- Email: [email protected]
Novel CLN1 mutation in two Italian sibs with late infantile neuronal ceroid lipofuscinosis
EUROPEAN JOURNAL OF PAEDIATRIC NEUROLOGY
10 (2006) 154–156
Official Journal of the European Paediatric Neurology Society
Case study
Novel CLN1 mutation in two Italian sibs with late infantile neuronal ceroid lipofuscinosis Maria Bonsignorea,*, Alessandra Tessab, Gabriella Di Rosaa,b, Fiorella Piemonteb, Carlo Dionisi-Vicib, Alessandro Simonatic, Filippo Calamoneria, Gaetano Tortorellaa, Filippo M. Santorellib a Division of Infantile, Neuropsychiatry, Department of Medical and Surgical Pediatrics, University of Messina, via Consolare Valeria 98125 Messina, Italy b Molecular Medicine and Metabolic Unit, IRCCS-Bambino Gesu`, Hospital, Rome, Italy c Department of Neurosciences, University of Verona, Verona, Italy
A R T I C L E
I N F O
A B S T R A C T
Article history:
We detected a novel CLN1 mutation (c.125-15tOg) in two Italian siblings. The clinical
Received 4 December 2005
phenotype is that of a variant late-infantile neuronal ceroid lipofuscinosis and consisted of
Received in revised form
early-onset visual loss, psychomotor deterioration, and seizures. Ultrastructurally, granular
27 April 2006
osmiophilic deposits were found in skin biopsy of both patients. The novel mutation occurs
Accepted 28 April 2006
in the acceptor sequences for splicing and leads to skipping of multiple exons. This predicts a protein lacking part or all of the active site of the enzyme and the palmitate-binding pocket. Consequently, biochemical activity of the palmitoyl protein thioesterase-1 enzyme
Keywords:
was drastically reduced. The new mutation was not identified in a large set of ethnically
CLN1
matched control chromosomes. Our findings support the notion that CLN1 patients are not
LINCL
rare in Southern Europe and facilitate DNA-based mutation and carrier testing in this
GRODs
family.
Novel mutation
Q 2006 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
1.
Introduction
Neuronal ceroid lipofuscinoses (NCLs) are rare autosomal recessive neurodegenerative disorders typically characterized by the accumulation of autofluorescent material in brain and other tissues. Six out of the nine forms thus far reported have a known gene defect.1 An infantile form of NCL (INCL) (MIM 256730) was initially described in Finland where the vast majority of the patients carry a common mutation in CLN1 (MIM 600722).1 However, INCL cases have been discovered in other countries and this form seems particularly frequent in US and Northern
Europe.2 Interestingly, mutations in CLN1 have also been associated with variant late-infantile (v-LINCL), juvenile (JNCL), and even adult (ANCL) onset forms of the disease.1 On the whole, deficient biochemical activity of the lysosomal enzyme palmitoyl protein thioesterase-1 (PPT1) and ultrastructural evidence of granular osmiophilic deposits (GRODs) in tissues revealed sequence variants in CLN1, even when onset is beyond infancy. In setting up a complete biochemical and molecular genetic screening for known NCL f orms in Italy, we identified two siblings with a variant LINCL harbouring a novel mutation in CLN1.
* Corresponding author. Tel.: C39 090 2212920; fax: C39 090 2930414. E-mail address: [email protected] (M. Bonsignore). 1090-3798/$ - see front matter Q 2006 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ejpn.2006.04.002
EUROPEAN JOURNAL OF PAEDIATRIC NEUROLOGY
2.
