Novel chemiluminescent substrate and probe systems for the identification of CFΔF508 genotypes

Molecular Diagnosis Vol. 2 No. 2 1997

Novel Chemiluminescent Substrate and Probe Systems for the Identification of CFAF508 Genotypes L E K K A L A V. R E D D Y , * H A S H E M A K H A V A N - T A F T I , t R E N U K A D e S I L V A , t R I C H A R D H A N D L E Y , I D A N I E L H. F A R K A S , * A. P A U L S C H A A P t Royal Oak, Southfield, Michigan

Background: Chemiluminescence detection systems are rapidly gaining popularity as safer alternatives to isotopic methods in molecular diagnostics with equal sensitivity and specificity. In addition, they offer versatility of detection because of the availability of different haptens for labeling the probes, the antihapten antibodies conjugated with either alkaline phosphatase (AP) or horseradish peroxidase (HRP), and their respective chemiluminescent substrates. A novel dual chemiluminescent substrate (AP and HRP based) and probe systems to distinguish genotypes of cystic fibrosis AFs08 mutation are described. Methods and Results: Two methodologies have been formulated to identify positively the genotypes of the cystic fibrosis AFs08 mutation. In method 1, a pair of oligonucleotides designed to anneal to the fanking regions of AFs08 mutation are differentially labeled with the hapten biotin or fluorescein and ligated using the template DNA of wild-type (N/N), heterozygous (N/AFs08), and homozygous (AFso8/AFs08) genotypes. The ligated product containing both labels is detected by first binding with avidin-HRP and anti-fluorescein-AP followed by reaction with the dual substrate. As expected, the ligation products are detected only in N/AFs08 and AFso8/AFs08 genotypes but not in N/N, where the ligation is precluded by the presence of three intervening nucleotides. In method 2, the three genotypes are hybridized on a membrane simultaneously with uniquely labeled (biotin or digoxigenin) oligonucleotides each designed to bind either the normal or the mutant allele. On treatment with HRP- and AP-conjugated antibodies followed by reaction with the dual substrate, only the band from N/AFs08 genotype emitted a strong signal because of the binding of both oligonucleotides. Conclusions: The ligation and hybridization methods in conjunction with the dual substrate can detect and differentiate the genotypes with the AFs08mutation. These formats may be valuable for distinguishing normal individuals from carriers in population screening and fetuses that are heterozygous, from those that are homozygous for cystic fibrosis AFs08in prenatal and neonatal diagnosis. Key words: cystic fibrosis, nonisotopic detection, alkaline phosphatase, horseradish peroxidase.

* From the Department of Clinical Pathology, William Beaumont Hospital, Royal Oak, Michigan, and iLumigen Inc., Southfield, Michigan.

Supported by SBIR Grant 2 R44 DK47727-02 to Lumigen from the National Institutes of Health. Reprint requests: LekkalaV. Reddy,PhD, Molecular Probe Laboratory, Department of Clinical Pathology,William Beaumont Hospital, 3601 West Thirteen Mile Road, Royal Oak, MI 48073-6769. ©1997 Churchill Livingstone Inc.

