- Email: [email protected]
Novel isolation strategy to deliver pure fetal-origin and maternal-origin mesenchymal stem cell (MSC) populations from human term placenta
Placenta 35 (2014) 969e971
Contents lists available at ScienceDirect
Placenta journal homepage: www.elsevier.com/locate/placenta
Short communication
Novel isolation strategy to deliver pure fetal-origin and maternalorigin mesenchymal stem cell (MSC) populations from human term placenta J. Patel a, A. Shafiee a, W. Wang a, N.M. Fisk a, b, K. Khosrotehrani a, c, * a b c
The University of Queensland, UQ Centre for Clinical Research, Herston, QLD, 4029, Australia Centre for Advanced Prenatal Care, Women's & Newborn Services, Royal Brisbane & Women's Hospital, Herston, QLD, 4029, Australia The University of Queensland, UQ Diamantina Institute, Translational Research Institute, Woolloongabba, QLD, 4102, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 2 September 2014
The placenta is an abundant source of mesenchymal stem/stromal cells (MSC). Although presumed of translationally-advantageous fetal origin, the literature instead suggests a high incidence of either contaminating or pure maternal MSC. Despite definitional criteria that MSC are CD34, increasing evidence suggests that fetal MSC may be CD34 positive in vivo. We flow sorted term placental digests based on CD34þ expression and exploited differential culture media to isolate separately pure fetal and maternal MSC populations. This method has considerable translational implications, in particular to clinical trials underway with “placental” MSC of uncertain or decidual origin. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Mesenchymal stem cells Fetal Maternal Placenta Chorion Decidua
1. Introduction The human term placenta has long been touted as a plentiful source of fetal stem cells, due to its large size and presumed fetal origin [1]. Because mesenchymal stem/stromal cells (MSC) migrate to sites of injury and help repair damaged tissue [2], they have generated substantial interest in regenerative medicine for use as cell therapy [2e5], and are the predominant cell type in clinical trials. In particular fetal MSCs (fMSC) are reported to have higher proliferative capacity and broader differentiation potential. However, a scaleable clinically-accessible source of fMSC has yet to be established given the ethical and legal constraints of sourcing abortal tissue. MSC cultures from the term placenta have surprisingly yielded mixtures of both fetal and maternal, presumably decidual-origin cells, including pure populations of maternal origin cells after serial passaging [6]. Finding a marker unique to fetal cells is one avenue to separating the two populations. Although MSC are considered negative for haematopoietic surface markers, in vivo analyses of fMSC
* Corresponding author. UQ Centre for Clinical Research, Building 71/918, University of Queensland, Herston Campus, Brisbane, 4029, Australia. Tel.: þ61 7 3346 6077. E-mail addresses: [email protected] (J. Patel), [email protected] (K. Khosrotehrani). http://dx.doi.org/10.1016/j.placenta.2014.09.001 0143-4004/© 2014 Elsevier Ltd. All rights reserved.
populations from several tissues were in fact CD34 positive (CD45 negative) prior to culturing [7,8]. We have documented non-haematopoietic CD34þ fetal cells within term placenta, although these are predominantly endothelial [9,10]. Thus, we aimed to devise a sorting strategy to separately obtain fMSC and maternal (mMSC) from human term placenta, using CD34 as a marker of fMSC. 2. Methods 2.1. Placental tissue Whole placentas (n ¼ 5) were obtained from healthy women undergoing caesarean, delivering male babies at term (38e39 weeks). Ethics approval was obtained from both the Royal Brisbane and Women's Hospital and The University of Queensland. Tissue digest and preparation of magnetic separation of CD34þ cells was conducted as published from our laboratory [10].
2.2. Fluorescence activated cell sorting (FACS) Further purification was conducted via FACS. Cells were incubated with human CD34phycoerythrin (PE) (AbDSerotec, Raleigh, USA), human CD31V450 (BD Biosciences, Franklin Lakes, USA) and human CD45 fluorescein isothiocyanate (FITC) (BioLegend, San Diego, USA) antibodies and incubated for 20 min at 4 C. Matched conjugated mouse immunoglobulin G1 (IgG1) was used for isotype controls (BDBiosciences). Cells were sorted using a FACS Aria 11u (BD Biosciences). Only CD34þ cells were gated after removing contaminating CD45þ cells. CD34þ gated cells were analysed for CD31 expression against isotype controls. CD34þCD45CD31 cells were sorted directly into 100% FBS. MSC characterisation antibodies: PE CD29; FITC CD44; APC CD73; PECy5 CD90, FITC CD105, all from BD Biosciences.