Case study
Patient 1 was a 13-year-old boy who had a normal perinatal and neonatal period. At 2 years of age, his parents noticed regression in gross and fine motor abilities. At 3 years, he was admitted to our hospital because of severe psychomotor delay, blindness, microcephaly (OFC!38), myoclonic jerks, and sporadic generalized seizures. Neurological examination showed spasticity at the four limbs, loss of deambulation, brisk deep tendon reflexes, and bilateral Babinski sign. A brain magnetic resonance imaging (MRI) showed diffuse cerebral and cerebellar atrophy (Fig. 1A and B). An electroencephalogram (EEG) displayed a high-voltage slow wave pattern. Visual (VEP), brainstem (BAEP), and somatosensory (SEP) evoked potentials showed increased amplitude. Electron microscopy in cultured skin fibroblasts revealed typical GRODs. The patient showed severe deterioration at follow-up; at last examination he had difficulty in swallowing and lost most of his motor, visual and cognitive abilities. Seizures were partially controlled by a combination of phenobarbital (100 mg/d) and carbamazepine (700 mg/d). Patient 2 was the 11-year-old sister of patient 1. She had normal psychomotor development. At 2.5 years of age she presented myoclonic jerks following a febrile illness. Shortly after, she had an arrest of psychomotor development with progressive loss of previously acquired skills. Neurological examination at 3 years revealed microcephaly (OFC!38), poor visual contact, absence of language skills, difficult walking, spasticity at the four limbs, and pyramidal tract signs. EEG revealed poorly structured cerebral activity. A brain MRI showed diffuse brain atrophy. Fundus oculi showed optic atrophy. VEPs and BAEPs presented abnormal amplitudes. Ultrastructurally, we found typical GRODs in a skin biospy. The patient’s neurological conditions have been progressively deteriorating; she is now unable to walk unaided and has severe spasticity. On the other hand, seizures are well controlled (phenobarbital 100 mg/day and carbamazepine 700 mg/day). PPT1 enzyme activity was assayed in peripheral blood leukocytes and cultured skin fibroblasts by monitoring fluorescence release of 4-methylumbelliferone in a LS-50B Perkin–Elmer fluorometer, as reported previously.4 Enzyme activity was markedly reduced in leukocytes from both siblings (0.3 nmol/h/mg, normal values 25–95). It was also deficient in cultured skin fibroblasts from patient 1 (1.4 nmol/ h/mg, normal values 30–80). Direct sequencing of the CLN1 gene (GenBank NC_000001.8; GI: 51511461) identified the novel homozygous c.125-15tOg mutation. Numbering of the mutation considered nucleotide 59 of the cDNA (Genbank NM_000310.2; GI: 50726955) as C1 of the initiation codon. The presence of the mutation in the patients and their relatives, and its absence in 500 normal controls was also tested by a specific PCR-restriction fragment length polymorphism (PCRRFLP) analysis (Fig. 1c). Cultured skin fibroblast polyAC RNA was purified and reversely transcribed using the first Strand cDNA Synthesis Kit (Roche, Hamburg, Germany) and oligonucleotide primers CLN1-F (5 0 –3 0 GTGACACAGCGAAGATGGCG) and CLN1-R (5 0 -3 0 GTGGTTTGGAAGAGTTAGGG). PCR conditions to amplify the entire coding sequence of CLN1 were 5 min at 94 8C, followed by 35 cycles as follow: 1 min at 94 8C,
10 (2006) 154–156
155
2 min at 58 8C, 2 min at 72 8C, and a 7-min extension at 72 8C. Fragments were gel-purified and sequenced with the same primers using BigDye 3.1 chemistry.
3.
Discussion
The clinical spectrum of diseases due to mutations in the CLN1 gene is extremely wide, with age of onset varying from infancy to adulthood.1 The majority of patients are diagnosed within early infancy and in most the first symptoms are seen within the first 2 years of life. The INCL form is common worldwide but in Finland is quite molecularly homogenous with very few cases developing symptoms in late childhood and adolescence. Wisniewski and colleagues reported five patients with a late infantile onset clinical phenotype and PPT deficiency. All had the ultrastructural appearance of GRODs. The clinical features of those children were not clearly different from cases presenting with classical LINCL caused by CLN2 mutations.2 Das and colleagues reported that 50% of their Northern American cases with mutations in CLN1 developed the disease later in life. Among these, five patients (17%) received a clinical diagnosis of LINCL.3 Finally, an Italian child with a homozygous p.Leu222Pro mutation in exon 7 was reported to have clinical features consistent with early-juvenile NCL. Diagnosis was possible after detecting GRODs in a skin biopsy.5 Comparison of our patients with previous reports reveals few differences. Onset occurred after the age of 2 years, and unsteady gait and myoclonic jerks were the presenting symptoms. Retinal degeneration and visual failure occurred later. The patients are now in their early teens