113

114 MolecularDiagnosisVol.2 No. 2 June 1997 Cystic fibrosis (CF) is one of the most common lethal genetic diseases in Caucasian populations, affecting approximately 1 in 2000-2500 live births [1]. Cystic fibrosis affects multiple organs and is clinically heterogeneous, with patients having very severe to a relatively mild disease. Cystic fibrosis results from mutations in the CF transmembrane regulator (CFTR) gene on chromosome 7. The most common mutation is deletion of amino acid phenylalanine at position 508 (z~d~508)of CFTR protein. This results from an inframe deletion of three nucleotides in exon 10 of this gene [2]. The frequency of AFs08 in CF chromosomes is estimated on the average at 67% worldwide [3] and 75% in the United States [4,5]. To date, more than 500 additional but less frequent mutations of CFTR have been reported by the Cystic Fibrosis Genetic Analysis Consortium; however, in some ethnic groups such as the Ashkenazi Jewish population, the mutation W I282X accounts for as much as 50% of CF chromosomes [6]. Several different methods of molecular detection of CF mutations have been reported in the literature. These include allele-specific oligonucleotide (ASO) hybridization [2], allele-specific polymerase chain reaction (PCR) amplification system [7], amplification refractory mutation system (ARMS) [8], polyacrylamide gel electrophoresis (PAGE) of PCR products of exon 10 (for AFs08) [9], PCR amplification followed by restriction enzyme digestion [ 10], multiplex PCR amplification [11 ], single-strand conformation polymorphism (SSCP) [12], and reverse dot-blot hybridization [13]. These methods have evolved over time as simultaneous detection of multiple mutations was warranted with the discovery of many more CF mutations. With an objective to develop methods for specific and rapid detection of CF mutations and their genotypes, we report here the utility of a dual chemiluminescent substrate system in which the signal is generated by the combined action of both alkaline phosphatase (AP) and horseradish peroxidase (HRP); both enzymes must be present in close proximity such as in the hybridized band of DNA for chemiluminescence to be produced. Based on this substrate system, we have formulated two methodologies for differentiating the AFs08 genotypes. One method depends on the specific detection of ligated product of two uniquely labeled oligonucleotide primers that are complementary to the flanking regions of the AFs08 mutation. The other method is based on the hybridization of two differentially labeled oligonu-

cleotide probes one of which is complementary to the wild-type allele and the other to the AFs0s allele. This method differentiates the heterozygous genotype from either homozygous genotype.

Materials and Methods Dual Chemiluminescent Substrate System The chemiluminescent detection reagent consisted of 0.01 M Tris, pH 8.8, 1 mM 2-naphthyl phosphate, 2.5 mM urea peroxide, 0.5% Tween 20, and 0.3 mM 2,3,6-trifluorophenyl 10-methylacridan-9-carboxylate [14]. Reaction of the naphthyl phosphate in the dual substrate reagent with AP produces 2-naphthol, an enhancer of peroxidase activity. Oxidation of the acridan derivative with HRP in the presence of peroxide produces an acridinium ester, which undergoes a chemiluminescent reaction with peroxide under the reaction conditions as shown in Figure 1. The enhancer greatly extends the catalytic lifetime and turnover of the peroxidase. Chemiluminescence intensities produced in the absence of either or both enzymes are insignificant.

DNA Samples DNA samples of the wild-type (N/N), heterozygous (N/AFs08), and homozygous (AFso8/AFs08) genotypes were obtained from the Coriell Cell Repositories (Camden, NJ) and from Dr. Janet Bayleran (Eastern Maine Medical Center, Bangor, ME). Random DNA samples of individuals without CF were used for genotype (normal or carrier) determination.

~

OPO 3Na2

AP

Protected Enhancer

~ ~ O H Enhancer

F

Enhancer HRP + H202 ~-

Light

I

CH3

Fig. 1. Production of acridinium ester via oxidation of acridan derivative with horseradish peroxidase in the presence of peroxide.

Chemiluminescent Detection of CFAF508

>

I ~Ligatton ii

/tgated

Electrophorese Transfertomembran: ReactwithAvidin-HRP andAP-anti-fluorescein antibody Addchemiluminescent

----~ i

unligated N/N N/A 6/A

substrate

Mutant Gene

~

115

The detection of the AFs08 mutation and differentiation of genotypes are based on the ability to ligate a pair of oligonucleotides that anneal to the template next to each other on either side of the mutation in N/AFs08 and AFsos/AFs08 genotypes (Fig. 2A). In the N/N (wildtype) genotype, on the other hand, the annealed oligonucleotides do not ligate to each other because they are separated by a gap resulting from the presence of three intervening nucleotides (Fig. 2B). Two oligonucleotides, one labeled with biotin and the other with fluorescein and differing in length by three nucleotides (21- and 24-mers), were designed to anneal to the sense strand of the DNA template and are designated antisense upstream (5 biotin-TATTCATCATAGGAAACACCA 3') and antisense downstream (5"-phosphate-ATGATATTTTCTTTAATGGTGCC A-fluorescein-Y). The antisense downstream oligonucleotide was synthesized with 5'-phosphate to facilitate its enzymatic ligation to the antisense upstream oligonucleotide (Fig. 2B). The ligation reaction consisted of 200 ng of purified PCR amplified template of each genotype, 10 ng each of the oligonucleofides, 1× ligation buffer (30 mM Tris-HC1, pH 7.8, 10 mM MgC12, 10 mM dithiothreitol, 0.5 mM adenosine triphosphate), and 5 U of T4 DNA ligase. The template--oligonucleotide mix was first heated at 95°C for 3 minutes and quickly cooled on ice before adding to it

