Nucleotide Sequence of the Pirital Virus (Family Arenaviridae) Small Genomic Segment

Biochemical and Biophysical Research Communications 280, 1402–1407 (2001) doi:10.1006/bbrc.2001.4288, available online at http://www.idealibrary.com on

Nucleotide Sequence of the Pirital Virus (Family Arenaviridae) Small Genomic Segment Re´mi N. Charrel,* ,† ,1 Xavier de Lamballerie,† Philippe De Micco,† and Charles F. Fulhorst* *Center for Tropical Diseases and Department of Pathology, University of Texas Medical Branch, Galveston, Texas 77555-0609; and †Unite´ des Virus Emergents, Laboratoire de Virologie Mole´culaire, Tropicale et transfusionnelle, Faculte´ de Me´decine, 27 boulevard Jean Moulin, Marseille 13005, France

Received December 27, 2000

Pirital virus is a newly discovered South American member of the family Arenaviridae. We determined that the complete nucleotide sequence of the small genomic segment of Pirital virus is 3393 nt long, and encodes the viral nucleoprotein (N) and glycoprotein precursor (GPC) (561 aa and 509 aa, respectively) in nonoverlapping open reading frames of opposite polarities. The N and GPC genes are separated by an intergenic region that is 80 nt long; the predicted secondary structure of this region includes a single hairpin stabilized by 11 G-C and 8 A-U base pairs. Independent analyses of N and GPC amino acid sequence data confirmed that Pirital virus is related to Pichinde´ virus and belongs to the lineage A of the New World (Tacaribe complex) arenaviruses. The analysis of genetic distances between Pirital virus and other arenaviruses confirmed that Pirital virus is a distinct species within the family Arenaviridae. © 2001 Academic Press Key Words: Pirital virus; Arenaviridae; Tacaribe complex; arenavirus; phylogeny; taxonomy.

viruses represent 3 phylogenetic lineages (designated A, B, and C). Pirital (PIR) virus is a newly discovered arenavirus. The first strains of this virus were originally recovered from Sigmodon alstoni (cotton rat) captured in Western Venezuela (5, 6). Prior to this study, knowledge of the PIR virus genome was limited to a partial length region (616 nucleotides, positions 1786 to 2401) of the N gene (5). Phylogenetic analyses based on this region determined that PIR virus was included in the lineage A with 3 other South American viruses (Pichinde [PIC], Flexal [FLE], and Parana [PAR]) and 2 North American viruses (Whitewater Arroyo [WWA] and Tamiami [TAM]) (2, 3, 4). The objective of the present study was to extend our knowledge on the phylogenetic relationships between PIR virus and other Tacaribe complex arenaviruses. For this purpose, the nucleotide sequence of the complete S genomic segment was determined and compared to that of other arenaviruses. MATERIALS AND METHODS

The viruses in the family Arenaviridae possess bisegmented RNA genomes. The large (L) genomic segment (⬃7200 nt) encodes the viral RNA-dependent RNA polymerase and a zinc-binding protein. The small (S) genomic segment (⬃3500 nt) encodes the nucleoprotein (N) and the glycoprotein precursor (GPC) in two nonoverlapping reading frames (ORF) of opposite polarities (1). The GPC is cotranslationally cleaved into the envelope proteins G1 and G2 (1). The most comprehensive studies on the phylogeny of the arenaviruses (2, 3, 4) were based on nucleotide sequences of a small fragment (613– 631 nt, depending on the virus) of the N gene. The results of those studies indicated that the 14 Tacaribe complex (New World) 1

To whom correspondence should be addressed. Fax: (33) 491 32-44-95. E-mail: [email protected]. 0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.

