Ocean warming and acidification pose synergistic limits to the thermal niche of an economically important echinoderm

Science of the Total Environment 693 (2019) 133469

Contents lists available at ScienceDirect

Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv

Ocean warming and acidification pose synergistic limits to the thermal niche of an economically important echinoderm Patricio H. Manríquez a,b,⁎, Claudio P. González a,b, Katherina Brokordt c,a, Luis Pereira d, Rodrigo Torres e,f, María E. Lattuca g, Daniel A. Fernández g,h, Myron A. Peck i, Andrea Cucco j, Fabio Antognarelli j, Stefano Marras j, Paolo Domenici j a

Centro de Estudios Avanzados en Zonas Áridas (CEAZA), Coquimbo, Chile Laboratorio de Ecología y Conducta de la Ontogenia Temprana (LECOT), Coquimbo, Chile c Laboratorio de Fisiología y Genética Marina (FIGEMA), Universidad Católica del Norte, Coquimbo, Chile d Departamento de Acuicultura, Facultad de Ciencias de Mar, Universidad Católica del Norte, Coquimbo, Chile e Centro de Investigación en Ecosistemas de la Patagonia (CIEP), Coyhaique, Chile f Centro de Investigación: Dinámica de Ecosistemas Marinos de Altas Latitudes (IDEAL), Punta Arenas, Chile g Laboratorio de Ecología, Fisiología y Evolución de Organismos Acuáticos (LEFyE), Centro Austral de Investigaciones Científicas (CADIC-CONICET), Ushuaia, Argentina h Universidad Nacional de Tierra del Fuego, Instituto de Ciencias Polares, Ambiente y Recursos Naturales, Fuegia Basket 251, 9410 Ushuaia, Tierra del Fuego, Argentina i Institute of Marine Ecosystem and Fisheries Science, Center for Earth System Research and Sustainability, University of Hamburg, GroßeElbstrasse 133, D-22767 Hamburg, Germany j CNR-IAMC-Istituto per l'Ambiente Marino Costiero, Localita Sa Mardini, Torregrande, Oristano 09170, Italy b

H I G H L I G H T S

G R A P H I C A L

• CO2-induced acidification reduced the thermal tolerance in the sea urchin L. albus. • This reduction was achieved by increasing the critical thermal minimum at 15 and 20 °C. • This reduction was also achieved by decreasing the critical thermal maximum at 20 °C. • CO2-induced acidification and warming increase HSP70 transcription levels. • CO2-induced acidification and warming may have implications on community structure.

Laboratory experiments examined the effect of near-future changes in temperature (warming) and pCO2 (acidification) on the marine sea urchin Loxechinus albus using self-righting success as end points, thermal tolerance and HSP70 transcription. Partial thermal tolerance polygons were reduced and HSP70 transcription increased in near-future conditions, potentially disrupting the performance and narrowing the distribution of this species with potential ecological and economic consequences.

a r t i c l e

a b s t r a c t

i n f o

Article history: Received 9 April 2019 Received in revised form 30 June 2019 Accepted 17 July 2019 Available online 22 July 2019 Editor: Henner Hollert

A B S T R A C T

To make robust projectios of the impacts of climate change, it is critical to understand how abiotic factors may interact to constrain the distribution and productivity of marine flora and fauna. We evaluated the effects of projected end of the century ocean acidification (OA) and warming (OW) on the thermal tolerance of an important living marine resource, the sea urchin Loxechinus albus, a benthic shallow water coastal herbivore inhabiting part of the Pacific coast of South America. After exposing young juveniles for a 1-month period to contrasting pCO2 (~500 and 1400 μatm) and temperature (~15 °C and 20 °C) levels, critical thermal maximum (CTmax) and minimum (CTmin) as well as thermal tolerance polygons were assessed based on self-righting success as

⁎ Corresponding author at: Centro de Estudios Avanzados en Zonas Áridas (CEAZA), Coquimbo, Chile. E-mail address: [email protected] (P.H. Manríquez).

https://doi.org/10.1016/j.scitotenv.2019.07.275 0048-9697/© 2019 Published by Elsevier B.V.