A

Fig. 2. (A) Schematic diagram of the ligation method. (B) DNA sequences of the target (wild-type and AFs08alleles) and of the complementary oligonucleotides used in the ligation. The underlined trinucleotide is deleted (A) in the AFs08 allele. The ligation assay format detects the AFso8 allele in the heterozygous (N/A) and homozygous (A/A) CF genotypes. B, biotin; E fluorescein; P, phosphate; AP, alkaline phosphatase, HRP, horseradish peroxidase.

Reddy et al.

Ligation Method: Ligation Reaction, Electrophoresis, and Transfer

Amplification of DNA by PCR To obtain a sufficient amount of DNA for the experiments, the exon l0 region (- 200 bp) containing the AFs08 mutation was first amplified by PCR using the primers 5' ACTTCACTTCTAATGATGATTATG 3' and 5' CTCTTCTAGTTGGCATGCTTTGAT Y. The PCR was performed in a 100 ~tL reaction consisting of 1× buffer (10 mM Tris-HCl, pH 8.3, 50 mM KC1), 200 ktM of each deoxynucleotide, 1 ktM of each primer, 2.5 mM MgCl=, 2.5 U of Amplitaq DNA polymerase (Roche Molecular Systems, Branchburg, NJ), and 0.5 ktg of genomic DNA template. The DNA was amplified in a Perkin-Elmer Cetus 480 (Norwalk, CT) thermal cycler for 35 cycles with an overlay of mineral oil. Each cycle consisted of 1 minute each of denaturation, primer annealing, and extension at 94°C, 60°C, and 72°C, respectively, with a 10-minute extension at the end of cycling. Prior to the cycling, the template DNA was denatured at 95°C for 3 minutes, quickly cooled on ice, and added to the PCR reaction tube. Specific amplification of correct size product was confirmed on a 1% agarose gel containing ethidium bromide. The amplified DNA was purified using a QIAquick purification kit (QIAGEN, Chatsworth, CA) to remove unincorporated deoxyribonucleotides and oligonucleotide primers. Purified DNA was quantitated spectrophotometrically before use in the ligation and hybridization experiments described below.

•

Fluorescein ~

Rio,in

B A 5, ~ A C C A T T A A A G A A A A T A T C A T q ~ 4 3 T G T T T C C T A T G A T G A A T A 3' ACCGTGGTAATTTCTT~TATAGTAACCACAAAGGATACTACTTAT

3' ~F508 (sense) 5' Oligonucleotides

q

II

[

F

5'P3'

B

5' T G G C A C C A T T A A A G A A A A T A T C A T ~ T G G T G T T T C C T A T G A T G A A T A 3' ACCGTGGTAATTTCTTTTATAGTA ACCACAAAGGATACTACTTAT

I

I

F

5'P

I

L

3'

B

3' Wildtype (sense) 5' Oligonucleotides

116

Molecular Diagnosis Vol. 2 No. 2 June 1997

the ligation buffer and ligase. The ligations were performed in a 20-~tL reaction at 15°C overnight. A negative control ligation reaction of the labeled oligonucleotides in the absence of template was also performed. The ligation reactions were fractionated on 16% or 20% denaturing polyacrylamide gels (7 M urea) along with a dual-labeled (biotin and fluorescein) oligonucleotide as size marker (45-mer). The 16% gel was electrophoresed until the bromophenol blue dye migrated halfway into the gel (short run), whereas on the 20% gel the dye ran off the gel (long run). The electrophoresed ligation reactions were capillary transferred onto a 0.2-t.tm MSI MagnaGraph nylon membrane (Micron Separations, Westborough, MA) in 10X SSC (1.5 M NaC1, 0.15 M sodium citrate, pH 7.2). The blotted membrane was baked at 80°C for 2 hours and reacted with the antibody--enzyme conjugates and the dual substrate, as described below.

