ end of a putative lipase modulator gene (GenBank Accession # CP000941.1, region 568125..568223). LAMP target region for

n = 24.

10 min, and then for 40 cycles of 94 °C for 10 s and 62 °C for 40 s. Ct values from the TaqMan PCR assay developed in this study were compared with Ct values obtained from the same samples using the assay from Harper et al. by linear fit (Fig. 6). Graphing was done using OriginPro 2018b software (Origin Labs). LAMP assay results from the primers developed in this study were compared to LAMP with primers designed by Harper et al. using a 30-min incubation at 65 °C and

Fig. 5. MLSA characterization of Bakersfield-1 and Ornamental Plum strains. Concatenated sequences from seven house-keeping genes were used for molecular phylogenetic analysis by the Maximum Likelihood method based on the Tamura 3-parameter model (Tamura, 1992). The tree with the highest log likelihood (−11,262.65) is shown. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 0.0500)). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. Molecular phylogenetic analyses were conducted in MEGA X (Kumar et al., 2018).

15

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

calculated for both the XFF and XFM probes in the multiplex reaction containing the internal control 18S probe are approximately 103 cfu/ml and 104 cfu/ml respectively in mixed samples, based on the concentration that produced a positive result in 95% of replicates. 3.3. LAMP assay optimization Multiple LAMP primer sets were tested empirically for specificity using a 30-min amplification at 65 °C. Binding sites for the chosen primer combinations are shown in Fig. 2. LAMP assays were validated using X. fastidiosa DNA from strains Stag's Leap or Dixon combined with plant or insect DNA to mimic naturally infected samples (Fig. 4). For fluorescent LAMP assays, any amplification curve in 30 min was considered a positive reaction (Fig. 4 A,B). LAMP assays were able to detect 104 cfu/ml concentrations of X. fastidiosa DNA in mixed samples. For colorimetric LAMP assays, color change within 30 min was considered a positive reaction. Results of color LAMP were the same as fluorescent LAMP after 30 min, and lower limits of detection for color LAMP were also around 104 cfu/ml. Specificity was tested on eight different X. fastidiosa strains as well as six other bacterial species, with no nonspecific amplification (Fig. 4 CD, Table 3). Results were consistent with the known sequence type of all the X. fastidiosa strains tested, as well as matching with the qPCR results on the same strains.

Fig. 6. Performance compared with general Xylella fastidiosa detection protocols. Linear fit of Ct values obtained with the subspecies-specific TaqMan PCR assay and Ct values obtained with the same samples using a general detection protocol from Harper et al. (Harper et al., 2010). A total of 36 samples were compared, included 18 field-collected plant samples (black) and 18 field-collected insect samples (red). Linear fit and graphing was performed using OriginPro 2018b (Origin Labs). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

3.4. TaqMan and LAMP assays can differentiate X. fastidiosa subspecies in plant and insect samples

subspecies multiplex is 512 bp long and overlaps two open reading frames (GenBank Accession #CP000941.1, region 1825757..1826268), one encoding a hypothetical protein of unknown function, and the other a DNA methyltransferase.

After validation on purified and spiked DNA samples, subspeciesspecific TaqMan and LAMP assays were tested on artificially inoculated plants (grapevine and almond), as well as field-collected plants (grapevine) and insects (glassy-winged sharpshooter). Grapevines inoculated with Stag's Leap (subspecies fastidiosa), and almonds inoculated with Dixon (subspecies multiplex) produced the correct subspecies identification with both TaqMan and LAMP assays (Table 5). LAMP assays had slightly higher detection rates compared with TaqMan in inoculated plants. Field collected symptomatic grapevines that tested positive for X. fastidiosa carried subspecies fastidiosa based on TaqMan and LAMP results (Table 5). Again, LAMP produced a higher rate of positive samples. For field collected plant samples, approximately 10% were potentially false negatives, based on amplification failure of the internal control probe. Both X. fastidiosa subsp. fastidiosa and subsp. multiplex were detected in field-collected insects by PCR, however detection rates in insects using LAMP were much lower (Table 5). For field-collected plant and insect samples, qPCR and LAMP subspecies identifications were confirmed by cloning and sequencing the target DNA region from each individual sample. All positive samples produced the correct target sequence, and negative samples did not produce any X. fastidiosa sequence when subjected to the same cloning procedures.