970
J. Patel et al. / Placenta 35 (2014) 969e971
2.3. Cell culture All tissue culture plates/flasks (Nunc, Roskilde, Denmark) were initially precoated with a rat tail collagen type 1 solution (SigmaeAldrich, St. Louis, MO). The flow sorted cells were plated into either EGM-2 (Lonza, Mount Waverley, Victoria, Australia) or DMEM (Invitrogen, Mulgrave, Victoria, Australia) supplemented with 10% fetal bovine serum (FBS) (Invitrogen). 2.4. PCR Genomic DNA (gDNA) was obtained using a QIAGEN All Prep DNA/RNA Mini Kit (Qiagen, Valencia, CA) as per manufactures guide. The following SRY primers were used Forward AGCAGTCAGGGAGGCAGATCA; Reverse CCCCCTAGTACCCTGACAATGTAT. The following GAPDH primers were used Forward GGTGAAGGTCGGAGT; Reverse CAAAGTTGTCATGGA. 2.5. Mesodermal lineage differentiation At passage 4, human placental fMSC and mMSC were used for osteogenic and adipogenic differentiation, as previously described [11]. 2.6. Fluorescence in-situ hybridisation (FISH) Fluorescent in-situ hybridisation (FISH) analysis for X and Y chromosomes were then conducted as per manufacturer's protocol [12] (Abbott Molecular, Illinois, USA). A Zeiss Axio microscope (Carl Zeiss, North Ryde, Australia) was used to analyse slides and capture images.
3. Results and discussion We used a tissue digest from human term placenta to interrogate MSC populations based on specific cell surface marker expression, namely CD34 positive but negative for the haematopoietic marker CD45 and endothelial marker CD31. Using this strategy, to our surprise plating CD34þCD45CD31 in EGM-2 resulted in large quantities of pure MSC colonies, which rapidly became confluent (Fig. 1AeB). The CD34þCD45CD31þ fraction yielded endothelial colonies as we previously reported [10].
Similarly CD34CD45 cells initially used as control populations also resulted in larger MSC-like colonies (not shown). We next cultured both CD34þCD45CD31 and CD34CD45 populations in DMEM with 10% FBS, a more classical MSC culture medium. Interestingly, CD34þCD45CD31 cells did not give rise to any colonies whereas CD34CD45cells resulted in MSC-like colonies (Fig. 1BeC). In colonies obtained from CD34þCD45CD31 cells, 100% (200 cells counted per donor) of observed cells from passage 2 to 8 were fetal in origin, documented by X and Y chromosome FISH, regardless of whether cultured in EGM-2 or DMEM (Fig. 2A). In contrast, 100% of the progeny of CD45CD34cells were stably maternal over multiple passages (Fig. 2A). The fetal nature of the cells obtained was further confirmed by conducting SRY PCR (Fig. 2B). Finally, isolated fMSC and mMSC were able to differentiate down both osteogenic and adipogenic lineages (Fig. 2C) and were positive for markers CD29, CD44, CD73, CD90, CD105 and negative for CD31, CD34 and CD45 through flow cytometry (Fig. 2D) confirming their MSC nature. fMSC colonies could begin to be observed after 7 days in culture and by day 14 were confluent. Interestingly, this was observed only when cells were directly plated in EGM-2 following FACS sorting. Cells plated onto DMEM did not expand and mostly did not appear healthy. Previous reports have required different culture medium strategies to allow fetal cells to propagate [7], including fMSC outgrowth from cord blood [13]. After initial passage in EGM2, we were able to expand these cells in DMEM. In contrast mMSCs grew readily in DMEM, suggesting that the predominant mMSC isolation found in most studies of unsorted placenta may be related to this differential ability of fMSC and mMSC to grow in DMEM. Our work addresses the hitherto-confusing donor source and mixed culture constraints of placental MSC cultures allowing
Fig. 1. Flow sorting and culture strategy to obtain pure fetal mesenchymal stem cells (fMSC). (A) To obtain pure fMSC populations, CD34þCD45 cells were gated and then interrogated for the endothelial marker CD31 to remove endothelial cells. (B) All CD34þCD45CD31 cells were plated directly into both EGM-2 and DMEM and cultured for 14 days. Only cells in EGM-2 could be propagated from primary culture and expanded further in either EGM-2 or DMEM (n ¼ 5; scale bar represents 20 mm). (C) CD34CD45 cells were flow sorted then plated directly into DMEM, cultured for 14 days before being expanded (n ¼ 5; scale bar represents 20 mm).