Hybridization Method: Southern Transfer and Hybridization In the hybridization method of detection and differentiation of AFs08 genotypes, a pair of differentially

labeled (biotin and digoxigenin) oligonucleotide probes, one complementary to the normal and the other to the mutant allele, were hybridized simultaneously to the membrane-bound DNA templates and reacted sequentially with the antibody-enzyme conjugates followed by the chemiluminescent substrate (Fig. 3A). The labeled oligonucleotides are 5'-biotin-ATATCATCTTFGGTGTTTCCT 3' (normal) and 5'-digoxigenin-GAAAATATCATTGGTGTITCC 3' (mutant) (Fig. 3B). All of the oligonucleotides used in this study have been custom synthesized by Oligos Etc., (Wilsonville, OR). The amplified PCR products of each genotype (100 ng) were electrophoresed on a 1% agarose gel for a short distance (1 cm) so that the PCR products of normal and AFs08 alleles differing by three nucleotides migrate as a single band, The gel was depurinated (0.25 M He1), denatured (0.5 N NaOH, 1.5 M NaCI), neutralized (0.5 M Tris-HCl, pH 7.5, 1.5 M NaC1), and vacublotted (Vacugene apparatus, Pharmacia, Uppsala, Sweden) onto a neutral nylon membrane (Hybond N, Amersham, Arlington Heights, IL). The blotted membrane was baked at 80°C for 2 hours and hybridized with the biotin- and digoxigenin-labeled oligonu-

A IIIl|lllllll IIIIIIIIIIIIIIIIIIIIIII

IIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIII

IIIIIIIIIIll IIIIIIIIIIIIIIIIIIIIIII

IIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIII

N/N

Fig. 3. (A) Schematic diagram of the hybridizationmethod. (B) DNA sequences of the target (wild-type and AFs0salleles) and of the complementary oligonucleotides probes used for the hybridization. The underlined trinucleotideis deleted (A) in the AFs08 allele. The hybridization method positively identifies the heterozygous (N/A) genotype. B, biotin; D, digoxigenin; AP, alkaline phosphatase; HRP, horseradish peroxidase.

A

IIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIII

A

IIIIIIIIIII IIIInlllllllllllllllll

NH,

~/a

~1=

Digoxigenln Biotin

II!11i11111 ll~lllllllllllllllillliillllll

till Illlllll IIIIIIIIIIIIIIIIIIIIIIIIIIIIII N/A

B

B

I

5' ATATCATCTTTGGTGTTTCCT 3' Oligonucleotide probe 3' TATAGTA~5~ACCACAAAGGA 5' Wildtype (antisense)

D

f

5" GAAAATATCATTGGTGTTTCC 3' 3" CTTTTATAGTAACCACAAAGG 5'

Oligonucleotide probe ~F508 (antisense)

Chemiluminescent Detection of CF~F508

cleotide probes as described below. The blot was prehybridized and hybridized at 52°C for 1 hour and overnight, respectively, using a buffer containing 6x SSC (0.9 M NaC1, 0.09 M sodium citrate, pH 7.0), 0.01 M EDTA, pH 8.0, 5x Denhardt's solution (0.1% Ficoll Type 400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.5% sodium dodecyl sulfate (SDS), and 100 ktg/mL denatured salmon sperm DNA (GIBCO/BRL, Life Technologies, Gaithersburg, MD). The posthybridization washes were done at 52°C for 20 minutes each in 2x SSC, 0.1% SDS and 0.5x SSC, 0.1% SDS.