Safety. All work with infectious virus was done in a biosafety level 3 (BSL-3) laboratory at the University of Texas Medical Branch, Galveston. Virus. The PIR virus prototype strain VAV-488 was first recovered from the spleen of a Sigmodon alstoni (cotton rat) by cultivation in monolayer cultures of Vero E6 cells (5). The passage history of the virus used in the present study was Vero E6 ⫹ 4. Preparation of viral RNA. Total RNA was extracted from Vero E6 cell monolayers infected with the PIR virus prototype strain VAV-488, using the RNA NOW TC-kit (Biogentex. Inc., Seabrook, TX) according to the manufacturer’s instructions. Briefly, Vero monolayers in 25-cm 2 plastic tissue flasks each were inoculated with 0.2 ml of a 1:100 v/v suspension of the stock virus. On day 12 post inoculation, the cell culture fluid overlay was discarded and 2.0 ml of RNA NOW TC cell lysis reagent was applied to the cell monolayer. The cell lysate was incubated for 2 min at room temperature; then 2.0 ml of the RNA NOW TC extraction reagent was gently mixed with the cell lysate. Aliquots of 750 ␮l were transferred to 1.5 ml microfuge tubes, and 200 ␮l of chloroform was

1402

Vol. 280, No. 5, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 1

Oligonucleotide Primers Used for the Amplification and the Sequencing of PIR Virus Prototype Strain VAV-488 PCR product Amplification reaction P1 P2 Sequencing reaction P1-a P1-b P1-c P1-d P2-a P2-b P2-c P2d

Sequence (5⬘ to 3⬘) 1

Oligonucleotide

Nt position 2

ARE-3⬘END 3 PIR-C 4 PIR-V 4 ARE-3⬘END 3

GCCTAGGATCCACTGTGCG CARGTYAAAGGGAGAGCTTGGG GGAGAKCCYTTCTTCTTTCTTGC CGCACAGTGGATCCTAGGC

1–19 2382–2361 1805–1827 3375–3393

1a-V 5 PIR-C 4 ARE-3⬘END 3 1b-C 5 1c-C 5 ARE-3⬘END 3 1a-V 5 1d-C 5 PIR-V 4 ARE-3⬘END 3 PIR-V 4 PIR-C 4 2c-V 5 ARE-3⬘END 3 2d-V 5 ARE-3⬘END 3

CCTATYTGYAAYTACACCAAATT CARGTYAAAGGGAGAGCTTGGG GCCTAGGATCCACTGTGCG GTSTGRTTGAKRTACCAAAAT GTGGTGTTTTCTGGTCCCTTATAG CGCACAGTGGATCCTAGGC CCTATYTGYAAYTACACCAAATT CACTGTGCICTICTIGACIICITIATGT GGAGAKCCYTTCTTCTTTCTTGC CGCACAGTGGATCCTAGGC GGAGAKCCYTTCTTCTTTCTTGC CARGTYAAAGGGAGAGCTTGGG GGTGGCCCYTCWATRTCAATCCA CGCACAGTGGATCCTAGGC TCATTAGTGCATCAACTTCTTT CGCACAGTGGATCCTAGGC

1175–1197 2382–2361 1–19 1215–1195 354–331 1–19 1175–1197 1785–1758 1805–1827 3375–3393 1805–1827 2382–2361 2189–2211 3375–3393 3111–3132 3375–3393

Y ⫽ C and T; R ⫽ A and G; M ⫽ A and C; K ⫽ G and T; S ⫽ G and C; W ⫽ A and T; I ⫽ inosine. Nucleotide positions numbered from the 5⬘ end of the small genomic segment of Pirital virus prototype strain VAV-488 (GenBank Accession No. AF277659). 3 Oligonucleotide ARE-3⬘END (7) anneals to the terminal 19 nucleotides at the 5⬘ and 3⬘ ends of the antigenomic (positions 1–19) and genomic (positions 3375–3393) S RNA, respectively (7). 4 Oligonucleotide designed based on sequence data from the GenBank database. 5 Oligonucleotide designed based on sequence data generated in the present study. 1 2