J. Patel et al. / Placenta 35 (2014) 969e971
971
Fig. 2. X and Y male chromosome analysis using Fluorescent In-situ Hybridisation (FISH). (A) All cells plated from the CD34þCD45CD31 population were 100% fetal in origin as demarcated by X (red) and Y (green) chromosome staining per cell from passage (P) 2e8. 200 cells were counted from each donor (n ¼ 5; scale bar represents 50 mm). All cells plated from population CD34CD45 were 100% maternal in origin as demarcated by X only (red) chromosome staining from passage 2e8 (n ¼ 5; scale bar represents 50 mm). (B) Further confirmation of fetal origin of the cells through SRY PCR. (C) Both fetal MSC (fMSC) and maternal MSC (mMSC) differentiated down osteogenic and adipogenic lineages (n ¼ 5; scale bar represents 20 mm). (D) Flow characterisation of both mMSC and fMSC demonstrated positive staining for MSC markers CD29, CD44, CD73, CD90 and CD105 and negative for markers CD31, CD34, and CD45 (Red line e isotype; Black line e marker). þve male bone marrow MSC; ve CD34CD45 maternal MSC; ntc No Template Control.
comparative studies of relative properties of maternal and fetal placental MSC. This technique for the separate and efficient isolation of fMSC and mMSC from same placenta holds considerable significance for translational applications. Conflict of interest None declared. Acknowledgements This study was supported by the National Health and Medical Research Council (NHMRC), project grant number APP1023368. We are grateful to the hospital midwifery staff for assisting with sample collection. References [1] Pipino C, Shangaris P, Resca E, Zia S, Deprest J, Sebire NJ, et al. Placenta as a reservoir of stem cells: an underutilized resource? Br Med Bull 2013;105:43e68. [2] Chavakis E, Urbich C, Dimmeler S. Homing and engraftment of progenitor cells: a prerequisite for cell therapy. J Mol Cell Cardiol 2008;45(4):514e22. [3] Phinney DG, Prockop DJ. Concise review: mesenchymal stem/multipotent stromal cells: the state of transdifferentiation and modes of tissue repairecurrent views. Stem Cells 2007;25(11):2896e902. [4] Zhang ZY, Teoh SH, Hui JH, Fisk NM, Choolani M, Chan JK. The potential of human fetal mesenchymal stem cells for off-the-shelf bone tissue engineering application. Biomaterials 2012;33(9):2656e72.
[5] Kinzer M, Hingerl K, Konig J, Reinisch A, Strunk D, Huppertz B, et al. Mesenchymal stromal cells from the human placenta promote neovascularization in a mouse model in vivo. Placenta 2014;35(7):517e9. [6] Barlow S, Brooke G, Chatterjee K, Price G, Pelekanos R, Rossetti T, et al. Comparison of human placenta- and bone marrow-derived multipotent mesenchymal stem cells. Stem Cells Dev 2008;17(6):1095e107. [7] in 't Anker PS, Noort WA, Scherjon SA, Kleijburg-van der Keur C, Kruisselbrink AB, van Bezooijen RL, et al. Mesenchymal stem cells in human second-trimester bone marrow, liver, lung, and spleen exhibit a similar immunophenotype but a heterogeneous multilineage differentiation potential. Haematologica 2003;88(8):845e52. [8] Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8(4):315e7. [9] Parant O, Dubernard G, Challier JC, Oster M, Uzan S, Aractingi S, et al. CD34þ cells in maternal placental blood are mainly fetal in origin and express endothelial markers. Lab Invest 2009;89(8):915e23. [10] Patel J, Seppanen E, Chong MS, Yeo JS, Teo EY, Chan JK, et al. Prospective surface marker-based isolation and expansion of fetal endothelial colonyforming cells from human term placenta. Stem cells Transl Med 2013;2(11): 839e47. [11] Chen YS, Pelekanos RA, Ellis RL, Horne R, Wolvetang EJ, Fisk NM. Small molecule mesengenic induction of human induced pluripotent stem cells to generate mesenchymal stem/stromal cells. Stem cells Transl Med 2012;1(2): 83e95. [12] Khosrotehrani K, Johnson KL, Cha DH, Salomon RN, Bianchi DW. Transfer of fetal cells with multilineage potential to maternal tissue. J Am Med Assoc 2004;292(1):75e80. [13] Kogler G, Sensken S, Wernet P. Comparative generation and characterization of pluripotent unrestricted somatic stem cells with mesenchymal stem cells from human cord blood. Exp hematol 2006;34(11):1589e95.