and cannot walk. Spasticity, dystonic posturing and tremor are also observed. Recent brain MRIs showed severe progression of the brain atrophy. Ultrastructural detection of GRODs and deficient PPT1 activity in blood led to the identification of a novel mutation in CLN1. Forty-three mutations have now been described in CLN1 distributed throughout the gene. Mutations include 20 missense, 9 nonsense, 10 small deletions or insertions, and four mutations affecting splice sites (1, see also www.ucl.ac. uk/ncl/MutationDatabase.html). Invariably, all the cases of NCL caused by mutations in CLN1 are associated with a granular appearance of the stored material. Patients from certain countries share common mutations that make it possible to test affected and carrier status. For instance, patients of Scottish or Irish origin bear the common p.Thr75Pro and p.Leu10Stop mutations.1 On the other hand, p.Arg122Trp is frequent in Finland.1 The novel mutation identified in this work occurs in intron 1 of CLN1, in the polypyrimidine tract of the acceptor sequences for splicing, and leads to multiple exon skipping (Fig. 1D). Whereas multiple mutant transcripts were detected by RT-PCR in skin, the two most abundant lacked the sequences of exon 2 and exons 2–4. Although it would be tempting to speculate that the presence of multiple transcripts in somehow influence age of onset and clinical severity, this appears not the case of our patients. The two most abundant transcripts predicted a protein prematurely truncated at residues 63 and 203, respectively, and missing part or all of the active site of the enzyme (residues
156
EUROPEAN JOURNAL OF PAEDIATRIC NEUROLOGY
10 (2006) 154–156
Fig. 1 – Brain MRI showing diffuse cerebral and cerebellar atrophy are seen in sagittal (A) and coronal (B) sections in patient 1. (C) The presence of the c.125-15tOg mutation in this family was tested by PCR-restriction fragment length polymorphism (PCR-RFLP) analysis. An 849 base pair (bp) fragment was amplified using oligonucleotide primers CLN1-2F (5 0 –3 0 AAGTTGTAACATGTGTCAGCAC) and CLN1-2R (5 0 –3 0 AACAGCTGTGAAGCGCCTTAC). PCR conditions were the following: 2 min at 94 8C, followed by 30 cycles as follows: 1 min at 94 8C, 1 min at 58 8C, 1 min at 72 8C, and 5-min extension at 72 8C. The amplicon is normally cleaved with the endonuclease BslI (New England BioLabs Inc., Beverly, MA) into fragments sized 825 (red arrow-head), and 24 bp (not shown). The presence of the c.125-15tOg mutation introduces an additional single site of cleavage producing fragments sized 701 and 124 (black arrow-heads), and 24-bp. Fragments were resolved on a Metaphor 2%-agarose 1% gel and stained with ethidium bromide. Individuals are as in the superimposed pedigree. U, uncut fragment; C, normal control; M, DNA molecular marker size. (D) PCR amplification of CLN1 cDNA from cultured skin fibroblasts. When compared to a normal control (Ctrl), patient III-10 showed at least three alternativelyspliced transcripts (SA1-SA3) as the products of the novel mutation in intron 1. Direct sequencing of the two most abundant transcripts lacked the sequences of exon 2 and exons 2–4, respectively.
Ser115-Asp233-His289) and the palmitate-binding pocket. Thus, the severe effect on the geometry of the active site or the conformation of PPT1 does not seem to correlate with a lateonset phenotype nor with a longer survival. Other unknown genetic factors are supposed to modify the course of the disease in such patients. To summarize, our findings expand the number of CLN1 variants known worldwide and confirm that variant forms of LINCL with GRODs are not rare. These observations might suggest that cases of late-infantile onset epilepsy should be investigated with appropriate morphological and biochemical testing before a correct molecular diagnosis is proposed.
Acknowledgements Research in our laboratories was partially funded by the Italian Ministry of Health. We are indebted to Dr Steven
Chance, Fellow in Clinical Neurology at the University of Oxford, for kindly reviewing and editing the manuscript. R E F E R E N C E S
1. Mole SE, Williams RE, Goebel HH. Correlations between genotype, ultrastructural morphology and clinical phenotype in the neuronal ceroid lipofuscinoses. Neurogenetics 2005;6:107–26. 2. Wisniewski KE, Connell F, Kaczmarski W, et al. Palmitoylprotein thioesterase deficiency in a novel granular variant of LINCL. Pediatr Neurol 1998;18:119–23. 3. Das AK, Becerra CHR, Won YI, et al. Molecular genetics of palmitoyl-protein thioesterase deficiency in the US. J Clin Invest 1998;102:361–70. 4. Van Diggelen OP, Keulemans JLM, Winchester B, et al. A rapid fluorogenic palmitoyl-protein thioesterase-assay: pre- and postnatal diagnosis of INCL. Mol Gen Metab 1999;66:240–4. 5. Mazzei R, Conforti FL, Magariello A. A novel mutation in the CLN1 gene in a patient with juvenile neuronal ceroid lipofuscinosis. J Neurol 2002;249:1398–400 [CLN1 mutation in LINCL 8].