2 Keywords: Thermal tolerance Critical thermal minimum Critical thermal maximum Self-righting HSP70 Loxechinus albus

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

an end point. Transcription of heat shock protein 70 (HSP70), a chaperone protecting cellular proteins from environmental stress, was also measured. Exposure to elevated pCO2 significantly reduced thermal tolerance by increasing CTmin at both experimental temperatures and decreasing CTmax at 20 °C. There was also a strong synergistic effect of OA × OW on HSP70 transcription levels which were 75 times higher than in control conditions. If this species is unable to adapt to elevated pCO2 in the future, the reduction in thermal tolerance and HSP response suggests that near-future warming and OA will disrupt their performance and reduce their distribution with ecological and economic consequences. Given the wider latitudinal range (6 to 56°S) and environmental tolerance of L. albus compared to other members of this region's benthic invertebrate community, OW and OA may cause substantial changes to the coastal fauna along this geographical range. © 2019 Published by Elsevier B.V.

1. Introduction Benthic invertebrates play important roles in marine habitats as predators and prey (energy cycling), ecosystem engineers (creating habitats), and provide additional services to human communities (via commercial harvest) (Micael et al., 2009). Ongoing global change such as ocean warming (OW) and ocean acidification (OA) is having important effects on many groups of marine benthic invertebrate species such as cnidarians (Rodolfo-Metalpa et al., 2010; Kenneth et al., 2011; Prada et al., 2017), mollusks (Watson et al., 2012; Duarte et al., 2014; Keppel et al., 2015; Manríquez et al., 2016; Domenici et al., 2017), annelids (Godbold and Solan, 2013), arthropods (Findlay et al., 2009; Zittier et al., 2013) and bryozoans (Rodolfo-Metalpa et al., 2010; Pistevos et al., 2011; Durrant et al., 2013). Studies on echinoderms suggest that both OW and OA could severely impair normal development (Byrne et al., 2009; Byrne et al., 2013; Wolfe et al., 2013; Hardy and Byrne, 2014; Garcia et al., 2015) and alter calcification, test strength and morphology (Gooding et al., 2009; Byrne et al., 2014) with consequences to physiological and behavioural traits (Manríquez et al., 2017). The importance of how animal behaviour may be affected by OA and/or OW has recently been highlighted (Briffa et al., 2012; Nagelkerken and Munday, 2016). These studies suggest that changes to animal behaviour can play an important role in the ecological effects of the ocean acidification and warming in the sea. It is important to understand how ocean stressors such as OA and OW interact to affect both cellular- and organismal-level responses in order to develop effective biomarkers, particularly since cellular responses may occur at lower levels of stress compared to more obvious, whole organism responses (Hook et al., 2014). In benthic stages of marine invertebrates, the potential effects of changes in partial pressure of carbon dioxide (herafter pCO2) have been previously documented at both cellular and organismal levels. For example, increased rates of oxygen consupmtion and HSP70 gene expression were reported in the Antarctic bivalve Laternula elliptica in response to increased or decreased pCO2 levels (Cummings et al., 2011). Recent work on intertidal limpets indicated that OA increased the sensitivity and variability of physiological responses to temperature such as the expression of HSP70 (Wang et al., 2018). Similarly, it has been reported that elevated pCO2, warmer temperature, and the interaction between OA and OW induced HSP70 production in the pearl oyster Pinctada fucata (Liu et al., 2012; Liu et al., 2017), suggesting an inability of that species to cope with projected warming and ocean acidification. The critical thermal minimum and maximum (CTmin, CTmax) are commonly measured to assess the lower and upper limits of the temperature tolerance window. Beyond these critical temperatures, performance and activity rapidly decrease and chances of mortality increase (Huey and Stevenson, 1979). In marine ectotherms, CTmin and CTmax are thresholds beyond which organisms are unable to supply sufficient oxygen to metabolically demanding tissues (oxygen- and capacitylimitation of thermal tolerance, OCLTT) (Pörtner, 2010). Determining CTmax and CTmin for organism at different exposure temperatures provide de endpoint data need to construct CTM-polygons (areas, °C2, of cold and warm temperature tolerance at two or more exposure

