Novel stem–loop probe DNA arrays: Detection of specific acetotrophic 16S ribosomal RNA signatures

Analytical Biochemistry 435 (2013) 60–67

Contents lists available at SciVerse ScienceDirect

Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio

Novel stem–loop probe DNA arrays: Detection of specific acetotrophic 16S ribosomal RNA signatures Jonas Boateng a, Robert Zahorchak b, Joel Peek c, Krishnan Chittur a,⇑ a

Department of Chemical Engineering, University of Alabama in Huntsville, Huntsville, AL 35899, USA HudsonAlpha Institute for Biotechnology, Huntsville, AL 35806, USA c Microarrays, Huntsville, AL 35806, USA b

a r t i c l e

i n f o

Article history: Received 22 August 2012 Received in revised form 24 November 2012 Accepted 3 December 2012 Available online 19 December 2012 Keywords: Stem–loop probes DNA microarrays Nucleic acid testing (NAT) Archaea Methanosarcina Methanosaeta Microbial population dynamics

a b s t r a c t In a recent study, we showed how novel stem–loop DNA probes on dendron-modified aldehyde substrates could be used to detect synthetic nucleic acid targets without amplification. In this article, we demonstrate the application of stem–loop DNA probes as arrays for the detection of specific families and genera of methane-producing bacteria from sludge samples harvested from an anaerobic digester using 16S ribosomal RNA (rRNA) signatures. Specific 16S rRNA could be detected in samples that had 0.2 ng/ll total sludge RNA without any target amplification. Ó 2012 Elsevier Inc. All rights reserved.

Acetotrophic methanogens (aceticlastics) are methane-producing Archaea that use acetic acid as their preferred substrate. Aceticlastics are predominant in anaerobic digesters, and two-thirds of biomethane is derived from acetate through the metabolic activity of these organisms [1]. They have been shown to have significant impact on the biogeochemical fluxes in microbial community structure that directly affects the efficiency and yield of anaerobic digesters [2–4]. Thus, the ability to effectively monitor or detect acetotrophic populations in anaerobic digesters is crucial for the optimization of biomethane production. Most acetotrophic populations are detected using molecular approaches that use amplified 16S ribosomal RNA (rRNA)1 gene (16S rDNA) cloning and sequencing techniques and microarray technology [5–7]. DNA microarrays are used extensively in clinical applications such as disease screening, diagnostics, and genotyping. The extension of DNA microarrays ⇑ Corresponding author. Fax: +1 256 824 6839. E-mail address: [email protected] (K. Chittur). Abbreviations used: rRNA, ribosomal RNA; PCR, polymerase chain reaction; NAT, nucleic acid testing; SLP, stem–loop DNA probe; SSC, saline–sodium citrate; SDS, sodium dodecyl sulfate; EtOH, ethanol; NaBH4, sodium borohydride; NaH2PO4, sodium phosphate (monobasic); EDTA, ethylenediaminetetraacetic acid; Na2HPO4, sodium phosphate (dibasic); TAE, Tris–acetate–EDTA; IDT, Integrated DNA Technologies; HPLC, high-performance liquid chromatography; RDP, Ribosomal Database Project; ATCC, American Type Culture Collection; SSPE, saline–sodium phosphate– EDTA; PBS, phosphate-buffered saline; UV–Vis, ultraviolet–visible; PMT, photomultiplier tube; SNR, signal-to-noise ratio. 1

0003-2697/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ab.2012.12.006

for the detection and analysis of 16S rRNAs in microbial community analysis and process monitoring holds great potential in both basic and applied environmental sciences [8–10]. The use of microarrays for autonomous in-field or point-of-use environmental applications is dependent on their ability to (i) detect numerous microorganisms simultaneously, (ii) use a bioanalytical detection method that is conducive to automation or field deployment, (iii) monitor RNA as a qualitative indicator of microbial activity, and (iv) quantify RNA levels or extent of reaction [11]. The common approach is to amplify 16S rRNA genes (16S rDNA) specific to the organism of interest using group-specific primer and probe sets and to hybridize the amplified gene segments to immobilized oligonucleotide probes with sequences complementary to the conserved region of the amplicons [12–14]. Polymerase chain reaction (PCR) is usually the method of choice for target amplification, but it presents several problems, including (i) inhibition by coextracted contaminants, (ii) differential amplification and (iii) formation of artifactual PCR products that are generated when applied to environmental microbial communities [15–20]. Using mixtures of known DNA templates to mimic DNA samples from natural ecosystems, Giovannoni and coworkers [21] developed a kinetic model showing that the differences in the kinetics of product accumulation in the nonexponential phase of PCR amplification was a contributor to the observed variation in amplification efficiencies and differed from one standard template dilution to