10 (2006) 154–156
Official Journal of the European Paediatric Neurology Society
Case study
Novel CLN1 mutation in two Italian sibs with late infantile neuronal ceroid lipofuscinosis Maria Bonsignorea,*, Alessandra Tessab, Gabriella Di Rosaa,b, Fiorella Piemonteb, Carlo Dionisi-Vicib, Alessandro Simonatic, Filippo Calamoneria, Gaetano Tortorellaa, Filippo M. Santorellib a Division of Infantile, Neuropsychiatry, Department of Medical and Surgical Pediatrics, University of Messina, via Consolare Valeria 98125 Messina, Italy b Molecular Medicine and Metabolic Unit, IRCCS-Bambino Gesu`, Hospital, Rome, Italy c Department of Neurosciences, University of Verona, Verona, Italy
A R T I C L E
I N F O
A B S T R A C T
Article history:
We detected a novel CLN1 mutation (c.125-15tOg) in two Italian siblings. The clinical
Received 4 December 2005
phenotype is that of a variant late-infantile neuronal ceroid lipofuscinosis and consisted of
Received in revised form
early-onset visual loss, psychomotor deterioration, and seizures. Ultrastructurally, granular
27 April 2006
osmiophilic deposits were found in skin biopsy of both patients. The novel mutation occurs
Accepted 28 April 2006
in the acceptor sequences for splicing and leads to skipping of multiple exons. This predicts a protein lacking part or all of the active site of the enzyme and the palmitate-binding pocket. Consequently, biochemical activity of the palmitoyl protein thioesterase-1 enzyme
Keywords:
was drastically reduced. The new mutation was not identified in a large set of ethnically
CLN1
matched control chromosomes. Our findings support the notion that CLN1 patients are not
LINCL
rare in Southern Europe and facilitate DNA-based mutation and carrier testing in this
GRODs
family.
Novel mutation
Q 2006 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
1.
Introduction
Neuronal ceroid lipofuscinoses (NCLs) are rare autosomal recessive neurodegenerative disorders typically characterized by the accumulation of autofluorescent material in brain and other tissues. Six out of the nine forms thus far reported have a known gene defect.1 An infantile form of NCL (INCL) (MIM 256730) was initially described in Finland where the vast majority of the patients carry a common mutation in CLN1 (MIM 600722).1 However, INCL cases have been discovered in other countries and this form seems particularly frequent in US and Northern
Europe.2 Interestingly, mutations in CLN1 have also been associated with variant late-infantile (v-LINCL), juvenile (JNCL), and even adult (ANCL) onset forms of the disease.1 On the whole, deficient biochemical activity of the lysosomal enzyme palmitoyl protein thioesterase-1 (PPT1) and ultrastructural evidence of granular osmiophilic deposits (GRODs) in tissues revealed sequence variants in CLN1, even when onset is beyond infancy. In setting up a complete biochemical and molecular genetic screening for known NCL f orms in Italy, we identified two siblings with a variant LINCL harbouring a novel mutation in CLN1.
* Corresponding author. Tel.: C39 090 2212920; fax: C39 090 2930414. E-mail address: [email protected] (M. Bonsignore). 1090-3798/$ - see front matter Q 2006 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ejpn.2006.04.002
EUROPEAN JOURNAL OF PAEDIATRIC NEUROLOGY
2.