Contents lists available at ScienceDirect
Placenta journal homepage: www.elsevier.com/locate/placenta
Short communication
Novel isolation strategy to deliver pure fetal-origin and maternalorigin mesenchymal stem cell (MSC) populations from human term placenta J. Patel a, A. Shafiee a, W. Wang a, N.M. Fisk a, b, K. Khosrotehrani a, c, * a b c
The University of Queensland, UQ Centre for Clinical Research, Herston, QLD, 4029, Australia Centre for Advanced Prenatal Care, Women's & Newborn Services, Royal Brisbane & Women's Hospital, Herston, QLD, 4029, Australia The University of Queensland, UQ Diamantina Institute, Translational Research Institute, Woolloongabba, QLD, 4102, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 2 September 2014
The placenta is an abundant source of mesenchymal stem/stromal cells (MSC). Although presumed of translationally-advantageous fetal origin, the literature instead suggests a high incidence of either contaminating or pure maternal MSC. Despite definitional criteria that MSC are CD34, increasing evidence suggests that fetal MSC may be CD34 positive in vivo. We flow sorted term placental digests based on CD34þ expression and exploited differential culture media to isolate separately pure fetal and maternal MSC populations. This method has considerable translational implications, in particular to clinical trials underway with “placental” MSC of uncertain or decidual origin. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Mesenchymal stem cells Fetal Maternal Placenta Chorion Decidua
1. Introduction The human term placenta has long been touted as a plentiful source of fetal stem cells, due to its large size and presumed fetal origin [1]. Because mesenchymal stem/stromal cells (MSC) migrate to sites of injury and help repair damaged tissue [2], they have generated substantial interest in regenerative medicine for use as cell therapy [2e5], and are the predominant cell type in clinical trials. In particular fetal MSCs (fMSC) are reported to have higher proliferative capacity and broader differentiation potential. However, a scaleable clinically-accessible source of fMSC has yet to be established given the ethical and legal constraints of sourcing abortal tissue. MSC cultures from the term placenta have surprisingly yielded mixtures of both fetal and maternal, presumably decidual-origin cells, including pure populations of maternal origin cells after serial passaging [6]. Finding a marker unique to fetal cells is one avenue to separating the two populations. Although MSC are considered negative for haematopoietic surface markers, in vivo analyses of fMSC
* Corresponding author. UQ Centre for Clinical Research, Building 71/918, University of Queensland, Herston Campus, Brisbane, 4029, Australia. Tel.: þ61 7 3346 6077. E-mail addresses: [email protected] (J. Patel), [email protected] (K. Khosrotehrani). http://dx.doi.org/10.1016/j.placenta.2014.09.001 0143-4004/© 2014 Elsevier Ltd. All rights reserved.
populations from several tissues were in fact CD34 positive (CD45 negative) prior to culturing [7,8]. We have documented non-haematopoietic CD34þ fetal cells within term placenta, although these are predominantly endothelial [9,10]. Thus, we aimed to devise a sorting strategy to separately obtain fMSC and maternal (mMSC) from human term placenta, using CD34 as a marker of fMSC. 2. Methods 2.1. Placental tissue Whole placentas (n ¼ 5) were obtained from healthy women undergoing caesarean, delivering male babies at term (38e39 weeks). Ethics approval was obtained from both the Royal Brisbane and Women's Hospital and The University of Queensland. Tissue digest and preparation of magnetic separation of CD34þ cells was conducted as published from our laboratory [10].
2.2. Fluorescence activated cell sorting (FACS) Further purification was conducted via FACS. Cells were incubated with human CD34phycoerythrin (PE) (AbDSerotec, Raleigh, USA), human CD31V450 (BD Biosciences, Franklin Lakes, USA) and human CD45 fluorescein isothiocyanate (FITC) (BioLegend, San Diego, USA) antibodies and incubated for 20 min at 4 C. Matched conjugated mouse immunoglobulin G1 (IgG1) was used for isotype controls (BDBiosciences). Cells were sorted using a FACS Aria 11u (BD Biosciences). Only CD34þ cells were gated after removing contaminating CD45þ cells. CD34þ gated cells were analysed for CD31 expression against isotype controls. CD34þCD45CD31 cells were sorted directly into 100% FBS. MSC characterisation antibodies: PE CD29; FITC CD44; APC CD73; PECy5 CD90, FITC CD105, all from BD Biosciences.