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67

another. This is affirmed by the findings of Hansen and coworkers [22], which demonstrated that the 16S rDNA PCR amplification of different bacterial species is highly biased due to the genomic DNA of some species containing segments outside the amplified region that inhibit the initial phase of the PCR. Several variants of PCR amplification that address some of these limitations have been developed. For example, gene-specific primers can be used at very low concentrations to enrich targets during the initial cycle of the reaction, followed by a universal primer that amplifies all targets present [23]. This process resolves some of the (i) incompatibility of amplification conditions among different primer sets and (ii) background amplification associated with high concentrations of primers. However techniques that rely on PCR amplification for detection remain complex and difficult to implement for routine environmental applications. There is a need to develop methods that allow for the direct detection of RNA signatures with the sensitivity and specificity needed for environmental samples. There are several direct rRNA microarray detection approaches ranging from gel element microarrays [9] to surface plasmon resonance sensors [24]. The biggest obstacle to directly detecting 16S rRNA with solid immobilized probes is that hybridization is greatly affected by the secondary and tertiary structures inherent in 16S rRNA. Recently, we reported how a previously developed novel nucleic acid testing (NAT) technique [25] could be used in conjunction with dendron-modified aldehyde functionalized surfaces to directly detect nucleic acid targets up to approximately 1 pM without PCR amplification [26]. In this article, we demonstrate the application of this new stem–loop DNA probe (SLP) microarray technique for the direct detection of single and multiple 16S rRNA signatures of acetotrophic Archaea populations without amplification. The method uses a two-step hybridization approach that does not need target labeling and amplification (Fig. 1). The first hybridization event is characterized by probe–target binding of unlabeled targets to the loop of denatured surface-immobilized SLPs. If targets bind to the probes, it allows for the binding of a second, fluorescently labeled oligonucleotide (detector) to the hanging stem arm of the SLP (Fig. 1B–D). Conversely, if the target does not bind to the SLP due to noncomplementarity, then the SLP reforms back into its native closed hairpin conformation and the detector fails to bind to the SLP. The method has the advantage of not requiring any modification or prelabeling of target nucleic acids, thereby reducing sample preparation time and minimizing the possibility of changing the nature of the sample. Materials and methods Materials All solvents and chemicals were purchased from Fisher Scientific (Pittsburgh, PA, USA) as reagent grade. These included agarose, 20 saline–sodium citrate (SSC), sodium dodecyl sulfate (SDS), ethanol (EtOH), sodium borohydride (NaBH4), NaCl, sodium phosphate (monobasic) (NaH2PO4), ethylenediaminetetraacetic acid (EDTA), sodium phosphate (dibasic) (Na2HPO4), HCl, 40 Tris–acetate–EDTA (TAE), and NaOH. Electrophoresis experiments requiring nucleic acid staining were performed using GelRed from Phenix Research Products (Candler, NC, USA). FlashGel Precast Agarose Gel Systems obtained from Lonza (Rockland, ME, USA) were used along with manually cast gels. Aldehyde-functionalized dendron-modified glass slides (2.5  7.5 cm) with 7-nm mesospacing (NSB27) were purchased from NSB Postech (Pohang, South Korea). PCR 2 master mix was purchased from Promega (Madison, WI, USA). Ultrapure water (18 MX/cm) from a Millipore purification system and diethylpyrocarbonate (DEPC) treated water from OpenBiosystems (Huntsville, AL, USA) were used where needed.

61

Oligonucleotides All oligonucleotides were purchased from Integrated DNA Technologies (IDT, Coralville, IA, USA) (Table 1). High-performance liquid chromatography (HPLC) purified SLPs were obtained with a C6-terminal amino linker modification at the 50 end to allow for attachment to aldehyde-functionalized slides. The target sequences were derived using the online rRNA-targeted oligonucleotide probe database probeBase [27] and verified using the Ribosomal Database Project (RDP website) and GenBank. Negative control SLPs, NEG915, were designed with loop regions noncomplementary to any of the target sequences screened. This was verified by using BLAST (http://blast.ncbi.nlm.nih.gov) to search for homology to the designed sequences against the 16S rRNA ribosomal database of Archaea, Methanosarcina, and Methanosaeta on GenBank and RDP. The probes were designed to immobilize in a closed stem–loop orientation with a 20- to 25-nt base loop region housing the target sequence (shown in uppercase in Table 1), a 16-bp double-stranded stem region (shown in lowercase in Table 1), and a 4-nt adenosine spacer (underlined in Table 1) between the two regions. Singlestranded HPLC purified detector oligonucleotides modified with a Cy3 fluorescent dye at the 50 end were obtained from IDT with complementarity to the unanchored stem arm of the probes. Synthetic target oligonucleotides that were complementary to the Archaea and Euryarchaeota stem–loop probe–target sequences (ARC915 and EURY499) were obtained from IDT with no terminal modification. Total Methanosarcina acetivorans RNA (ATCC 35395) and genomic M. acetivorans DNA (ATCC 35395D-5) were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). Immobilization of probes on slide surface SLP oligonucleotides were dissolved in sodium phosphate buffer solution (150 mM, pH 8.0) and hand-spotted into either 8  3 array matrices at ascending spotting concentrations of 5, 10, 20, and 50 lM for single-target experiments or 11  4 array matrices at a spotting concentration of 50 lM for multi-target experiments. All probes were spotted onto NSB27 dendron-modified aldehyde slides. Arrays were left overnight in a vacuum desiccator after spotting and incubated in a saturated humidity chamber for 4 h and in hybridization buffer solution (2 saline–sodium phosphate–EDTA [SSPE] buffer [pH 7.4] containing 7.0 mM SDS) at 37 °C for 10 min. The arrays were then rinsed for 5 min in ultrapure water at 25 °C, stirred in reducing solution (2.4 g/L NaBH4 and EtOH/phosphate-buffered saline [PBS], 25:75, v/v) for 20 min at 25 °C, and rinsed twice in ultrapure water at 25 °C. Slides were centrifuged to dryness at 3000 rpm and stored at room temperature until used. Nucleic acid isolation Municipal sewage sludge samples were obtained from the Huntsville Spring Branch Wastewater Treatment Plant (WWTP) anaerobic digester (Huntsville, AL, USA). Total DNA and total RNA were extracted from the samples using the MO BIO Laboratories PowerSoil DNA Isolation Kit and the MO BIO Laboratories RNA PowerSoil Isolation Kit (Carlsbad, CA, USA), respectively. DNA and RNA quality and quantity were assessed using the Thermo Fisher Nanodrop UV–Vis Spectrophotometer and non-denaturing agarose gel electrophoresis. Samples were stored at 80 °C in RNase/ DNase-free water prior to use. Hybridization and detection Target and detector solutions were diluted with 2 SSPE buffer dissolved in 7.0 mM SDS at pH 8.0 and heated at 95 °C for 5 min