Case study
Patient 1 was a 13-year-old boy who had a normal perinatal and neonatal period. At 2 years of age, his parents noticed regression in gross and fine motor abilities. At 3 years, he was admitted to our hospital because of severe psychomotor delay, blindness, microcephaly (OFC!38), myoclonic jerks, and sporadic generalized seizures. Neurological examination showed spasticity at the four limbs, loss of deambulation, brisk deep tendon reflexes, and bilateral Babinski sign. A brain magnetic resonance imaging (MRI) showed diffuse cerebral and cerebellar atrophy (Fig. 1A and B). An electroencephalogram (EEG) displayed a high-voltage slow wave pattern. Visual (VEP), brainstem (BAEP), and somatosensory (SEP) evoked potentials showed increased amplitude. Electron microscopy in cultured skin fibroblasts revealed typical GRODs. The patient showed severe deterioration at follow-up; at last examination he had difficulty in swallowing and lost most of his motor, visual and cognitive abilities. Seizures were partially controlled by a combination of phenobarbital (100 mg/d) and carbamazepine (700 mg/d). Patient 2 was the 11-year-old sister of patient 1. She had normal psychomotor development. At 2.5 years of age she presented myoclonic jerks following a febrile illness. Shortly after, she had an arrest of psychomotor development with progressive loss of previously acquired skills. Neurological examination at 3 years revealed microcephaly (OFC!38), poor visual contact, absence of language skills, difficult walking, spasticity at the four limbs, and pyramidal tract signs. EEG revealed poorly structured cerebral activity. A brain MRI showed diffuse brain atrophy. Fundus oculi showed optic atrophy. VEPs and BAEPs presented abnormal amplitudes. Ultrastructurally, we found typical GRODs in a skin biospy. The patient’s neurological conditions have been progressively deteriorating; she is now unable to walk unaided and has severe spasticity. On the other hand, seizures are well controlled (phenobarbital 100 mg/day and carbamazepine 700 mg/day). PPT1 enzyme activity was assayed in peripheral blood leukocytes and cultured skin fibroblasts by monitoring fluorescence release of 4-methylumbelliferone in a LS-50B Perkin–Elmer fluorometer, as reported previously.4 Enzyme activity was markedly reduced in leukocytes from both siblings (0.3 nmol/h/mg, normal values 25–95). It was also deficient in cultured skin fibroblasts from patient 1 (1.4 nmol/ h/mg, normal values 30–80). Direct sequencing of the CLN1 gene (GenBank NC_000001.8; GI: 51511461) identified the novel homozygous c.125-15tOg mutation. Numbering of the mutation considered nucleotide 59 of the cDNA (Genbank NM_000310.2; GI: 50726955) as C1 of the initiation codon. The presence of the mutation in the patients and their relatives, and its absence in 500 normal controls was also tested by a specific PCR-restriction fragment length polymorphism (PCRRFLP) analysis (Fig. 1c). Cultured skin fibroblast polyAC RNA was purified and reversely transcribed using the first Strand cDNA Synthesis Kit (Roche, Hamburg, Germany) and oligonucleotide primers CLN1-F (5 0 –3 0 GTGACACAGCGAAGATGGCG) and CLN1-R (5 0 -3 0 GTGGTTTGGAAGAGTTAGGG). PCR conditions to amplify the entire coding sequence of CLN1 were 5 min at 94 8C, followed by 35 cycles as follow: 1 min at 94 8C,
10 (2006) 154–156
155
2 min at 58 8C, 2 min at 72 8C, and a 7-min extension at 72 8C. Fragments were gel-purified and sequenced with the same primers using BigDye 3.1 chemistry.
3.
Discussion
The clinical spectrum of diseases due to mutations in the CLN1 gene is extremely wide, with age of onset varying from infancy to adulthood.1 The majority of patients are diagnosed within early infancy and in most the first symptoms are seen within the first 2 years of life. The INCL form is common worldwide but in Finland is quite molecularly homogenous with very few cases developing symptoms in late childhood and adolescence. Wisniewski and colleagues reported five patients with a late infantile onset clinical phenotype and PPT deficiency. All had the ultrastructural appearance of GRODs. The clinical features of those children were not clearly different from cases presenting with classical LINCL caused by CLN2 mutations.2 Das and colleagues reported that 50% of their Northern American cases with mutations in CLN1 developed the disease later in life. Among these, five patients (17%) received a clinical diagnosis of LINCL.3 Finally, an Italian child with a homozygous p.Leu222Pro mutation in exon 7 was reported to have clinical features consistent with early-juvenile NCL. Diagnosis was possible after detecting GRODs in a skin biopsy.5 Comparison of our patients with previous reports reveals few differences. Onset occurred after the age of 2 years, and unsteady gait and myoclonic jerks were the presenting symptoms. Retinal degeneration and visual failure occurred later. The patients are now in their early teens