3.2. TaqMan assay optimization For TaqMan assays, primer-probe combinations XFF (subspecies fastidiosa specific) and XFM (subspecies multiplex specific) were validated using purified DNA from X. fastidiosa, strains Stag's Leap (subspecies fastidiosa) and Dixon (subspecies multiplex) (Fig. 3). Combined template consisting of equal parts DNA from the two strains was used for validation of the multiplex PCR assay using both primer-probe sets (Fig. 3A). For validation on mixed samples, uninfected plant or insect DNA was spiked with purified X. fastidiosa DNA, and the internal control probe targeting 18S was included (Fig. 3B, C). The slight reduction in efficiency with insect DNA templates is likely a result of inhibitory compounds from insect tissues. Overall the three probes perform well in a multiplex reaction with mixed template DNA. The 18S probe produces amplification on all samples containing plant or insect DNA (Fig. 3D). On unknown samples, reactions with no CY5 amplification (18S control probe) are classified as potential false negatives and can be either excluded from analysis or re-tested accordingly. Fluorescence intensity of the CY5 fluorophore is lower than FAM or HEX but standard curves show equal efficiency when viewed to scale (Fig. 3D). Specificity was tested on eight different X. fastidiosa strains, as well as six other bacterial species known to be present in similar host plants, and no nonspecific amplification was detected (Table 3). Limit of detection

3.5. Sequence typing confirms TaqMan and LAMP subspecies identification An unknown X. fastidiosa strain isolated from grapevine in Kern County, California was characterized as subspecies fastidisosa based on TaqMan and LAMP assay results. Multi-locus sequence analysis (MLSA) was performed on this strain (Bakersfield-1) to confirm sequence type,

Table 5 Subspecies level detection in artificially and naturally inoculated plants and insects. Sample

Positive qPCR Xff⁎

Positive qPCR Xfm⁎

Positive 18S

Positive LAMP Xff

Positive LAMP Xfm

Inoculated grape Inoculated almond Field collected grape Field collected GWSS

7/9 0/23 10/20 15/27

0/9 11/23 0/20 10/27

7/9 23/23 10/20 27/27

9/9 0/23 18/20 9/27

0/9 13/23 0/20 5/27

⁎

Based on a cutoff of 35 cycles. 16

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

titers than plant samples due to the limited space for bacterial colonization in the insect mouthparts, and the small amount of tissue available for extraction from individual insect heads. We found that in insect samples, quantities of X. fastidiosa were sometimes below the detection threshold for LAMP, and TaqMan performed better if the extracted DNA was of high purity. Thus, it is important to consider extraction method and sample type when choosing the optimal detection methodology. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mimet.2018.11.002.

using a set of seven housekeeping genes (Scally et al., 2005) (Fig. 5). A second isolate obtained from ornamental plum in California was identified with TaqMan and LAMP assays as subspecies multiplex and confirmed using MLSA (Fig. 5). Based on MLSA, Bakersfield-1 clustered with characterized strains belonging to subspecies fastidiosa, and the ornamental plum strain clustered with subspecies multiplex strains, confirming sequence type identity obtained by qPCR and LAMP. 3.6. Performance comparison with a general X. fastidiosa detection protocol Several general detection protocols are commonly used for detection and quarantine screening for X. fastidiosa. We compared the Ct values obtained with the subspecies specific TaqMan assay with a previously established qPCR protocol using field-collected plant and insect samples (Harper et al., 2010). In general, Ct values from the subspecies-specific TaqMan assay were highly correlated with Ct values obtained using the general detection protocol (Fig. 6). However, at very low target concentrations such as in insect samples, the general detection protocol performed better and had a lower limit of detection (102 cfu/ml). Subspecies-specific LAMP assays also were compared with the LAMP primers published by Harper et al. (Harper et al., 2010) using both colorimetric and fluorescent LAMP protocols. LAMP detection rates were the same with the subspecies-specific detection protocol and the general detection protocol.