temperatures). These polygons define the fundamental (thermal) niche of species (Bennett and Beitinger, 1997; Magnuson et al., 1979) or the intrinsic thermal tholerance zone (i.e. tolerance independent of previous thermal acclimation history) as well as the upper and lower acquiered tolerance zones (i.e. tolerance gained through acclimation) (Beitinger and Bennett, 2000) needed to gain a cause-and-effect understanding of how temperature impacts trophodynamic structure and function (Pörtner, 2008) including fluctuations in the size and productivity of populations (Eme and Bennett, 2009). Since population growth in ectotherm organims depends not only on individual thermal tolerance, focusing solely on individual thermal tolerance range could provide biased estimate of species thermal niche (Gvoždík, 2018). Therefore, our experimental approach to thermal niche only represents a practical method to obtain the minimum and maximum thermal tolerance values and the corresponding thermo tolerance zone under near future pCO2 and temperature levels. The body of evidence collected thus far suggests that the combination of OA and OW will cause either additive, synergistic or antagonistic effects on the performance of marine organisms (reviewed by Byrne and Przeslawski, 2013 and Nagelkerken and Munday, 2016). Continued progress in our understanding of the effect of such interactions, particularly on the thermal tolerance windows, is important if we hope to make robust projections of the potential consequences of global change to ocean species and ecosystems. However, we acknowledged that the thermal niche might be modified by acclimatisation capacity and other factors not investigated here (e.g. ontogeny, inter- intra-population variation or reproduction (Gvoždík, 2012, 2018). The tube feet of echinoderms are used for movement (Kleitman, 1941; Domenici et al., 2003) and are critical for foraging, predator avoidance and self-righting (Domenici et al., 2007; Manríquez et al., 2017). The time needed for self-righting has been used as a reliable measurement of thermal tolerance in six intertidal echinoderms (Ubaldo et al., 2008) and is a relatively stable, mechano-behavioural trait that could be utilized as an indicator of thermal stress. Similarly, upregulation of HSP70 has proven to be a useful molecular indicator of thermal stress (Nguyen et al., 2013; Vergara-Amado et al., 2017; González-Aravena et al., 2018). Sea urchins are found on rocky reefs fringing all the temperate seas of the world and, as grazers of marine algae (Harrold and Pearse, 1987), play an important ecological role in structuring coastal communities in the northern (see Lawrence, 1975; Dayton, 1985) and southern (Dayton et al., 1973, Castilla and Moreno, 1984; Vásquez et al., 1984) hemisphere. The removal of large predators controlling sea urchin populations can trigger important shifts in ecosystem states (Estes and Duggins, 1995; Steneck, 1998). For example, increased grazing by urchins can turn structurally and biologically diverse kelp forests into barrens (Norderhaug and Christie, 2009; Filbee-Dexter and Scheibling, 2012). In ecosystem engineers such as urchins, therefore, changes in behavioural traits including grazing rate (Dean et al., 1984; Harrold and Reed, 1985), self-righting (Kleitman, 1941), foraging speed (Tertschnig, 1989) and tenacity (Tuya et al., 2007) may have important consequences for community structure and ecological functions of coastal ecosystems and the services these habitats provide to human communities.