62

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67

Fig.1. Schematic depicting the working of the microarray platform. (A) Stem–loop captor drawing showing the four regions of significance. dsDNA, double-stranded DNA. (B) Denaturation of the microarray via heat in the presence of the sample RNA under investigation leads to an open hairpin orientation for the captor probe. (C) Hybridization of the open hairpin captor probe with its target RNA. (D) The hybridized captor maintains its open hairpin orientation on subjection to the renaturation condition, which allows the detector to bind with the unanchored stem arm. Consequently, the unhybridized captor returns back to its closed hairpin orientation on renaturation, preventing the detector from binding to the unanchored stem.

before hybridization. Arrays were hybridized overnight with either total RNA or synthetic target oligonucleotides (ARC915T or EURY499T) at 54 °C using an Agilent hybridization system, washed twice in hybridization buffer at 54 °C for 10 min, rinsed in 0.2 SSC at room temperature, and dried. Slides were then hybridized to the detector for 20 min at 20 °C, washed once in hybridization buffer at 37 °C for 5 min, rinsed for 10 s in 0.2 SSC at room temperature, and dried. Images were obtained by scanning each slide at 510 photomultiplier tube (PMT, set automatically using the GenePix Pro in-built PMT optimizer), 100% laser power, and 10 pixels/lm resolution. Images were processed using median-intensity values and corrected for background noise by subtracting the values from their respective local backgrounds. Each signal-to-noise ratio (SNR) was calculated using the ratio of the fluorescent signal of the positive probe (ARC915) to the negative control (NEG915). PCRs The presence of Archaea and acetotrophic populations was verified using 50-ll PCRs that were set up for each primer set (Table 2) using 25 ll of a ready-to-use Promega 2 PCR master mix containing 50 U/ml Taq DNA polymerase supplied in a proprietary reaction buffer at pH 8.5, 400 lM deoxyadenosine triphosphate (dATP), 400 lM deoxycytosine triphosphate (dCTP), 400 lM deoxythymidine triphosphate (dTTP), 400 lM deoxyguanosine triphosphate

(dGTP), and 3 mM MgCl2; 2 ll of genomic DNA from either cultured M. acetivorans or sludge (5–20 ng); 2 ll of a reverse and forward primer set, 200 nM each for a total of 400 nM; and Sigma RNase- and DNase-free water (Sigma, St. Louis, MO, USA) to bring the final concentration to 50 ll. Primer sets adopted from Yu and coworkers [28] were ordered from IDT to detect the 16S rRNA genes of the Archaea domain and the Methanosaetaceae and Methanosarcinaceae families of acetotrophes. Each primer set was BLASTed against the complete genome of M. acetivorans (accession no. AE010299.1) and Methanosaeta concilii GP-6 (accession no. CP002565.1) to validate the accuracy of each primer set and the size of each amplicon prior to amplification. The reactions were initialized at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 45 s, annealing at 55 °C for 60 s, and extension at 72 °C for 60 s. The final extension was held at 72 °C for 7 min [28]. Volumes of 5 ll of amplicons from each sample (50 ng/band) were mixed with 1 ll of 6 loading dye, loaded onto the 2% nondenaturing agarose gel in 1 TAE buffer, and run at 100 V against a Promega BenchTop 100-bp DNA Ladder. Gels were stained in 3 GelRed for 30 min and visualized under a UV transilluminator. Instruments Hybridizations were performed using Agilent Technologies hybridization gaskets, chambers, and oven (Wilmington, DE, USA). Fluorescence intensities from the microarrays were