Acknowledgments

4. Discussion

References

The TaqMan qPCR and LAMP assays described here can differentiate between X. fastidiosa subspecies multiplex and subspecies fastidiosa strains in plant and insect samples. Subspecies level detection is important in areas where multiple sequence types of X. fastidiosa are present, both for research studies and for preliminary identification of new isolates. Previously developed molecular detection assays for subspecies level identification of X. fastidiosa focused on strains causing citrus variegated chlorosis, and differentiation from other strains present in Europe and South America (Li et al., 2013; Ouyang et al., 2013; Pooler and Hartung, 1995). The methods described here are designed to identify Pierce's disease strains in the context of North America where subspecies multiplex is often found in close proximity. In addition, it is likely that these methods will be useful for subspecies level identification in other regions such as Europe where these two subspecies have also been found in the same areas (Denancé et al., 2017; Olmo et al., 2017). However, some further validation may be required to confirm specificity on strains found in other parts of the world. It should also be noted that although subspecies pauca was included in primer design exclusion criteria, these assays have not been empirically tested against pauca isolates because this subspecies is not present in North America where sampling was conducted. Strain identification using TaqMan and LAMP assays can be extremely rapid and can be used for highthroughput screening and preliminary characterization of large numbers of isolates. There are always some challenges however in implementing molecular detection in environmental samples, such as presence of inhibitory compounds in plant and insect sample extractions which can contribute to false negative PCR results (Schrader et al., 2012). Incorporation of internal control primers and probes that amplify the host 18S ribosomal gene is intended to improve detection confidence by showing the success or failure of amplification in each individual sample (Ioos et al., 2012). As shown in our results on field samples, a certain percentage of negative results can in some cases be attributed to PCR failure rather than true negative results. This information is important, especially in detection protocols for quarantine screening. Alternatively, LAMP assays are known to be more robust in the presence of inhibitors (Francois et al., 2011). In this case, although not as sensitive or quantitative as TaqMan, LAMP assays provide subspecies specific detection of X. fastidiosa, and perform well on plant sample extractions. Insect samples typically have much lower bacterial