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

The edible sea urchin Loxechinus albus (Molina, 1782, known locally as the Chilean red sea urchin) is an ecologically and commercially important benthic herbivore found along the Pacific coast of South America from Isla Lobos de Afuera in Perú (~6° S) to the southern end of South America in Tierra del Fuego (~56° S) (Vásquez, 2001; Molinet et al., 2012). In shallow-water coastal ecosystems of Chile, this species is a target for local fishers (Vásquez et al., 1984; Guisado and Castilla, 1987; Castilla, 1990; Vásquez and Donoso, 2013) and represents one of the largest urchin fisheries in the world (Andrew et al., 2002). Across its wide latitudinal and large depth (intertidal to 100 m) distribution (Molinet et al., 2012), L. albus is exposed to a mosaic of temperatures and pCO2 levels from ~22 °C in the north to 5 °C in the south and 500 μatm pCO2 in surface waters to N800 μatm pCO2 in oxygen-poor upwelled waters, suggesting that it has the physiological capacity to cope with habitats varying widely in abiotic characteristics. Nonetheless, OA and/or OW have been documented to have significant effects on somatic growth, structural integrity, metabolic costs and behavioural traits of this species (Manríquez et al., 2017) including altered skeletal structure (Rodriguez et al., 2017) and predator-prey interactions (Lord et al., 2017). Climate change is poised to make substantial changes to the abiotic environment experienced by marine invertebrate communities along the broad Chilean coastline. For example, intensification of upwellingfavourable wind stress and the ENSO cold-phase (La Niña) is expected to increase seasonal and inter-annual fluctuations in temperature and the presence of acidified waters in the central and northern Chilean coastal habitats (17–27°S, Falvey and Garreaud, 2009). This spatiotemporal variability in temperature and pCO2 will be exacerbated by potentially more intense and/or frequent ENSO warm-phases (El Niño events) (Timmermann et al., 1999; Cai et al., 2018). The present study examined the combined impacts of OA and OW on the growth, thermal tolerance window and thermal stress response (HSP transcription) in juvenile urchins (L. albus). Urchins were studied at two temperatures and two pCO2 levels representing the average ambient seawater conditions (15 °C, 500 μatm) at the collection site of animals in northern Chile (29 °S). Given the disagreement in the ammount of future warming for this region in global climate model projections (Oyarzun and Brierley, 2019), the warmer treatment (20 °C) represented the mean 5 °C temperature increase observed in northern Chilean coastal waters during intense El Niño events (Torres et al., 2003). The high pCO2 treatment (1400 μatm) is that projected for the beginning of the next century in the IPCC RCP 8.5 business-as-usual scenario (Meinshausen et al., 2011; IPCC, 2014). Our null hypothesis was that near-future elevated pCO2 and warming would not impact L. albus because of its broad range in physiological tolerance. An alternative hypothesis was that elevated pCO2 and warming would have interactive effects (additive, antagonistic or synergistic) on the thermal physiology of this species, causing a thermal stress response in comparison to current-day levels. 2. Methods 2.1. Production of the study organisms Early benthic stages of Loxechinus albus were produced under laboratory conditions at the Universidad Católica del Norte, Coquimbo, Chile (29° 57′ S; 71° 21′ W). Adults were collected from nearby shallow subtidal zones. Larvae were generated from manipulated fertilisations in which eggs and sperm from 12 females and 8 males were used following standard protocols described for the species (Bustos et al., 1991). Larvae were raised in mass cultures at densities of approximately 1 larva mL−1, fed with a mixed diet of microalgae (Chaetoceros gracilis Pantocsek, 1982 and Isochrysis galbana Parke, 1949) at cell densities of 2 to 4 × 103 mL−1 until they reached settlement competency, and induced to settle on biofilms covering polycarbonate sheets. Prior to the experiments, early settlers of L. albus (0.15–0.20 cm diameter) and small juvenile individuals (N0.2 cm in diameter) were reared in 5000-

3

L containers with running seawater for 12-months. Early settler-stage urchins grazed on biofilms until they reached the small juvenile stage, when their diet was switched to fresh fronds of the green macroalgae Ulva sp. and later to the brown macroalgae Lessonia sp. Moreover, during this period, the urchins were not exposed to predators. 2.2. CO2 mixing system A flow-through CO2 mixing system, as described by Torres et al. (2013), was used to manipulate pCO2 levels in the exposure containers. Briefly, mass flow controllers (Aalborg ®, model GFC) were used to blend air with pure CO2 gas in order to obtain a CO2-enriched air to approximately 1200 μatm, which was then bubbled into 4 large (230-L), independent plastic reservoirs filled with 1.0 μm filtered seawater (FSW). From these reservoirs, treated seawater was delivered to 20 L equilibration containers immersed in temperature-controlled waterbaths (~15 °C and 20 °C) using an electric pump. Subsequently, the treated seawater was delivered to each exposure container. Carbonate system parameters, total alkalinity, pH, temperature and salinity were quantified twice weekly in each experimental treatment on three randomly chosen containers per treatment (Table 1). Total alkalinity (TA) was measured using an automated, open-cell titration system, described by Haraldsson et al. (1997) and the accuracy was verified using certified reference material (CRM) supplied by Andrew Dickson (Scripps Institution of Oceanography, San Diego, USA). Seawater pH was measured inside a 25 mL closed cell at 25 °C using a pH meter (Metrohm 713) with a glass combined double junction Ag/AgCl electrode (Metrohm, 6.0219.100) calibrated using 8.089 Tris buffer (DOE [US Department of Energy], 1994) at 25 °C. Values of pH were reported using the total hydrogen ion scale (DOE, 1994). Temperature and salinity were measured using an Idronaut Ocean Seven CTD (model 304 Plus). Total alkalinity was measured after water samples had been fixed with mercuric chloride in accordance with standard procedures for ocean CO2 measurements (Dickson et al., 2007). Alkalinity was determined by potentiometric titration in an open cell, according to Haraldsson et al. (1997). The accuracy was controlled against a certified reference material supplied by Andrew Dickson (Scripps Institution of Oceanography). The correction factor was ~1.002, corresponding to a difference of b5 μmol kg−1. The pH, total alkalinity, temperature and salinity data were used to calculate the rest of the carbonate system parameters (pCO2 and DIC) and the seawater saturation stage for aragonite using CO2SYS software (Lewis and Wallace, 1998) set with Mehrbach solubility constants (Mehrbach et al., 1973) refitted by Dickson and Millero (1987). 2.3. Experimental rearing During August 2017, 12 months after fertilisation, 92 small juvenile urchins with a mean ± SE diameter of 0.95 ± 0.04 cm were removed from the culturing conditions and randomly placed into four 7-L pexiglass containers with running seawater simulating the average annual temperature (~16 °C) and at the current pCO2 conditions (C, 500 μatm). After 1 month of acclimatization to the laboratory conditions, water temperature were increased or decreased by ~1°C day−1 until the desired exposure temperatures were reached for each treatment. However, as in most similar OA studies, in the present study the pace of pCO2 increments was not controlled and the experimental individuals were moved from the acclimation to the exposure conditions only controlling changes in temperature. Then, the changes in pCO2 levels were conducted only after the requiered experimental temperatures were achieved. Thus, in each experimental temperature two pCO2 conditions were set, current (C; 500 μatm) or future (F; 1400 μatm) conditions (Table 1). Although the vast majority of OA experiments are performed in this manner (with an acute aclimation), to the best knowledge, no studies have examined whether or how the rate of acclimation to different pCO2 levels impact cellular and/or organismal