63

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67 Table 1 Tabulated summary of oligonucleotides. Probe name

Target organism

Sequence (50 –30 )

UNIV1390

All organisms

agacagacagacagacaGACGGGCGGTGTGTACAAaaaatgtctgtctgtctgtc

ARC915

Archaea

agacagacagacagacaGTGCTCCCCCGCCAATTCCTaaaatgtctgtctgtctgtc

EURY514

Euryarchaeota

agacagacagacagacaGCGGCGGCTGGCACCaaaatgtctgtctgtctgtc

EURY499

Euryarchaeota

agacagacagacagacaCGGTCTTGCCCGGCCCTaaaatgtctgtctgtctgtc

MS821

Methanosarcina

agacagacagacagacaCGCCATGCCTGACACCTAGCGAGCaaaatgtctgtctgtctgtc

SARC1645

Methanosarcina genus

agacagacagacagacaTCCCGGTTCCAAGTCTGGCaaaatgtctgtctgtctgtc

MSMX860

Methanosarcinales

agacagacagacagacaGGCTCGCTTCACGGCTTCCCTaaaatgtctgtctgtctgtc agacagacagacagacaACGTATTCACCGCGTTCTGTaaaatgtctgtctgtctgtc

MX1361

Methanosaetaceae

MX825

Methanosaeta spp.

agacagacagacagacaCGCCATGCCTGACACCTAGCGAGCaaaatgtctgtctgtctgtc

NEG915

Negative control

ARC915T EURY499T

ARC915 target EURY499 target

agacagacagacagacaTGTAGAAAAATAACCGGTTGaaaatgtctgtctgtctgtc AGGAATTGGCGGGGGAGCAC AGGGCCGGGCAAGACCG

Upper case - target specific region, lower case - stem region, underlined - spacer region.

Table 2 Characteristics of primer sets used in study. Name

Primer sequence (50 –30 )

Amplicon size (bp)

Primer length

Tm (°C)

Archaea ARC787F (BLAST against AE010299.1||CP002565.1) ARC1059R (BLAST against AE010299.1||CP002565.1)

ATTAGATACCCSBGTAGTCC GCCATGCACCWCCTCT

273

20 16

61.0 62.3

Methanosarcinaceae family Msc380F (BLAST against AE010299.1) Msc828R (BLAST against AE010299.1)

GAAACCGYGATAAGGGGA TAGCGARCATCGTTTACG

408

18 18

61.2 59.9

Methanosaetaceae family Mst702F (BLAST against CP002565.1) Mst862R (BLAST against CP002565.1)

TAATCCTYGARGGACCACCA CCTACGGCACCRACMAC

165

20 17

61.0 62.1

Note. Primer sets were adopted from Yu and coworkers [28]. Accession numbers in parentheses show which genomes were analyzed by BLAST with the primers to calculate the expected amplicon size for each PCR product.

Fig.2. SNRs of various targets hybridized to ARC915 captors spotted at different concentrations. Symbols: s, mixture of 50 lM ARC915T with 7.5 ng/ll placental DNA; e, 0.2 ng/ll sludge genomic RNA in hybridization buffer; D, 2.0 ng/ll sludge genomic RNA without hybridization buffer; h, 1.33 ng/ll sludge genomic RNA in hybridization buffer; , mixture of 1 part of 100 nM ARC915T to 10 parts of 2 ng/ll sludge genomic RNA. Error bars represent standard deviations.

measured with a GenePix 4200 scanner, and the images were analyzed with GenePix Pro 6 (Molecular Devices, Downingtown, PA, USA) and Microsoft Excel (Redmond, WA, USA). DNA and RNA purity and quantity were determined using the Thermo Scientific Nanodrop UV–Vis Spectrophotometer. PCRs and pre-hybridization sample heating were conducted using the 96-Well GeneAmp PCR System by Applied Biosystems (Carlsbad, CA, USA).

Fig.3. SNRs from a mixture of 500 nM ARC915T and EURY499T hybridized to both positive and negative captors. Error bars were calculated from the standard deviations of each experimental condition.

Results and discussion Detection of a synthetic Archaea target The ability to detect specific nucleic acid signatures in a complex mixture of nucleic acids obtained from sludge containing unknown numbers of microbial species required that we first determine how well our SLP arrays could detect one specific synthetic target nucleic acid from mixtures. The synthetic target

64

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67

Fig.4. SNRs from 1.8 ng/ll ATCC cultured M. acetivorans (ATCC 35395) hybridized to a number of different captors. Error bars were calculated from the standard deviations of each experimental condition.