added to each tube. The chloroform-lysate mixture was vigorously mixed, incubated on wet ice for 10 min, and then centrifuged at 14,000g at 4°C for 10 min. The aqueous phase was transferred into a new sterile 1.5 ml microfuge tube, mixed with 600 ␮l of 100% isopropanol, incubated overnight at ⫺20°C, and centrifuged at 14,000g for 15 min. The RNA pellet was washed with 1.0 ml of 70% ethanol, centrifuged at 14,000g for 10 min, air-dried at 37°C, resuspended into 50 ␮l of RNase-free sterile water, and stored at ⫺70°C until processed. Reverse transcription, polymerase chain amplification, and sequencing reactions. Reverse transcription of virus-specific RNA was carried out at 42°C in a 20 ␮l reaction that included 11 ␮l of RNA extract, 200 U of Superscript II RNase H ⫺ Reverse Transcriptase (Gibco BRL, Life Technologies, Inc., Grand Island, NY) and 2 pmol of oligonucleotide ARE-3⬘END (7). DNA products were generated from two overlapping regions (P1 and P2) of the first strand cDNA, using a polymerase chain reaction (PCR) assay (Fig. 1). The P1 fragment was synthesized by using ARE-3⬘END in conjunction with oligonucleotide PIR-C (Table 1); the P2 fragment was generated by using ARE-3⬘END in conjunction with oligonucleotide PIR-V. The PCR reactions were carried out in a volume of 50 ␮l that included 10 mM Tris–HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 ␮M each dNTP, 0.2 ␮M of each primer, 5 ␮l of cDNA and 1.5 U of Taq DNA polymerase (Promega Corp., Madison, WI). The thermocycler profile was 5 min at 95°C, followed by 35 cycles of 30 s at 95°C, 1 min at 50°C, and 2 min at 72°C, and terminated by a final extension for 7 min at 72°C. PCR products of the expected size were purified from agarose gel slices by using the Wizard PCR Preps DNA Purification System (Promega Corp.). Both strands of each PCR products were sequenced

directly, using the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer Corp., Foster City, CA). The oligonucleotides that were used to prime the cycle sequencing reactions included ARE-3⬘END, PIR-C, PIR-V, and 6 oligonucleotides that were designed based on sequence data generated in the present study (Table 1). The products of the cycle sequencing reactions were analyzed on an ABI Prism 373XL automated sequencer (Perkin-Elmer Corp.). Sequence data and phylogenetic analysis. The analyses reported in this study were done exclusively with complete GPC or N gene sequences. GPC and N sequences of PIR virus strain VAV-488 were compared to sequences corresponding to different strains of New World arenaviruses available in the GenBank database (November 2000): Junin (JUN) virus strains MC2 [D10072] and XJ [U70799, U70802], Machupo (MAC) virus strain AA288-77 [X62616], Oliveros (OLV) virus strain 3229 [U34248], PIC virus strains An3739 [K02734] and Munchique [AF081552], Sabia (SAB) virus strain SPH114202 [U41071], Tacaribe (TCR) virus strain TRVL11573 [M20304]. Two Old World arenavirus, Lassa (LAS) virus strain Josiah [J04324] and lymphocytic choriomeningitis (LCM) strain Armstrong [M20869] were used as outgroup in the phylogenetic analyses. The amino acid sequence alignment was generated with Clustal W 1.7 (8). Amino acid sequences identities were calculated by the pairwise distance algorithm with the MEGA software program (9). Phylogenetic relationships were determined by using the Gamma distance algorithm (10) with a shape parameter ␣ ⫽ 2 and the neighborjoining (NJ) method implemented in MEGA. The robustness of the resulting branching patterns was tested by bootstrap analysis (11) with 500 replications.

1403

Vol. 280, No. 5, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 1. Strategy for amplification and direct sequencing of PIR virus prototype strain VAV-488. Empty arrows correspond to the primers used for amplification of P1 and P2 from specific cDNA; the corresponding primer names are underlined. Black arrows correspond to the primers used for sequencing P1-a, P1-b, P1-c, P1-d, P2-a, P2-b, P2-c, and P2-d. N refers to the nuceoprotein gene; GPC refers to the glycoprotein precursor gene.