4

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

Table 1 Average (±SE) treatment conditions of the seawater used to maintain the post metamorphic and small juvenile of Loxechinus albus during the acclimation (12 months) and then a 30-day exposure period to a combination of chronic temperature and pCO2 levels. Current and high pCO2 levels are based on rate of change in pH predicted by the most extreme scenario (RCP8.5 scenario) of atmospheric CO2 for the beginning of the next century. See Meinshausen et al. (2011) for further details. pH at 25 °C (pH units)

Temperature (°C)

AT (μmol kg−1)

pCO2 in situ (μatm)

[CO2− 3 ] in situ (μmol kg−1 SW)

Salinity

Ω calcite

Ω aragonite

Acclimation period Natural seawater

7.824 ± 0.019

16.68 ± 0.27

2278.605 ± 2.466

543.371 ± 21.840

142.654 ± 5.532

34.485 ± 0.039

3.413 ± 0.133

2.196 ± 0.087

Exposure period Natural seawater C15 F15 C20 F20

7.792 ± 0.016 7.738 ± 0.013 7.428 ± 0.021 7.771 ± 0.016 7.453 ± 0.013

14.30 ± 0.15 14.95 ± 0.15 15.05 ± 0.16 20.01 ± 0.26 20.22 ± 0.19

2267.807 ± 11.398 2216.724 ± 13.569 2219.011 ± 7.312 2230.922 ± 9.866 2196.883 ± 12.465

513.148 ± 20.090 594.762 ± 21.401 1359.949 ± 67.341 676.707 ± 33.252 1520.061 ± 44.814

125.622 ± 4.184 109.731 ± 3.167 55.825 ± 2.943 119.909 ± 3.789 60.250 ± 1.904

34.554 ± 0.100 34.426 ± 0.034 34.406 ± 0.034 34.294 ± 0.043 34.454 ± 0.041

3.002 ± 0.100 2.626 ± 0.076 1.336 ± 0.071 2.883 ± 0.091 1.447 ± 0.046

1.924 ± 0.064 1.685 ± 0.049 0.857 ± 0.045 1.871 ± 0.058 0.940 ± 0.030

Treatment

C15, current-day levels (500 μatm) of CO2 at 15 °C; F15, future levels (1400 μatm) CO2 at 15 °C; C20, current-day levels (500 μatm) of CO2 at 20 °C; F20, end of the century levels (1400 μatm) of CO2 at 20 °C. The elevated pCO2 is based on the rate of change in pH predicted by the most extreme scenario (RCP8.5 scenario) of atmospheric CO2 for the beginning of the next century. See Meinshausen et al. (2011) for further details. The parameters of the natural seawater were collected during daylight hours and therefore the average temperature did not include day/night temperature variations.