ARC915T into the sludge RNA was an attempt to introduce a positive control target to a complex mixture of RNA from the sludge that we expected to have the Archaea 16S rRNA target sequence. Here, 10 parts of total sewage sludge RNA at 2 ng/ll was spiked with 1 part of 17.5 ng/ll (100 nM) ARC915T and hybridized overnight. Fluorescent signals of the positive ARC915 captors were significantly higher than those of the negative NEG915 control captors. High signals (10–17 SNR) were observed across all spotting concentrations from 5 to 50 lM (shown as "x"’s in Fig. 2), which demonstrated the capability of the platform to detect Archaea 16S rRNA in municipal sewage sludge RNA. Encouraging as these results were, these experiments could not allow us to conclude whether the increase in intensities of the ARC915 probe over controls, NEG915, was the result of hybridization of any native 16S rRNA or the synthetic ARC915T target or a combination of the two. To confirm the presence of Archaea 16S rRNA, 2 ng/ll total sludge RNA isolates was hybridized directly to an ARC915/NEG915 array overnight without the addition of the synthetic target. The SNR was approximately 5.0 ± 0.5-fold over the negative (NEG915) control at all spotting concentrations (shown as triangles in Fig. 2). When hybridization buffer (2 SSPE with 7 mM SDS) was added to the samples, it increased the SNRs at nearly all spotting concentrations (also shown as squares in Fig. 2). Starting with an initial total sludge RNA concentration of 2 ng/ ll, a 10-fold dilution was made to determine the detection range of the system. The resulting SNR values were higher than 1 at all spotting concentrations (shown as diamonds in Fig. 2). At lower dilutions, we could not differentiate the ARC915 and NEG915 fluorescent signals (data not shown). We concluded that the detection limit of the platform was approximately 0.2 ng/ll total sludge RNA. Multi-target detection in synthetic systems

Fig.5. SNRs from captors hybridized to 16.5 ng/ll sludge. Each experimental condition represents an average of four replicates.

sequence was ARC915T, complementary to the probe specific for Archaea. Several experiments were performed, and the results are shown in Fig. 2. In one experiment, 7.5 ng/ll human placenta DNA was mixed with 50 nM ARC915T and hybridized onto an array that had both ARC915 and a negative control, NEG915. The total volume was 490 ml equally divided between the human placental DNA and the synthetic target. The results showed that the synthetic target nucleic acids preferentially bound to ARC915 captors and not to the NEG915 captors in the presence of other genetic material at SNRs P 3 (shown as circles in Fig. 2). The highest SNR values were seen at the highest probe spotting concentration, 50 lM, which gave fluorescent intensities approximately 8-fold over negative controls. These results show that (i) ARC915 nucleic acid targets present in a mixture of excess unrelated nucleic acids could be detected and (ii) the SLP DNA arrays have a high specificity for detection of a particular target from a mixture. Detection of Archaea populations in sludge RNA Next, we hybridized sewage sludge RNA spiked with ARC915T to an array of ARC915 and NEG915 probes. The spiking of synthetic

We wanted to test the ability of our SLP DNA array to detect multiple known nucleic acid targets from mixtures. We tested this by performing array hybridizations using synthetic oligonucleotide target mixtures containing sequences complementary to specific SLPs, which allowed for the assessment of hybridization performance in a controlled environment. Here, 50 lM of ARC915 (Archaea), EURY499 (Euryarchaeota), MX825 (Methanosaeta), and MS821 (Methanosarcina) captors were spotted onto dendronmodified (Nanocones) aldehyde NSB27 glass slides at 0.5 ll/spot. The slides were hybridized to a 500-nM mixture of ARC915T and EURY499T target oligonucleotides. SNRs were calculated using intensities observed with the MX825 captors as negative controls. Captors for MS821 also served as negative controls for ARC915 and EURY499. SNRs from hybridization to the ARC915 and EURY499 captors were much higher than 1—different from the SNRs of the control SLPs (MS821 and MX825). The ARC915 and EURY499 captor SNRs indicated that the probes for these two targets were specific, with SNRs between 3 and 5 (Fig. 3). Multi-target detection in cell cultured M. acetivorans RNA Next, we examined the ability of the SLP DNA array to detect multiple native 16S rRNA target sequences from a sample containing RNA extract from a known culture. RNA extracts from M. acetivorans (ATCC 35395) at 1.8 ng/ll were hybridized overnight to an array spotted at 50 lM with UNIV1389C (Archaea), ARC915 (Archaea), MX1361 (Methanosaeta), MS821 (Methanosarcina), and MX825 (Methanosaeta spp.). MS821 showed the highest signal intensity and specificity (8- to 17-fold over Methanosaeta probes), which was expected given that the sample was composed entirely of Methanosarcina RNA. Of the two Archaea 16S rRNA target SLPs (UNIV1389C and ARC915), UNIV1389C was found to be more

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67

65

Fig.6. Gel electrophoresis showing the PCR amplicons for Archaea (273 bp), Methanosarcinaceae (408 bp), and Methanosaetaceae (165 bp) in M. acetivorans ATCC genomic DNA (lanes 1–4) and sewage sludge total DNA (lanes 6–9). L, ladder.

sensitive and specific than ARC915 (i.e., 4 times the intensity of ARC915 and 5.5-fold over the highest Methanosaeta signal, MX1361, compared with 1.5 for ARC915) (Fig. 4). All positive probes, with the exception of ARC915, demonstrated high specificity in detecting the targeted organismic 16S rRNA present within the cultured sample. In contrast, the negative Methanosaeta probes failed to produce significant fluorescent signals, indicating that their hairpin structure was stabilized and refolded back into its closed conformation in the absence of target 16S rRNA sequences. The smaller SNR observed with the ARC915 probe indicated that for M. acetivorans 16S rRNA target sequences did not hybridize efficiently. This phenomenon has been observed in environmental microbiology microarrays that use short linear probe sequences. This problem can be overcome by including multiple probes in one spot (‘‘mixed probe spots’’) to enhance the detection of specific target nucleic acids [29–33].