970
J. Patel et al. / Placenta 35 (2014) 969e971
2.3. Cell culture All tissue culture plates/flasks (Nunc, Roskilde, Denmark) were initially precoated with a rat tail collagen type 1 solution (SigmaeAldrich, St. Louis, MO). The flow sorted cells were plated into either EGM-2 (Lonza, Mount Waverley, Victoria, Australia) or DMEM (Invitrogen, Mulgrave, Victoria, Australia) supplemented with 10% fetal bovine serum (FBS) (Invitrogen). 2.4. PCR Genomic DNA (gDNA) was obtained using a QIAGEN All Prep DNA/RNA Mini Kit (Qiagen, Valencia, CA) as per manufactures guide. The following SRY primers were used Forward AGCAGTCAGGGAGGCAGATCA; Reverse CCCCCTAGTACCCTGACAATGTAT. The following GAPDH primers were used Forward GGTGAAGGTCGGAGT; Reverse CAAAGTTGTCATGGA. 2.5. Mesodermal lineage differentiation At passage 4, human placental fMSC and mMSC were used for osteogenic and adipogenic differentiation, as previously described [11]. 2.6. Fluorescence in-situ hybridisation (FISH) Fluorescent in-situ hybridisation (FISH) analysis for X and Y chromosomes were then conducted as per manufacturer's protocol [12] (Abbott Molecular, Illinois, USA). A Zeiss Axio microscope (Carl Zeiss, North Ryde, Australia) was used to analyse slides and capture images.
3. Results and discussion We used a tissue digest from human term placenta to interrogate MSC populations based on specific cell surface marker expression, namely CD34 positive but negative for the haematopoietic marker CD45 and endothelial marker CD31. Using this strategy, to our surprise plating CD34þCD45CD31 in EGM-2 resulted in large quantities of pure MSC colonies, which rapidly became confluent (Fig. 1AeB). The CD34þCD45CD31þ fraction yielded endothelial colonies as we previously reported [10].
Similarly CD34CD45 cells initially used as control populations also resulted in larger MSC-like colonies (not shown). We next cultured both CD34þCD45CD31 and CD34CD45 populations in DMEM with 10% FBS, a more classical MSC culture medium. Interestingly, CD34þCD45CD31 cells did not give rise to any colonies whereas CD34CD45cells resulted in MSC-like colonies (Fig. 1BeC). In colonies obtained from CD34þCD45CD31 cells, 100% (200 cells counted per donor) of observed cells from passage 2 to 8 were fetal in origin, documented by X and Y chromosome FISH, regardless of whether cultured in EGM-2 or DMEM (Fig. 2A). In contrast, 100% of the progeny of CD45CD34cells were stably maternal over multiple passages (Fig. 2A). The fetal nature of the cells obtained was further confirmed by conducting SRY PCR (Fig. 2B). Finally, isolated fMSC and mMSC were able to differentiate down both osteogenic and adipogenic lineages (Fig. 2C) and were positive for markers CD29, CD44, CD73, CD90, CD105 and negative for CD31, CD34 and CD45 through flow cytometry (Fig. 2D) confirming their MSC nature. fMSC colonies could begin to be observed after 7 days in culture and by day 14 were confluent. Interestingly, this was observed only when cells were directly plated in EGM-2 following FACS sorting. Cells plated onto DMEM did not expand and mostly did not appear healthy. Previous reports have required different culture medium strategies to allow fetal cells to propagate [7], including fMSC outgrowth from cord blood [13]. After initial passage in EGM2, we were able to expand these cells in DMEM. In contrast mMSCs grew readily in DMEM, suggesting that the predominant mMSC isolation found in most studies of unsorted placenta may be related to this differential ability of fMSC and mMSC to grow in DMEM. Our work addresses the hitherto-confusing donor source and mixed culture constraints of placental MSC cultures allowing
Fig. 1. Flow sorting and culture strategy to obtain pure fetal mesenchymal stem cells (fMSC). (A) To obtain pure fMSC populations, CD34þCD45 cells were gated and then interrogated for the endothelial marker CD31 to remove endothelial cells. (B) All CD34þCD45CD31 cells were plated directly into both EGM-2 and DMEM and cultured for 14 days. Only cells in EGM-2 could be propagated from primary culture and expanded further in either EGM-2 or DMEM (n ¼ 5; scale bar represents 20 mm). (C) CD34CD45 cells were flow sorted then plated directly into DMEM, cultured for 14 days before being expanded (n ¼ 5; scale bar represents 20 mm).