RESULTS AND DISCUSSION Together, the P1 and P2 DNA products (2382 bp and 1589 bp, respectively) generated from the PIR virus S segment represented a sequence that is 3393 nt in length (Fig. 1). The sequence of the 19 nt located at the extreme 3⬘ and 5⬘ ends were inferred from the sequence of oligonucleotide ARE-3⬘END, in view of the fact that these regions are reverse complementary to each other and highly conserved in other arenaviruses (2, 12), and that ARE-3⬘END primed cDNA synthesis and PCR amplification for P1 and P2. The 3393 nt sequence was deposited in the GenBank database under Accession No. AF277659. The PIR virus N gene comprises a single ORF, with the initiation (AUG) codon at nucleotides 3342–3340 (nt positions numbered from the 5⬘ end of the S segment) and an UGA translational termination signal at nt 1659 –1657. The length of the N gene ORF (1683 nt) and N protein (561 aa) are similar to that of the N gene and N protein of the 6 other Tacaribe complex viruses included in the analysis (range: 1674 –1710 nt and 558 –570 aa, respectively). The N protein is composed of 102 basic amino acids (18.2%), of which 56 are common to all Tacaribe complex viruses included in the analysis (Table 2). The abundance of basic residues in the arenavirus N protein is consistent with its role as an RNA binding protein (13). The PIR virus N protein contains seven putative glycosylation sites compared to five to eight sites for other arenaviruses; three of these sites (located at residues 235–237, 240 –242, and 329 –331) are conserved amongst all Tacaribe complex viruses. The PIR virus N protein contains nine cysteine residues, of which five are common to all of the Tacar-

ibe complex viruses included in this study. In pairwise comparisons, the amino acid sequence of PIR virus N protein was 70.1% identical to PIC virus (lineage A), and less than 58.6% identical to each lineage B and C viruses and Old World arenavirus (Table 3). The PIR virus GPC is encoded in a single ORF, with the initiation (AUG) codon at nucleotides 47– 49 and an TABLE 2

Amino Acid Composition of the Glycoprotein Precursor and Nucleoprotein of the PIR Virus Prototype Strain VAV-488 N Residue A C D E F G H I K L M N P Q R S T V W Y TOTAL

1404

Ala Cys Asp Glu Phe Gly His Ile Lys Leu Met Asn Pro Gln Arg Ser Thr Val Trp Tyr

GPC

Number

%

Number

%

33 9 40 25 13 41 8 28 43 67 17 25 25 28 31 43 31 34 7 13 561

5.88 1.60 7.13 4.46 2.32 7.31 1.43 4.99 7.66 11.94 3.03 4.46 4.46 4.99 5.53 7.66 5.53 6.06 1.25 2.32 100.00

21 21 17 21 24 37 17 33 29 56 12 39 18 17 16 38 37 26 14 15 508

4.13 4.13 3.35 4.13 4.72 7.28 3.35 6.50 5.71 11.02 2.36 7.68 3.54 3.35 3.15 7.48 7.28 5.12 2.76 2.95 100.00

Vol. 280, No. 5, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS TABLE 3

Pairwise Amino Acid Sequence Identities among the Nucleoproteins and Glycoprotein Precursors of PIR Virus Prototype Strain VAV-488 and Eight other Arenaviruses New World (Tacaribe complex) arenaviruses Lineage A PIR