Detection in sludge samples Our next objective was to examine 16S rRNA extracts obtained from sludge samples that are likely to contain rRNA from a number of bacterial species. Arrays spotted with multiple probes targeting different taxonomic supersets and subsets of Methanosarcina and Methanosaeta were hybridized overnight with 3.3 ng/ll sludge total RNA extract with and without the addition of 0.5 ng/ll ARC915T (Fig. 5). ARC915 had the highest signal intensity and specificity, as expected in both cases with the SNR higher for the spiked sample. The overall signal intensities for most of the captors were relatively low, which was likely due to the low starting amount of total RNA screened. EURY499 (Euryarchaeota), MS821 (Methanosarcina), and MX1361 (Methanosaetaceae) exhibited SNR values approximately 4-fold above background (NEG915 was used as the reference signal background). MX825 (Methanosaeta spp.) probes showed the least sensitivity in these experiments, perhaps reflecting the fact that this species was present at a very low concentration in the sludge extract. It is known that Methanosaeta are notorious for their slow growth rate in anaerobic digesters [34]. It was also interesting that comparison of the ARC915T spiked sludge total RNA extract with the nonspiked hybridization experiments revealed no significant change in the overall expression

pattern of the target sequences (Fig. 5). ARC915 had the highest SNRs compared with the other probes, consistent with the expected high content of Archaea microorganisms in the sludge. The presence of acetotrophic methanogens in the sludge was confirmed by the relative expression ratios of MSMX860 (Methanosarcina and Methanosaeta), MS821 (Methanosarcina), MX1361 (Methanosaetaceae), and SARC1645 (Methanosarcina genus), all of which were P3-fold above the negative background control (NEG915). EURY499 and EURY514 confirmed the presence of Euryarchaeota microorganisms in the sludge sample, which is the phylum of acetotrophic methanogens. UNIV1390 is a universal probe that we used as a positive control for microorganisms in the sample. PCR confirmation It was important to determine that the samples from which we had obtained the RNA in the hybridization experiments with the SLP arrays did contain the acetotrophic and Archaea populations that were targeted by our probes. For this, a PCR was designed to amplify the gene sequences of the 16S rRNA targets that were detected using the SLP arrays. Amplicons of genomic sludge DNA extracts and genomic DNA from M. acetivorans (ATCC 35395D-5) were run on a gel and visualized. Cultured M. acetivorans genomic DNA from ATCC was used as a control to validate primer specificity. Results from the ATCC M. acetivorans genomic DNA showed two bands at 200 to 300 bp and approximately 400 bp, respectively (Fig. 6). The smallest band between the 200- and 300-bp fragments of the ladder correlated with the expected amplicon size for Archaea domain (273 bp), and the larger band matched with the expected band size for the Methanosarcinaceae family (408 bp). No bands were observed at 165 bp, which is the expected amplicon size for the Methanosaetaceae family. Because the ATCC genomic M. acetivorans was a pure sample, Methanosaetaceae methanogens were not expected to be present in the samples. In contrast, the sludge samples had three distinctive bands at 408, 273, and 165 bp, confirming the presence of both Methanosarcina and Methanosaeta in the samples studied. The results support results from hybridization to SLP DNA arrays that indicated the presence of Methanosaeta and Methanosarcina populations in anaerobic digesters without PCR amplification or reverse transcription.