J. Patel et al. / Placenta 35 (2014) 969e971
971
Fig. 2. X and Y male chromosome analysis using Fluorescent In-situ Hybridisation (FISH). (A) All cells plated from the CD34þCD45CD31 population were 100% fetal in origin as demarcated by X (red) and Y (green) chromosome staining per cell from passage (P) 2e8. 200 cells were counted from each donor (n ¼ 5; scale bar represents 50 mm). All cells plated from population CD34CD45 were 100% maternal in origin as demarcated by X only (red) chromosome staining from passage 2e8 (n ¼ 5; scale bar represents 50 mm). (B) Further confirmation of fetal origin of the cells through SRY PCR. (C) Both fetal MSC (fMSC) and maternal MSC (mMSC) differentiated down osteogenic and adipogenic lineages (n ¼ 5; scale bar represents 20 mm). (D) Flow characterisation of both mMSC and fMSC demonstrated positive staining for MSC markers CD29, CD44, CD73, CD90 and CD105 and negative for markers CD31, CD34, and CD45 (Red line e isotype; Black line e marker). þve male bone marrow MSC; ve CD34CD45 maternal MSC; ntc No Template Control.
comparative studies of relative properties of maternal and fetal placental MSC. This technique for the separate and efficient isolation of fMSC and mMSC from same placenta holds considerable significance for translational applications. Conflict of interest None declared. Acknowledgements This study was supported by the National Health and Medical Research Council (NHMRC), project grant number APP1023368. We are grateful to the hospital midwifery staff for assisting with sample collection. References [1] Pipino C, Shangaris P, Resca E, Zia S, Deprest J, Sebire NJ, et al. Placenta as a reservoir of stem cells: an underutilized resource? Br Med Bull 2013;105:43e68. [2] Chavakis E, Urbich C, Dimmeler S. Homing and engraftment of progenitor cells: a prerequisite for cell therapy. J Mol Cell Cardiol 2008;45(4):514e22. [3] Phinney DG, Prockop DJ. Concise review: mesenchymal stem/multipotent stromal cells: the state of transdifferentiation and modes of tissue repairecurrent views. Stem Cells 2007;25(11):2896e902. [4] Zhang ZY, Teoh SH, Hui JH, Fisk NM, Choolani M, Chan JK. The potential of human fetal mesenchymal stem cells for off-the-shelf bone tissue engineering application. Biomaterials 2012;33(9):2656e72.
[5] Kinzer M, Hingerl K, Konig J, Reinisch A, Strunk D, Huppertz B, et al. Mesenchymal stromal cells from the human placenta promote neovascularization in a mouse model in vivo. Placenta 2014;35(7):517e9. [6] Barlow S, Brooke G, Chatterjee K, Price G, Pelekanos R, Rossetti T, et al. Comparison of human placenta- and bone marrow-derived multipotent mesenchymal stem cells. Stem Cells Dev 2008;17(6):1095e107. [7] in 't Anker PS, Noort WA, Scherjon SA, Kleijburg-van der Keur C, Kruisselbrink AB, van Bezooijen RL, et al. Mesenchymal stem cells in human second-trimester bone marrow, liver, lung, and spleen exhibit a similar immunophenotype but a heterogeneous multilineage differentiation potential. Haematologica 2003;88(8):845e52. [8] Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8(4):315e7. [9] Parant O, Dubernard G, Challier JC, Oster M, Uzan S, Aractingi S, et al. CD34þ cells in maternal placental blood are mainly fetal in origin and express endothelial markers. Lab Invest 2009;89(8):915e23. [10] Patel J, Seppanen E, Chong MS, Yeo JS, Teo EY, Chan JK, et al. Prospective surface marker-based isolation and expansion of fetal endothelial colonyforming cells from human term placenta. Stem cells Transl Med 2013;2(11): 839e47. [11] Chen YS, Pelekanos RA, Ellis RL, Horne R, Wolvetang EJ, Fisk NM. Small molecule mesengenic induction of human induced pluripotent stem cells to generate mesenchymal stem/stromal cells. Stem cells Transl Med 2012;1(2): 83e95. [12] Khosrotehrani K, Johnson KL, Cha DH, Salomon RN, Bianchi DW. Transfer of fetal cells with multilineage potential to maternal tissue. J Am Med Assoc 2004;292(1):75e80. [13] Kogler G, Sensken S, Wernet P. Comparative generation and characterization of pluripotent unrestricted somatic stem cells with mesenchymal stem cells from human cord blood. Exp hematol 2006;34(11):1589e95.