Antibody-Enzyme and Chemiluminescent Substrate Treatments Both the antibody-enzyme and substrate treatments were performed at room temperature; the substrate incubations were done in the dark to protect the substrate from light. The membranes of both the ligation and hybridization experiments were first washed for 15 minutes in lx wash buffer (0.1 M maleic acid, 0.15 M NaC1, pH 7.5, 0.3% Tween 20) and blocked for 1 hour in 2% blocking buffer (Blocking Reagent [Boehringer-Mannheim] dissolved in 0.1 M maleic acid, 0.15 M NaCI, pH 7.5). The membrane with the ligation products was incubated for 30 minutes in anti-fluorescein-AP (Boehringer-Mannheim) and avidin-HRP (Pierce, Rockford, IL), whereas the hybridized membrane was treated for 30 minutes with anti-digoxigenin-AP (Boehringer-Mannheim) and avidin-HRP. The working concentrations of all the antibody-enzyme conjugates were 1:5000 dilutions in 2% blocking buffer. Although the avidin-HRP is not an antibody conjugated enzyme, for convenience it is referred to, along with the others, as an antibody-enzyme conjugate. Following the antibody-enzyme treatment, the membranes were washed twice for 20 minutes each in lx wash buffer and then reacted with the chemiluminescent substrate for 5 minutes. Excess substrate from the membrane was removed by placing and gently pressing the membrane between a pair of transparent sheets, which was then exposed to an x-ray film for a period generally ranging from a few seconds to minutes, to obtain optimal signal and background.

Results We report here two methods (ligation and hybridization) of detecting the CF AFso8 mutation and

•

Reddy et al.

117

the corresponding genotypes using a dual enzymebased (HRP-AP) substrate. In the ligation method, genotypes containing the mutated allele (N/AFso8 and AFso8/AF508) are positively identified. In the hybridization method, only the heterozygous genotype is detected, thus differentiating the heterozygous carrier from the homozygous mutant genotype.

Ligation Method As shown in Figure 4, the ligated oligonucleotide products containing both labels are present only in the N/AFs08 (lane 5) and AFs08/AFs08 (lane 6) genotypes but not in the wild type (lane 4). Further, the ligated product in the N/AFs08 genotype is less intense than in the AF508/AF5os. This is expected because the heterozygote contains only one copy of the allele with AFs08 mutation as compared with two alleles in the homozygote. Such discrimination of genotypes was possible by optimizing the concentrations of the template (200 ng) and the oligonu-

1

2

1

2

3

4

5

6

A

3

4

5

6

B Fig. 4. Electrophoretic analysis of the ligation products on 16% (A) and 20% (B) denaturing polyacrylamide gels. Lane 1, duallabeled (biotin and fluorescein) oligonucleotide as size marker (45-mer); lane 2, blank; lanes 3, 4, 5, and 6, ligation products without template (negative control) and with wild-type (N/N), heterozygous (N/AFs08), and homozygous (AFs08/AFs08) templates, respectively.

118

Molecular Diagnosis Vol. 2 No. 2 June 1997

cleotides (10 ng each). The unligated oligonucleotides differing by three nucleotides (21- and 24mers) and bearing two different labels are not separated on the 16% gel (short run) and thus yielded the chemiluminescent signal (Fig. 4A, lower band), whereas these unligated oligonucleotides are separated on the 20% gel (long run) and thus no signal is evident (Fig. 4B).

Hybridization Method As shown in Figure 5, hybridization with a pair of differentially labeled oligonucleotide probes, one complementary to the normal allele and the other to the AFs08 mutant allele, yielded a positive chemiluminescent signal only in the heterozygous (N/AFs08) genotype (lane 2). The wild-type and AFs08/AFs08 genotypes (lane 1 and 3), on the other hand, are negative because only one of the oligonucleotide probes, complementary to either the normal or mutant allele, hybridizes to each of these genotypes. The absence of the other labeled probe and its bound enzyme precludes light emission as expected.

1

2

Random Testing of Specimens of Individuals Without CF Both the ligation and hybridization methods were used to test DNA specimens of unknown CF genotype for F508 mutation. As shown in Figure 6, none of the four specimens tested produced positive signals by both the ligation (Fig. 6A, lanes 5, 6, 7, and 8) and hybridization (Fig. 6B, lanes 4, 5, 6, and 7) methods, indicating lack of the AFs08 mutation. As a positive control, a known heterozygous genotype in both methods yielded a strong positive signal by both methods (Fig. 6A, lane 4; Fig. 6B, lane 2).

1

2

3

4

5

6

7

8

A

3

1 2 3 4 5 6 7 i

B

Fig. 5. Southern hybridization analysis of wild-type N/N (lane 1), heterozygous N/AF508 (lane 2), and homozygous AFsos/AFso8 (lane 3) genotypes by simultaneous probing with normal (biotin-labeled) and mutant-specific (digoxigeninlabeled) oligonucleotide probes.