66

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67

Conclusion In this study, a novel NAT platform was successfully used to directly detect the 16S rRNA signatures of acetotrophic populations in sewage sludge RNA extracts at relatively high specificity without sample amplification. The lowest concentration of detectable total sludge RNA was found to be 0.2 ng/ll. Methanosarcina and Methanosaeta populations were successfully detected in total sludge RNA using nine 16S rRNA SLPs. The probes were designed to target 16S rRNA sequences complementary to subcategories of the Archaea taxonomy up to the genus level (Methanosarcina genus) or in some cases the species level (Methanosaeta spp.). Overall, the Methanosarcina genus and Methanosaetaceae family of acetotrophic methanogens were the most abundantly detected targets, with signals 4-fold over background. The only 16S rRNA signature that was not detected at high specificity was Methanosaeta spp., and this was attributed to the likely small amounts of Methanosaeta spp. in the sludge sample. The captor probe designated for the detection of all acetotrophic methanogens (MSMX86) yielded SNR values 3fold over background. We have shown that the coupling of our NAT technique with novel SLP arrays immobilized on dendron-modified aldehyde solid surfaces can be used to directly detect 16S rRNA signatures of acetotrophic methanogens in both characterized and uncharacterized samples without target amplification at reasonable sensitivity and specificity levels for infield and point-of-service applications in environmental sciences. Although we did not present data directly comparing the SLP technology with PCR amplified detection approaches, we highlight key advantages of our methodology. For both the SLP and PCR methods, the first step is the extraction of RNA from samples. The workflow diverges from this point forward. For PCR analysis, the RNA extraction is usually followed by reverse transcription to create template DNA strands that are then used in real time or multiplex PCR methods. Sample requirements for reverse transcription and for PCR amplification are stringent and designed to avoid problems with known (or unknown) components in the solution that could inhibit the enzymes involved in either the reverse transcription or PCR amplification steps. In our SLP method, RNA extraction is followed by direct hybridization to an array of probes followed by detection. Our data indicate that the presence of unrelated nucleic acids (or other components) does not interfere with the hybridization to the specific probes on the surface. Our data showed that we could detect a specific target nucleic acid present in a mixture where the total concentration of nucleic acids was 0.2 ng/ll. Translating this information to a limit of detection was not possible because we could not establish the concentration of the specific target in the mixture. In a previous study, under very controlled conditions with known concentrations, we showed that the limit of detection for specific nucleic acids was 1 pM. The practical detection limit is likely to be much higher than 1 pM. Our objective in this study was not to establish precise detection limits for nucleic acids from complex mixtures but rather to provide an alternative approach to PCR that offers far simpler requirements in sample preparation and considerable reduction in both time and complexity from sample to result using direct hybridization. The detection by direct hybridization as we described here, thus, provides an alternative technique that could more easily help the development of a fast automatable method for detection of bacterial populations. References [1] R.E. Speece, Anaerobic Biotechnology for Industrial Wastewaters, Archaea Press, Nashville, TN, 1996. [2] H. Penning, P. Claus, P. Casper, R. Conrad, Carbon isotope fractionation during acetoclastic methanogenesis by Methanosaeta concilii in culture and a lake sediment, Am. Soc. Microbiol. 72 (2006) 5648–5652.