Lineage B PIC

JUN

MAC

TCR

Lineage C SAB

Old World arenaviruses

OLV

LAS

LCM

58.6 57.3 60.2 61.8 60.4 61.3 — 45.3 44.0

49.8 49.9 49.1 49.7 50.0 50.1 50.2 — 59.9

55.6 49.7 50.3 50.0 50.4 52.2 51.0 63.4 —

N amino acid identity (%) PIR PIC a JUN b MAC TCR SAB OLV LAS LCM

— 79.3 41.1 ND 42.1 41.8 48.7 41.1 39.6

70.1 — 41.1 ND 40.8 42.8 49.6 45.6 43.9

56.4 55.1 — ND 67.8 53.9 45.8 42.4 37.4

56.1 55.2 86.4 — ND ND ND ND ND

56.3 56.2 78.3 79.3 — 52.5 45.7 39.6 38.2

55.8 57.5 70.3 71.5 66.8 — 48.4 42.0 36.9

GPC amino acid identity (%) a The identities between Pichinde virus and other viruses correspond to the mean of identities calculated with the two strains An3739 and Munchique. b The identities between Junin virus and other viruses correspond to the mean of identities calculated with the two strains XJ and MC2.

UAG translational termination signal at nucleotides 1574 –1576. The length of the PIR GPC gene ORF (1527 nt) and gene product (509 aa) are similar to that of the GPC genes and GPC gene product of the five other Tacaribe complex arenaviruses included in the analysis (range: 1440 –1554 nt and 480 –518 aa, respectively). The PIR virus GPC contains 14 potential glycosylation sites; five of these sites (two in G1 [aa residues 90 –92 and 182–184], and three in G2 [aa residues 388 –390, 405– 407, and 410 – 412]) are conserved amongst all Tacaribe complex arenaviruses included in this analysis. The PIR virus GPC contains 20 cysteine residues, of which 15 are conserved amongst all Tacaribe complex arenaviruses included in the analysis (Table 2). The putative G1-G2 cleavage site of the PIR virus GPC contains the dibasic motif R-K (residues 271–272) that has been described for other arenaviruses (2). When compared to the homologous sequences of other arenaviruses, the amino acid sequence of the PIR virus GPC gene product was 79.3% identical to that of PIC virus (lineage A), and less than 48.7% identical to amino acid sequences of the GPC of lineage B and C viruses and the Old World arenaviruses (Table 3). The 5⬘ noncoding region of the PIR virus S segment is shorter than the homologous region of other arenaviruses: 46 nt vs 51–116 nt, respectively. The 3⬘ noncoding region of the PIR virus S segment is 51 nt in length vs 52–96 nt for other arenaviruses. The intergenic region (IR) (i.e., the noncoding region that separates the stop codons of the GPC and N genes) is 80 nt in length and extends from nucleotides 1577 to 1656.

The predicted secondary structure of PIR virus IR includes a single, large stem-loop or hairpin structure that is stabilized by 11 G-C and 8 A-U base pairs (Fig. 3). The size and base composition of the PIR virus hairpin structure is very similar to that of PIC virus (14). In contrast, the predicted secondary structure of the IR of OLV, JUN and TCR viruses contains two stem-loop structures (13, 15, 16) and the IR of SAB virus includes three stem-loop structures (17). Phylogenetic analyses performed independently with full-length N amino acid sequence data and fulllength GPC amino acid sequence data, using the gamma distance algorithm and neighbor-joining method, indicated that the PIR virus N and GPC are phylogenetically most closely related to that of PIC virus (Fig. 2). Monophyly of the PIR-PIC virus lineage was supported by a bootstrap value at 100% for N and GPC based topologies. Together, these data confirm the classification of PIR virus into the lineage A of the Tacaribe complex arenaviruses, as previously reported from analysis performed with a small fragment of the arenavirus N protein (2, 3, 4). When compared to other the arenaviruses, the PIR virus GPC and N exhibited the highest amino acid sequence identity with the PIC virus N and GPC gene products: 79.3 and 57.3%, respectively (Table 3). This level of identity is similar to that between antigenically closely related arenavirus species. For example, the JUN virus N gene product is 84.4% identical to the MAC virus N gene product, and the JUN virus GPC and N gene products are 67.8 and 78.3% identical to the TCR virus GPC and N gene products, respectively

1405

Vol. 280, No. 5, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Phylogenetic analysis of arenaviruses based on complete N amino acid and complete GPC amino acid sequences. Distances and groupings were determined by the gamma distance algorithm including a shape parameter ␣ ⫽ 2 and the neighbor-joining method using the MEGA software program (9). Bootstrap values are indicated and correspond to 500 replications.