Almeida, R.P.P., Nunney, L., 2015. How do plant diseases caused by Xylella fastidiosa Emerge? Plant Dis. 99, 1457–1467. Baldi, P., La Porta, N., 2017. Xylella fastidiosa: host range and advance in molecular identification techniques. Front. Plant Sci. 8. Bergsma-Vlami, M., Bilt, J.L.J., Tjou-Tam-Sin, N.N.A., Helderman, C.M., Gorkink-Smits, P.P.M.A., Landman, N.M., Nieuwburg, J.G.W., Veen, E.J., Westenberg, M., 2017. Assessment of the genetic diversity of Xylella fastidiosa in imported ornamental Coffea arabica plants. Plant Pathol. 66, 1065–1074. Bucci, E.M., 2018. Xylella fastidiosa, a new plant pathogen that threatens global farming: ecology, molecular biology, search for remedies. Biochem. Biophys. Res. Commun. 502, 173–182. Chen, J., Groves, R., Civerolo, E.L., Viveros, M., Freeman, M., Zheng, Y., 2005. Two Xylella fastidiosa genotypes associated with almond leaf scorch disease on the same location in California. Phytopathology 95, 708–714. Chen, J., Xie, G., Han, S., Chertkov, O., Sims, D., Civerolo, E.L., 2010. Whole genome sequences of two Xylella fastidiosa strains (M12 and M23) causing almond leaf scorch disease in California. J. Bacteriol. 192, 4534. Chen, J., Huang, H., Chang, C.-J., Stenger, D.C., 2013. Draft Genome Sequence of Xylella fastidiosa subsp. multiplex Strain Griffin-1 from Quercus rubra in Georgia. Genome Announcements. 1 e00756-00713. Chen, J., Wu, F., Zheng, Z., Deng, X., Burbank, L.P., Stenger, D.C., 2016. Draft genome sequence of Xylella fastidiosa subsp. fastidiosa strain stag's leap. Genome Announcements. 4. Davis, M., French, W., Schaad, N., 1981. Axenic culture of the bacteria associated with phony disease of peach and plum leaf scald. Curr. Microbiol. 6, 309–314. Denancé, N., Legendre, B., Briand, M., Olivier, V., Boisseson, C., Poliakoff, F., Jacques, M.A., 2017. Several subspecies and sequence types are associated with the emergence of Xylella fastidiosa in natural settings in France. Plant Pathol. 66, 1054–1064. Francis, M., Lin, H., Rosa, J.C.-L., Doddapaneni, H., Civerolo, E.L., 2006. Genome-based PCR primers for specific and sensitive detection and quantificationof Xylella fastidiosa. Eur. J. Plant Pathol. 115, 203. Francois, P., Tangomo, M., Hibbs, J., Bonetti, E.-J., Boehme, C.C., Notomi, T., Perkins, M.D., Schrenzel, J., 2011. Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications. FEMS Immunology & Medical Microbiology. 62, 41–48. Giampetruzzi, A., Saponari, M., Almeida, R.P.P., Essakhi, S., Boscia, D., Loconsole, G., Saldarelli, P., 2017. Complete genome sequence of the olive-infecting strain Xylella fastidiosa subsp. pauca De Donno. Genome Announcements. 5. Guan, W., Shao, J., Singh, R., Davis, R.E., Zhao, T., Huang, Q., 2013. A TaqMan-based real time PCR assay for specific detection and quantification of Xylella fastidiosa strains causing bacterial leaf scorch in oleander. J. Microbiol. Methods 92, 108–112. Guan, W., Shao, J., Davis, R.E., Zhao, T., Huang, Q., 2014. Genome sequence of a Xylella fastidiosa strain causing sycamore leaf scorch disease in Virginia. Genome Announcements. 2 e00773-00714. Harper, S.J., Ward, L.I., Clover, G.R.G., 2010. Development of LAMP and real-time PCR methods for the rapid detection of Xylella fastidiosa for quarantine and field applications. Phytopathology 100, 1282–1288. Harper, S.J., Ward, L.I., Clover, G.R.G., 2013. Erratum. Phytopathology 103, 762. Hendson, M., Purcell, A.H., Chen, D., Smart, C., Guilhabert, M., Kirkpatrick, B., 2001. Genetic diversity of pierce's disease strains and other pathotypes of Xylella fastidiosa.

We would like to thank R. Leija, S. Navarro, J. De la Pena, N. Luna, and K. Zhang for technical support; and M.S. Sisterson and D. Stenger for providing GWSS samples. Funding for this work was from United State Department of Agriculture (USDA) Agricultural Research Service appropriated project 2034-22000-012-00D. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not constitute endorsement by USDA. USDA is an equal opportunity provider and employer. Competing interests The authors declare no competing interests.