Fig. 6. Comparative analysis of known cystic fibrosis (CF) genotypes and random specimens of individuals without CF by the ligation (A) and Southern hybridization (B) methods. A: lane 1, dual-labeled (biotin and fluorescein) 45-mer as size marker; lane 2, blank; lanes 3 and 4, ligation products without template (negative control) and with heterozygous (N/Fs08) template, respectively; lanes 5-8, specimens of individuals without CE (B) Lanes 1-3, wild-type (N/N), heterozygous (N/AFros), and homozygous (AFs08/AFs08) genotypes, respectively: lanes 4-7, specimens of individuals without CE

Chemiiuminescent Detection of CFAF508

Discussion We have demonstrated the utility of a novel dual chemiluminescent substrate for differentiating the genotypes of the AFs08 mutation of CE The ligation and hybridization formats used here are examples of several formats that may be devised using this methodology for the detection of mutations. The electrophoretic resolution and transfer to a membrane can be avoided by devising an enzyme-linked immunosorbent assay-type detection format where one of the oligonucleotides used in the ligation and hybridization methods is immobilized. Such a format has recently been reported [15] in which one of the oligonucleotides was labeled with an acridinium ester and the other was immobilized on paramagnetic particles. Further, the substrate and assay systems presented here may be extended with a few modifications to the detection of single-base substitution mutations of CFTR and other genes. Thus, the data presented here may be viewed as a model with much broader applicability. As shown here, the ligation method of detection is template dependent and mutation specific. The simple procedure of denaturation of template, annealing of the oligonucleotides to the template by cooling on ice, and ligation at 15°C resulted in specific ligation of oligonucleotides in the genotypes carrying the mutation; no nonspecific ligation products were seen with the wild-type template or in the absence of template (negative control). Ligation at higher temperatures and/or for shorter periods, however, may be attempted for convenience and speed. Also, crosslinking of blotted DNA by ultraviolet irradiation may be preferable over baking at 80°C to improve binding of short single-stranded nucleic acids to the membrane [16]. In addition, we have found that nylon membrane of 0.2-~tm pore size retains shorter oligonucleotides (20- to 25-mers) better than the more commonly used 0.45-~m membrane. The hybridization experiment using the normal and mutant-specific oligonucleotides demonstrates the utility of the dual substrate system for positive identification of the carriers (N/AFs08) of AFs08 mutation. Although the identification of carriers can be achieved by using a single mutant-specific oligonucleotide for AFso8 when screening individuals with no clinical symptoms of CF, a positive result using a single AFs0s-specific oligonucleotide probe would not establish a true heterozygous carrier status (N/AFso8) if the other allele also has a mutation such as F508C.

•

Reddy et al.

119

Several cases of such compound heterozygosity have been reported [17]. On the other hand, when using both the normal and AFs08-specific probes such as used here with the dual substrate system, a positive result represents a true N/AFs08 status. A potential limitation of using the normal and AFs08-specific probes in the dual system is that a compound heterozygous genotype carrying the AFs08 (such as AFs08/Fs08C) would test negative for AFs08 status. In addition to the detection of mutations, the dual substrate and probe systems presented here have broader applicability. For example, this methodology can also be used for the detection of more than one nucleic acid entity, such as the presence of two different infectious agents in a clinical specimen, and for the detection of two different gene segments on a single DNA fragment, as in gene fusions resulting from chromosomal translocations. The hybridization and ligation formats reported here can be adapted for automation to reduce turnaround time, which is desirable for clinical laboratory setting.

Acknowledgment We thank the Department of Clinical Pathology, William Beaumont Hospital, for providing the laboratory facilities to carry out the experiments. Received Dec. 19, 1996. Received in revised form Feb. 10, 1997. Accepted Feb. 18, 1997.