(Table 3). Thus, the genetic distances between PIR virus and other arenaviruses confirms that PIR virus is a novel species within the family Arenaviridae. Recent studies have provided evidence that PIR virus and Guanarito (GTO) virus, the etiologic agent of Venezuelan hemorrhagic fever (VHF), coexist in the region of Venezuela in which VHF is endemic (4 – 6, 19, 20). In a recent study of 165 VHF cases (21), the laboratory confirmation of GTO viral infection was based

solely on the results of serological tests, i.e., indirect fluorescent antibody tests (IFAT) and/or enzymelinked immunosorbent assays (ELISA). Given the extensive cross-reactivity between GTO and PIR viruses in IFAT’s and ELISA’s (5, 6), some of the VHF cases may have been caused by PIR virus. The availability of nucleotide sequence data for the PIR virus S genomic segment will enable the design of molecular tools and production of recombinant antigens for investigation of

FIG. 3. Predicted base-paired hairpin structures in the intergenic region of PIR virus S RNA by MFOLD 3.0 (18). The positions of the C-terminus of the GPC and N proteins are indicated. The stop codons are underlined. 1406

Vol. 280, No. 5, 2001

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

the human health significance of PIR virus, particularly with regard to the epidemiology of VHF. 9.

ACKNOWLEDGMENTS The National Institutes of Health Grant AI-41435 (entitled “Ecology of emerging arenaviruses in the southwestern United States”) provided financial support for this research. The French Foreign Affairs Ministry (Bourse Lavoisier), Servier Laboratories (Institut de Recherche Internationales Servier, Courbevoie, France), Philippe Foundation (New York, NY 10168), and Association de la Recherche Me´dicale (A.DE.REM, Marseille, France) provided salary support for R. N. Charrel.

10.

11. 12.

REFERENCES 13. 1. Southern, P. J. (1996) Arenaviridae: The viruses and their replication in Fields Virology (Fields, B. N., Knipe, D. M., Howley, P. M., Chanock, R. M., Melnick, J. L., Monath, T. P., Roizman, B., and Straus, S. E., Eds.), 3rd ed., pp. 1505–1519, LippincottRaven Publishers, Philadelphia, PA. 2. Bowen, M. D., Peters, C. J., and Nichol, S. T. (1996) The phylogeny of New World (Tacaribe complex) arenaviruses. Virology 219, 285–290. 3. Bowen, M. D., Peters, C. J., and Nichol, S. T. (1997) Phylogenetic analysis of the Arenaviridae: Patterns of virus evolution and evidence for cospeciation between arenaviruses and their rodent hosts. Mol. Phylogenet. Evol. 8, 301–316. 4. Weaver, S. C., Salas, R. A., de Manzione, N., Fulhorst, C. F., Utrera, A., Mills, J. N., Ksiazek, T. G., Tovar, D., and Tesh, R. B. (2000) Guanarito virus (Arenaviridae) isolates from endemic and outlying localities in Venezuela: Sequence comparisons among and within strains isolated from Venezuela hemorrhagic fever patients and rodents. Virology 66, 189 –195. 5. Fulhorst, C. F., Bowen, M. D., Salas, R. A., de Manzione, N. M., Duno, G., Utrera, A., Ksiazek, T. G., Peters, C. J., Nichol, S. T., De Miller, E., Tovar, D., Ramos, B., Vasquez, C., and Tesh, R. B. (1997) Isolation and characterization of Pirital virus, a newly discovered South American arenavirus. Am. J. Trop. Med. Hyg. 56, 548 –553. 6. Fulhorst, C. F., Bowen, M. D., Salas, R. A., Duno, G., Utrera, A., Ksiazek, T. G., de Manzione, N. M., de Miller, E., Vasquez, C., Peters, C. J., and Tesh, R. B. (1999) Natural rodent host associations of Guanarito and Pirital viruses (family Arenaviridae) in central Venezuela. Am. J. Trop. Med. Hyg. 61, 325–330. 7. Gonzalez, J. P., Sanchez, A., and Rico-Hesse, R. (1995) Molecular phylogeny of Guanarito virus, an emerging arenavirus affecting humans. Am. J. Trop. Med. Hyg. 53, 1– 6. 8. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) CLUSTAL W: Improving the sensitivity of progressive multiple