17

Journal of Microbiological Methods 155 (2018) 8–18

L.P. Burbank, B.C. Ortega

Palmisano, F., Saponari, A., Tavano, D., Savino, V.N., Dongiovanni, C., Martelli, G.P., 2017. Isolation and pathogenicity of Xylella fastidiosa associated to the olive quick decline syndrome in southern Italy. Sci. Rep. 7, 17723. Scally, M., Schuenzel, E.L., Stouthamer, R., Nunney, L., 2005. Multilocus sequence type system for the plant pathogen Xylella fastidiosa and relative contributions of recombination and point mutation to clonal diversity. Appl. Environ. Microbiol. 71, 8491–8499. Schaad, N.W., Postnikova, E., Lacy, G., Fatmi, M.B., Chang, C.-J., 2004. Xylella fastidiosa subspecies: X. fastidiosa subsp piercei, subsp. nov., X. fastidiosa subsp. multiplex subsp. nov., and X. fastidiosa subsp. pauca subsp. nov. Syst. Appl. Microbiol. 27, 763. Schrader, C., Schielke, A., Ellerbroek, L., Johne, R., 2012. PCR inhibitors – occurrence, properties and removal. J. Appl. Microbiol. 113, 1014–1026. Schreiber, H.L., Koirala, M., Lara, A., Ojeda, M., Dowd, S.E., Bextine, B., Morano, L., 2010. Unraveling the first Xylella fastidiosa Subsp. fastidiosa Genome from Texas. Southwestern Entomologist. 35, 479–483. Schuenzel, E.L., Scally, M., Stouthamer, R., Nunney, L., 2005. A Multigene phylogenetic study of clonal diversity and divergence in north American strains of the plant pathogen Xylella fastidiosa. Appl. Environ. Microbiol. 71, 3832–3839. Sicard, A., Zeilinger, A.R., Vanhove, M., Schartel, T.E., Beal, D.J., Daugherty, M.P., Almeida, R.P.P., 2018. Xylella fastidiosa: Insights into an emerging plant pathogen. Annu. Rev. Phytopathol. 56, 181–202. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Söding, J., Thompson, J.D., Higgins, D.G., 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7. Simpson, A.J.G., Reinach, F.C., Arruda, P., Abreu, F.A., Acencio, M., Alvarenga, R., Alves, L.M.C., Araya, J.E., Baia, G.S., Baptista, C.S., Barros, M.H., Bonaccorsi, E.D., Bordin, S., Bové, J.M., Briones, M.R.S., Bueno, M.R.P., Camargo, A.A., Camargo, L.E.A., Carraro, D.M., Carrer, H., Colauto, N.B., Colombo, C., Costa, F.F., Costa, M.C.R., Costa-Neto, C.M., Coutinho, L.L., Cristofani, M., Dias-Neto, E., Docena, C., El-Dorry, H., Facincani, A.P., Ferreira, A.J.S., Ferreira, V.C.A., Ferro, J.A., Fraga, J.S., França, S. C., Franco, M.C., Frohme, M., Furlan, L.R., Garnier, M., Goldman, G.H., Goldman, M. H.S., Gomes, S.L., Gruber, A., Ho, P.L., Hoheisel, J.D., Junqueira, M.L., Kemper, E.L., Kitajima, J.P., Krieger, J.E., Kuramae, E.E., Laigret, F., Lambais, M.R., Leite, L.C.C., Lemos, E.G.M., Lemos, M.V.F., Lopes, S.A., Lopes, C.R., Machado, J.A., Machado, M. A., Madeira, A.M.B.N., Madeira, H.M.F., Marino, C.L., Marques, M.V., Martins, E.A.L., Martins, E.M.F., Matsukuma, A.Y., Menck, C.F.M., Miracca, E.C., Miyaki, C.Y., Monteiro-Vitorello, C.B., Moon, D.H., Nagai, M.A., Nascimento, A.L.T.O., Netto, L.E. S., Nhani