and cannot walk. Spasticity, dystonic posturing and tremor are also observed. Recent brain MRIs showed severe progression of the brain atrophy. Ultrastructural detection of GRODs and deficient PPT1 activity in blood led to the identification of a novel mutation in CLN1. Forty-three mutations have now been described in CLN1 distributed throughout the gene. Mutations include 20 missense, 9 nonsense, 10 small deletions or insertions, and four mutations affecting splice sites (1, see also www.ucl.ac. uk/ncl/MutationDatabase.html). Invariably, all the cases of NCL caused by mutations in CLN1 are associated with a granular appearance of the stored material. Patients from certain countries share common mutations that make it possible to test affected and carrier status. For instance, patients of Scottish or Irish origin bear the common p.Thr75Pro and p.Leu10Stop mutations.1 On the other hand, p.Arg122Trp is frequent in Finland.1 The novel mutation identified in this work occurs in intron 1 of CLN1, in the polypyrimidine tract of the acceptor sequences for splicing, and leads to multiple exon skipping (Fig. 1D). Whereas multiple mutant transcripts were detected by RT-PCR in skin, the two most abundant lacked the sequences of exon 2 and exons 2–4. Although it would be tempting to speculate that the presence of multiple transcripts in somehow influence age of onset and clinical severity, this appears not the case of our patients. The two most abundant transcripts predicted a protein prematurely truncated at residues 63 and 203, respectively, and missing part or all of the active site of the enzyme (residues
156
EUROPEAN JOURNAL OF PAEDIATRIC NEUROLOGY
10 (2006) 154–156
Fig. 1 – Brain MRI showing diffuse cerebral and cerebellar atrophy are seen in sagittal (A) and coronal (B) sections in patient 1. (C) The presence of the c.125-15tOg mutation in this family was tested by PCR-restriction fragment length polymorphism (PCR-RFLP) analysis. An 849 base pair (bp) fragment was amplified using oligonucleotide primers CLN1-2F (5 0 –3 0 AAGTTGTAACATGTGTCAGCAC) and CLN1-2R (5 0 –3 0 AACAGCTGTGAAGCGCCTTAC). PCR conditions were the following: 2 min at 94 8C, followed by 30 cycles as follows: 1 min at 94 8C, 1 min at 58 8C, 1 min at 72 8C, and 5-min extension at 72 8C. The amplicon is normally cleaved with the endonuclease BslI (New England BioLabs Inc., Beverly, MA) into fragments sized 825 (red arrow-head), and 24 bp (not shown). The presence of the c.125-15tOg mutation introduces an additional single site of cleavage producing fragments sized 701 and 124 (black arrow-heads), and 24-bp. Fragments were resolved on a Metaphor 2%-agarose 1% gel and stained with ethidium bromide. Individuals are as in the superimposed pedigree. U, uncut fragment; C, normal control; M, DNA molecular marker size. (D) PCR amplification of CLN1 cDNA from cultured skin fibroblasts. When compared to a normal control (Ctrl), patient III-10 showed at least three alternativelyspliced transcripts (SA1-SA3) as the products of the novel mutation in intron 1. Direct sequencing of the two most abundant transcripts lacked the sequences of exon 2 and exons 2–4, respectively.
Ser115-Asp233-His289) and the palmitate-binding pocket. Thus, the severe effect on the geometry of the active site or the conformation of PPT1 does not seem to correlate with a lateonset phenotype nor with a longer survival. Other unknown genetic factors are supposed to modify the course of the disease in such patients. To summarize, our findings expand the number of CLN1 variants known worldwide and confirm that variant forms of LINCL with GRODs are not rare. These observations might suggest that cases of late-infantile onset epilepsy should be investigated with appropriate morphological and biochemical testing before a correct molecular diagnosis is proposed.
Acknowledgements Research in our laboratories was partially funded by the Italian Ministry of Health. We are indebted to Dr Steven
Chance, Fellow in Clinical Neurology at the University of Oxford, for kindly reviewing and editing the manuscript. R E F E R E N C E S
1. Mole SE, Williams RE, Goebel HH. Correlations between genotype, ultrastructural morphology and clinical phenotype in the neuronal ceroid lipofuscinoses. Neurogenetics 2005;6:107–26. 2. Wisniewski KE, Connell F, Kaczmarski W, et al. Palmitoylprotein thioesterase deficiency in a novel granular variant of LINCL. Pediatr Neurol 1998;18:119–23. 3. Das AK, Becerra CHR, Won YI, et al. Molecular genetics of palmitoyl-protein thioesterase deficiency in the US. J Clin Invest 1998;102:361–70. 4. Van Diggelen OP, Keulemans JLM, Winchester B, et al. A rapid fluorogenic palmitoyl-protein thioesterase-assay: pre- and postnatal diagnosis of INCL. Mol Gen Metab 1999;66:240–4. 5. Mazzei R, Conforti FL, Magariello A. A novel mutation in the CLN1 gene in a patient with juvenile neuronal ceroid lipofuscinosis. J Neurol 2002;249:1398–400 [CLN1 mutation in LINCL 8].