References 1. Boat TF, Welsh MJ, Beaudet AL: Cystic fibrosis. In Scriver CL, Beaudet AL, Sly WS, Valle D: The metabolic basis of inherited disease. 6th ed. McGraw-Hill, New York, 1989, pp. 2649-2680 2. Kerem B, Rommens JM, Buchanan JA, Markiewicz D, Cox TK, Chakravarti A, Buchwald M, Tsui L-C: Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245:1073-1080 3. Cystic Fibrosis Genetic Analysis Consortium: Worldwide survey of the AFs08 mutation: report from the Cystic Fibrosis Genetic Analysis Consortium. Am J Hum Genet 1990;47:354-359 4. Lemna WK, Feldman GL, Kerem BS, Fernbach SD, Zevkovich EP, O'Brien WE, Riordan JR, Collins FS, Tsui L-C, Beaudet AL: Mutation analysis for heterozygote detection and prenatal diagnosis of cystic fibrosis. N Engl J Med 1990;322:291-296

120

Molecular Diagnosis Vol. 2 No. 2 June 1997

5. Highsmith WE, Chong GL, Orr HT, Perry TR, Schald D, Farber R, Wagner K, Knowles MR, Warwick WJ, Silverman LM, Thibodeau SN: Frequency of the delta Phe508 mutation and correlation with XV.2c/KM-19 haplotypes in an American population of cystic fibrosis patients: results of a collaborative study. Clin Chem 1990;36:1741-1746 6. Shoshani T, Augarten A, Gazit E, Bashan N, Yahav Y, Rivlin Y, Tal A, Seret H, Yaar L, Kerem E, Kerem B-S: Association of a nonsense mutation (W1282X), the most common mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel with presentation of severe disease. Am J Hum Genet 1992;50:222-228 7. Ballabio A, Gibbs RA, Caskey CT: PCR test for cystic fibrosis. Nature 1990;343:220 8. Newton CR, Schwartz M, Summers C, Hepinstall LE, Graham A, Smith JC, Super M, Markham AF: detection of AFs08 deletion by amplification refractory mutation system. Lancet 1990;335:1217-1219 9. Rommens JM, Kerem BS, Greer W, Chang P, Tsui LC, Ray P: Rapid non-radioactive detection of the major cystic fibrosis mutation. Am J Hum Genet 1990;46: 395-396 10. Haliassos A, Chomel JC, Teeson L, et al: Modification of enzymatically amplified DNA for the detection of point mutations. Nucleic Acids Res 1989;17:3606 11. Ng ISL, Pace R, Richard MV, Kobayashi K, Kerem BS, Tsui L-C, Beaudet AL: Methods for analysis of multiple cystic fibrosis mutations. Hum Genet 1991; 87:613-617

12. Dean M, White MB, Amos J, Gerrard B, Srewart C, Khaw K-T, Leppert M: Multiple mutations in highly conserved residues are found in mildly affected cystic fibrosis patients. Cell 1990;61:863-870 13. Serre JI, Taillandier A, Mornt E, Simon-Buoy B, Boue J, Boue A: Nearly 80% of cystic fibrosis heterozygous genotype and 64% of couples art risk may be detected through a unique screening of four mutations by ASO reverse dot blot. Genomics 1991;I 1: 1149-1151 14. Akhavan-Tafti H, Sugioka Y, Sugioka K, DeSilva R, Arghavani Z, Handley RS, Schoenfelner BA, Schaap AP: Chemiluminescent detection of DNA with dual enzyme labels. Clin Chem 1995;41:1683 15. Martinelli RA, Arruda JC, Dwivedi P: Chemiluminescent hybridization-ligation assays for AFs08 and AI507 cystic fibrosis mutations. Clin Chem 1996; 42:14-18 16. Creasy A, D'Angio Jr L, Dunne TS, Kissinger C, O'Keeffe T, Perry-O'Keeffe H, Moran LS, Roskey M, Schildkraut I, Sears LE, Saltko B: Application of a novel chemiluminescence based DNA detection method to single-vector and multiplex DNA sequencing. Biotechniques 1991 ;I 1:102-109 17. Dufourcq R, Vuillaumier S, Pascaud O, Guidal C, Oury J-F, Elion J, Denamur E: Compound heterozygosity for AFs0s and F308C: a cautionary note on the molecular diagnosis of cystic fibrosis. Prenat Diagn 1994; 14:1176-1177