14.

15.

16.

17.

18. 19.

20.

21.

1407

sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673– 4680. Kumar, S., Tamura, K., and Nei, M. (1993) MEGA: Molecular Evolutionary Genetics Analysis, 1.02 ed., (Pennsylvania State University), University Park, PA. Yang, Z. (1993) Maximum Likelihood estimation of phylogeny from DNA sequences when substitution rate differ over sites. Mol. Biol. Evol. 10, 1396 –1401. Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39, 783–791. Auperin, D. D., Compans, R. W., and Bishop, D. H. L. (1982) Nucleotide sequence conservation at the 3⬘ termini of the virion RNA species of New World and Old World arenaviruses. Virology 121, 200 –203. Bowen, M. D., Peters, C. J., and Nichol, S. T. (1996) Oliveros virus: A novel arenavirus from Argentina. Virology 217, 362– 366. Auperin, D. D., Galinski, M., and Bishop, D. H. L. (1984) The sequence of the N protein gene and intergenic region of the S RNA of Pichinde arenavirus. Virology 134, 208 –219. Ghiringelli, P. D., Riviera-Pomar, R. V., Lozano, M. E., Grau, O., and Romanowski, V. (1991) Molecular organization of Junin virus S RNA. Complete nucleotide sequence, relationship with other members of the Arenaviridae and unusual secondary structures. J. Gen. Virol. 72, 2129 –2141. Franze-Fernandez, M. T., Zetina, C., Iapalucci, S., Lucero, M. A., Bouissou, C., Lopez, R., Rey, O., Daheli, M., Cohen, G. N., and Zakin, M. M. (1987) Molecular structure and early events in the replication of Tacaribe arenavirus S RNA. Virus Res. 7, 309 –324. Gonzalez, J. P., Bowen, M. D., Nichol, S. T., and Rico-Hesse, R. (1996) Genetic characterization and phylogeny of Sabia´ virus, an emergent pathogen in Brazil. Virology 221, 318 –324. Zuker, M. (1989) On finding all suboptimal foldings of an RNA molecule. Science 244, 48 –52. Salas, R., de Manzione, N., Tesh, R. B., Rico-Hesse, R., Shope, R. E., Betancourt, A., Godoy, O., Bruzual, R., Pacheco, M. E., Ramos, B., Taibo, M. E., Tamayo, J. G., Jaimes, E., Vasquez, C., Araoz, F., Querales, J. (1991) Venezuelan haemorrhagic fever. Lancet 338, 1033–1036. Tesh, R. B., Jahrling, P. B., Salas, R., Shope, R. E. (1994) Description of Guanarito virus (Arenaviridae: Arenavirus), the etiologic agent of Venezuelan hemorrhagic fever. Am. J. Trop. Med. Hyg. 50, 452– 459. de Manzione, N., Salas, R. A., Paredes, H., Godoy, O., Rojas, L., Araoz, F., Fulhorst, C. F., Ksiazek, T. G., Mills, J. N., Ellis, B. A., Peters, C. J., Tesh, R. B. (1998) Venezuelan hemorrhagic fever: Clinical and epidemiological studies of 165 cases. Clin. Infect. Dis. 26, 308 –313.