[3] J. Schimel, Ecosystem consequences of microbial diversity and community structure, Ecol. Stud. 4 (1995) 239–254. [4] J.P. Schimel, J. Gulledge, Microbial community structure and global trace gases, GCB Bioenergy 4 (1998) 745–758. [5] J.-C. Cho, J.M. Tiedje, Quantitative detection of microbial genes by using DNA microarrays, Appl. Environ. Microbiol. 68 (2002) 1425–1430. [6] N. Stralis-Pavese, A. Sessitsch, A. Weilharter, T.G. Reichenauer, J. Riesing, J. Csontos, J.C. Murrell, L. Bodrossy, Optimisation of diagnostic microarray for application in analysing landfill methanotroph communities under different plant covers, Environ. Microbiol. 6 (2004) 347–363. [7] K.R. Everett, J. Rees-George, I.P.S. Pushparajah, B.J. Janssen, Z. Luo, Advantages and disadvantages of microarrays to study microbial population dynamics: a minireview, N. Z. Plant Prot. 63 (2010) 1–6. [8] D.R. Call, F.J. Brockman, D.P. Chandler, Genotyping Escherichia coli O157:H7 using multiplexed PCR and low-density microarrays, Int. J. Food Microbiol. 67 (2001) 71–80. [9] D.Y. Guschin, B.K. Mobarry, D. Proudnikov, D.A. Stahl, B.E. Rittmann, A.D. Mirzabekov, Oligonucleotide microchips as genosensors for determinative and environmental studies in microbiology, Appl. Environ. Microbiol. 63 (1997) 2397–2402. [10] A. Spiro, M. Lowe, D. Brown, A bead-based method for multiplexed identification and quantitation of DNA sequences using flow cytometry, Appl. Environ. Microbiol. 66 (2000) 4258–4265. [11] D.P. Chandler, G.J. Newton, J.A. Small, D.S. Daly, Sequence versus structure for the direct detection of 16S rRNA on planar oligonucleotide microarrays, Appl. Environ. Microbiol. 69 (2003) 2950–2958. [12] M. Song, G.S. Seung, S. Hwang, Methanogenic population dynamics assessed by real-time quantitative PCR in sludge granule in upflow anaerobic sludge blanket treating swine wastewater, Bioresour. Technol. 101 (2010) 523–528. [13] M. Tabatabaei, R.A. Rahim, N. Abdullah, A.-D.G. Wright, Y. Shirai, K. Sakai, A. Sulaiman, M.A. Hassan, Importance of the methanogenic Archaea populations in anaerobic wastewater treatment, Process Biochem. 45 (2010) 1214–1225. [14] I.H. Franke-Whittle, M. Goberna, H. Insam, Design and testing of real-time PCR primers for the quantification of Methanoculleus, Methanosarcina, Methanothermobacter, and a group of uncultured methanogens, Can. J. Microbiol. 55 (2009) 611–616. [15] S.G. Acinas, R. Sarma-Rupavtarm, V. Klepac-Ceraj, M.F. Polz, PCR-induced sequence artifacts and bias: insights from comparison of two 16S rRNA clone libraries constructed from the same sample, Appl. Environ. Microbiol. 71 (2005) 8966–8969. [16] T. Stinear, A. Matusan, K. Hines, M. Sandery, Detection of a single viable Cryptosporidium parvum oocyst in environmental water concentrates by reverse transcription–PCR, Appl. Environ. Microbiol. 62 (1996) 3385–3390. [17] M.T. Suzuki, S.J. Giovannoni, Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR, Appl. Environ. Microbiol. 62 (1996) 625–630. [18] V. Farrelly, F.A. Rainey, E. Stackebrandt, Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species, Appl. Environ. Microbiol. 61 (1995) 2798–2801. [19] C.F. Brunk, E. Avaniss-Aghajani, C.A. Brunk, A computer analysis of primer and probe hybridization potential with bacterial small-subunit rRNA sequences, Appl. Environ. Microbiol. 62 (1996) 872–879. [20] D. Zheng, E.W. Alm, D.A. Stahl, L. Raskin, Characterization of universal smallsubunit rRNA hybridization probes for quantitative molecular microbial ecology studies, Appl. Environ. Microbiol. 62 (1996) 4504–4513. [21] S.J. Giovannoni, E.F. DeLong, G.J. Olsen, N.R. Pace, Phylogenetic group-specific oligodeoxynucleotide probes for identification of single microbial cells, J. Bacteriol. 170 (1988) 720–726. [22] M.C. Hansen, T. Tolker-Nielsen, M. Givskov, S. Molin, Biased 16S rDNA PCR amplification caused by interference from DNA flanking the template region, Microbiol. Ecol. 26 (1998) 141–149. [23] J. Han, Molecular differential diagnoses of infectious diseases: is the future now?, In: C. Stratton and Y.W. Tang, (Eds.), Advanced Technologies in Diagnostic Microbiology, Springer; New York, 2006, pp 472–504. [24] B.P. Nelson, T.E. Grimsrud, M.R. Liles, R.M. Goodman, R.M. Corn, Surface plasmon resonance imaging measurements of DNA and RNA hybridization adsorption onto DNA microarrays, Anal. Chem. 73 (2001) 1–7. [25] M.L. Pusey, K.K. Chittur, J.J. Dowell, J.D. Ng, Nucleic acid detector and method of detecting targets within a sample, US patent 7,291,459, US Patent and Trademark Office, Washington, DC, 2007. [26] J. Boateng, R. Zahorchak, J. Peek, K. Chittur, Dendron modified surfaces provide an ideal environment for stem–loop DNA probes, Anal. Biochem. 430 (2012) 39–44. [27] A. Loy, F. Maixner, M. Wagner, M. Horn, ProbeBase—an online resource for rRNA-targeted oligonucleotide probes: new features, Nucleic Acids Res. 35 (2007) D800–D804. [28] Y. Yu, C. Lee, J. Kim, S. Hwang, Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction, Biotechnol. Bioeng. 89 (2005) 670–679. [29] S.R. Bates, D.A. Baldwin, A. Channing, L.K. Gifford, A. Hsu, P. Lu, Cooperativity of paired oligonucleotide probes for microarray hybridization assays, Anal. Biochem. 342 (2005) 59–68. [30] C.-C. Chou, C.-H. Chen, T.-T. Lee, K. Peck, Optimization of probe length and the number of probes per gene for optimal microarray analysis of gene expression, Nucleic Acids Res. 32 (2004) e99.

Novel stem–loop probe DNA arrays / J. Boateng et al. / Anal. Biochem. 435 (2013) 60–67 [31] T.R. Hughes, M. Mao, A.R. Jones, J. Burchard, M.J. Marton, K.W. Shannon, S.M. Lefkowitz, M. Ziman, J.M. Schelter, M.R. Meyer, et al., Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer, Nat. Biotechnol. 19 (2001) 342–347. [32] D.J. Lockhart, H. Dong, M.C. Byrne, M.T. Follettie, M.V. Gallo, M.S. Chee, M. Mittmann, C. Wang, M. Kobayashi, H. Horton, et al., Expression monitoring by hybridization to high-density oligonucleotide arrays, Nat. Biotechnol. 14 (1996) 1675–1680.

67

[33] D.W. Selinger, K.J. Cheung, R. Mei, E.M. Johansson, C.S. Richmond, F.R. Blattner, D.J. Lockhart, G.M. Church, RNA expression analysis using a 30 base pair resolution Escherichia coli genome array, Nat. Biotechnol. 18 (2000) 1262– 1268. [34] S.K. Khanal, Metabolism in Anaerobic Biotechnology for Bioenergy Production: Principles and Applications, Wiley–Blackwell, Ames, IA, 2008.