Jr, A., Nobrega, F.G., Nunes, L.R., Oliveira, M.A., de Oliveira, M.C., de Oliveira, R.C., Palmieri, D.A., Paris, A., Peixoto, B.R., Pereira, G.A.G., Pereira Jr, H. A., Pesquero, J.B., Quaggio, R.B., Roberto, P.G., Rodrigues, V., de M. Rosa, de Rosa Jr, V.E., de Sá, R.G., Santelli, R.V., Sawasaki, H.E., da Silva, A.C.R., da Silva, A.M., da Silva, F.R., Silva, W.A., da Silveira, J.F., Silvestri, M.L.Z., Siqueira, W.J., de Souza, A. A., de Souza, A.P., Terenzi, M.F., Truffi, D., Tsai, S.M., Tsuhako, M.H., Vallada, H., Van Sluys, M.A., Verjovski-Almeida, S., Vettore, A.L., Zago, M.A., Zatz, M., Meidanis, J., Setubal, J.C., 2000. The genome sequence of the plant pathogen Xylella fastidiosa. Nature 406, 151. Tamura, K., 1992. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol. Biol. Evol. 9, 678–687. Thomsen, M.C.F., Hasman, H., Westh, H., Kaya, H., Lund, O., 2017. RUCS: rapid identification of PCR primers for unique core sequences. Bioinformatics 33, 3917–3921. Tumber, K.P., Alston, J.M., Fuller, K., 2014. Pierce's disease costs California $104 million per year. Calif. Agric. 68, 20–29. Van Sluys, M.A., de Oliveira, M.C., Monteiro-Vitorello, C.B., Miyaki, C.Y., Furlan, L.R., Camargo, L.E.A., da Silva, A.C.R., Moon, D.H., Takita, M.A., Lemos, E.G.M., Machado, M.A., Ferro, M.I.T., da Silva, F.R., Goldman, M.H.S., Goldman, G.H., Lemos, M.V.F., El-Dorry, H., Tsai, S.M., Carrer, H., Carraro, D.M., de Oliveira, R.C., Nunes, L.R., Siqueira, W.J., Coutinho, L.L., Kimura, E.T., Ferro, E.S., Harakava, R., Kuramae, E.E., Marino, C.L., Giglioti, E., Abreu, I.L., Alves, L.M.C., do Amaral, A.M., Baia, G.S., Blanco, S.R., Brito, M.S., Cannavan, F.S., Celestino, A.V., da Cunha, A.F., Fenille, R.C., Ferro, J.A., Formighieri, E.F., Kishi, L.T., Leoni, S.G., Oliveira, A.R., Rosa Jr., V.E., Sassaki, F.T., Sena, J.A.D., de Souza, A.A., Truffi, D., Tsukumo, F., Yanai, G.M., Zaros, L.G., Civerolo, E.L., Simpson, A.J.G., Almeida Jr., N.F., Setubal, J. C., Kitajima, J.P., 2003. Comparative analyses of the complete genome sequences of pierce's disease and citrus variegated chlorosis strains of Xylella fastidiosa. J. Bacteriol. 185, 1018–1026. Yaseen, T., Drago, S., Valentini, F., Elbeaino, T., Stampone, G., Digiaro, M., Onghia, A.M., 2015. 2015. On-site detection of Xylella fastidiosa in host plants and in “spy insects” using the real-time loop-mediated isothermal amplification method. Phytopathologia Mediterranea; Vol 3, 54. Yuan, X., Morano, L., Bromley, R., Spring-Pearson, S., Stouthamer, R., Nunney, L., 2010. Multilocus sequence typing of Xylella fastidiosa causing pierce's disease and oleander leaf scorch in the United States. Phytopathology 100, 601–611.

Appl. Environ. Microbiol. 67, 895–903. Hernandez-Martinez, R., Costa, H.S., Dumenyo, C.K., Cooksey, D.A., 2006. Differentiation of strains of Xylella fastidiosa infecting grape, almonds, and oleander using a multiprimer PCR Assay. Plant Dis. 90, 1382–1388. Hernandez-Martinez, R., de la Cerda, K.A., Costa, H.S., Cooksey, D.A., Wong, F.P., 2007. Phylogenetic relationships of Xylella fastidiosa strains isolated from landscape ornamentals in Southern California. Phytopathology 97, 857–864. Hoffman, K., Baron, M., 2014. BoxShade. 2018. Hopkins, D.L., Purcell, A.H., 2002. Xylella fastidiosa: cause of pierce's disease of grapevine and other emergent diseases. Plant Dis. 86, 1056–1066. Ioos, R., Fourrier, C., Wilson, V., Webb, K., Schereffer, J.-L., de Labrouhe, D.T., 2012. An Optimized Duplex Real-Time PCR Tool for Sensitive Detection of the Quarantine Oomycete Plasmopara halstedii in Sunflower Seeds. Phytopathology 102, 908–917. Jacques, M.-A., Denancé, N., Legendre, B., Morel, E., Briand, M., Mississipi, S., Durand, K., Olivier, V., Portier, P., Poliakoff, F., Crouzillat, D., 2016. New coffee plant-infecting Xylella fastidiosa variants derived via homologous recombination. Appl. Environ. Microbiol. 82, 1556–1568. Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547–1549. Lee, R.F., Beretta, M.J.G., Hartung, J.H., Hooker, M.E., Derrick, K.S., 1993. Citrus variegated chlorosis: confirmation of a Xylella fastidiosa as the causal agent. Summa Phytopathol. 19, 123–125. Li, W., Teixeira, D.C., Hartung, J.S., Huang, Q., Duan, Y., Zhou, L., Chen, J., Lin, H., Lopes, S., Ayres, A.J., Levy, L., 2013. Development and systematic validation of qPCR assays for rapid and reliable differentiation of Xylella fastidiosa strains causing citrus variegated chlorosis. J. Microbiol. Methods 92, 79–89. Loconsole, G., Saponari, M., Boscia, D., D'Attoma, G., Morelli, M., Martelli, G.P., Almeida, R.P.P., 2016. Intercepted isolates of Xylella fastidiosa in Europe reveal novel genetic diversity. Eur. J. Plant Pathol. 146, 85–94. Minsavage, G.V., Thomson, C.M., Hopkins, D.L., Leite, R.M.V.B.C., Stall, R.E., 1994. Development of a polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopathology 84, 456–461. Monteiro, P.c.B., Teixeira, D.C., Palma, R.R., Garnier, M., Bové, J.-M., Renaudin, J., 2001. Stable transformation of the Xylella fastidiosa citrus variegated chlorosis strain withoriC plasmids. Appl. Environ. Microbiol. 67, 2263–2269. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, e63. Nunney, L., Yuan, X., Bromley, R., Hartung, J., Montero-Astúa, M., Moreira, L., Ortiz, B., Stouthamer, R., 2010. Population genomic analysis of a bacterial plant pathogen: novel insight into the origin of pierce's disease of grapevine in the U.S. PLoS One 5, e15488. Nunney, L., Elfekih, S., Stouthamer, R., 2012. The Importance of multilocus sequence typing: cautionary tales from the bacterium Xylella fastidiosa. Phytopathology 102, 456–460. Nunney, L., Schuenzel, E.L., Scally, M., Bromley, R.E., Stouthamer, R., 2014. Large-scale intersubspecific recombination in the plant-pathogenic bacterium Xylella fastidiosa is associated with the host shift to mulberry. Appl. Environ. Microbiol. 80, 3025–3033. Oliver, J.E., Cobine, P.A., De La Fuente, L., 2015. Xylella fastidiosa isolates from both subsp. multiplex and fastidiosa cause disease on southern highbush blueberry (Vaccinium sp.) under greenhouse conditions. Phytopathology 105, 855–862. Olmo, D., Nieto, A., Adrover, F., Urbano, A., Beidas, O., Juan, A., Marco-Noales, E., López, M.M., Navarro, I., Monterde, A., Montes-Borrego, M., Navas-Cortés, J.A., Landa, B.B., 2017. First detection of Xylella fastidiosa infecting cherry (Prunus avium) and Polygala myrtifolia plants, in Mallorca Island, Spain. Plant Dis. 101, 1820. Ouyang, P., Arif, M., Fletcher, J., Melcher, U., Ochoa Corona, F.M., 2013. Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated Chlorosis using razor ex technology and TaqMan quantitative PCR. PLoS One 8, e81647. Pierce, N., 1892. The California vine disease: a preliminary report of investigations. U.S. Department of Agriculture Bulletin 2. Pooler, M.R., Hartung, J.S., 1995. Specific PCR detection and identification of Xylella fastidiosa strains causing citrus variegated chlorosis. Curr. Microbiol. 31, 377–381. Randall, J.J., Goldberg, N.P., Kemp, J.D., Radionenko, M., French, J.M., Olsen, M.W., Hanson, S.F., 2009. Genetic analysis of a novel Xylella fastidiosa subspecies found in the southwestern United States. Appl. Environ. Microbiol. 75, 5631. Rapicavoli, J., Ingel, B., Blanco-Ulate, B., Cantu, D., Roper, C., 2018. Xylella fastidiosa: an examination of a re-emerging plant pathogen. Mol. Plant Pathol. 19, 786–800. Rodrigues, J.L.M., Silva-Stenico, M.E., Gomes, J.E., Lopes, J.R.S., Tsai, S.M., 2003. Detection and diversity assessment of Xylella fastidiosa in field-collected plant and insect samples by using 16S rRNA and gyrB sequences. Appl. Environ. Microbiol. 69, 4249–4255. Saponari, M., Boscia, D., Altamura, G., Loconsole, G., Zicca, S., D'Attoma, G., Morelli, M.,

18