level. Constant seawater temperature were maintained in the experiment a recirculating system with temperature maintanance provided by two Aqualogic® Titan Water-Cooled Heat Pump (900BTUH) with a digital temperature controller and a temperature sensor accuracy of 1 °C, with an online flow switch. The temperature-controlled seawater was the recirculated through two water tables made of insulated fiberglass ~25 cm deep, one set at 15 °C and the other to 20 °C. The replicate containers were maintained semi-immersed in the temperaturecontrolled water tables described above. During the exposure period, plastic tubing connected to an electric water pump was used to move the treatment FSW from each reservoir container to the experimental units located in the 2 temperature-controlled water tables (~15 °C and 20 °C). In each experimental treatment (n = 4), the sea urchins were separated into 8 replicate groups of 3 individuals and each group was assigned to a separate replicate container (n = 8) filled with 0.6 L of 1.0 μm FSW conditioned to the required pCO2 levels, and placed in the temperature-controlled water tables. Each replicate container was covered with a plastic lid pierced by the drip-feed system. The rate of water delivery from the equilibration vessel to the exposure containers was controlled by a plastic drip-feed system set to deliver at a rate of 1 L h−1 to ensure the renewal of the total seawater of each container 40 times per day. The treatment air supply was delivered to each exposure container by flexible silicone tubing, entering the exposure container through a second hole made in the lid. A standard 1–200 μL pipette tip was inserted at the end of the tub. A continuous stream of either air (500 μatm CO2) or enriched CO2 air (1400 μatm) was bubbled through the pipette. Plastic gang valves were used to control the amount of air delivery to each exposure container. During the exposure period, urchins were fed ad libitum with fresh fragments of the green alga Ulva sp. The mesocosm unit was kept outdoors, adjacent to the water-front and the replicate containers were shaded from direct sunlight by an opaque fabric tent. In the mesocosm, the exposure containers were maintained under a natural light regime for the austral winter months (10:14 h light:dark). Once a week, feces were siphoned out of each rearing container using a silicone tube. Moreover, once a week each replicate container was replaced by a clean-one filled with treated FSW at the corresponding temperature and pCO2. At the end of the exposure period, all the urchins were measured and one urchin was chosen at random from each rearing container and used for the thermal tolerance experiments. Another urchin was chosen at random for HSP70 measurements. 2.4. Size, growth and survival Maximum diameter and both wet and buoyant mass (as a proxy for calcification or dilution) of the small juveniles of L. albus were measured at the beginning and end of the exposure period. The growth and survival at the end of the exposure period (30 days) was evaluated in all

the sea urchins used in the thermal tolerance measurements (see below). Growth in terms of wet mass, buoyant weight and size were expressed as the percentage change per day. Survival was measured considering all urchins contained in the rearing containers. Diameters were measured using a digital calliper. All weight measurements were quantified using an analytical balance (Adam AFA180 LC, 0.1 mg precision). 2.5. Real-time quantitative PCR (RT-qPCR) analysis of HSP70 transcription HSP70 is considered a specific bio-indicator of thermal stress for L. albus (Vergara-Amado et al., 2017); therefore, HSP70 transcriptional relative levels were measured as an indicator of cellular stress in the complete soft tissues of juvenile sea urchins after the 30-days exposure period, under contrasting pCO2 and temperature levels. To this end, total RNA was extracted from soft tissue of each individual using the TRIzol® Reagent (Invitrogen™, USA) method following the manufacturer's instructions. The RNA obtained was quantified with an Epoch spectrophotometer (BioTek, USA); and its intactness was verified by visual inspection of integrity of 28S and 18S rRNA bands in denaturing formaldehyde/agarose gel electrophoresis stained with SYBR® Safe (Invitrogen™, USA). Reverse transcription (RT) of RNAs from tissues was carried out with a PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Japan) and oligo-p (dT)15 primer according to the manufacturer's protocol. RT of RNAs was done in equi-proportions (i.e., from equal quantity of RNA) within all compared samples from each experiment. Primers for RT-qPCR reaction were designed by comparing sequence homology using data from several sea urchin species deposited in the GenBank (Supplementary information), and using the Primer Express v3.0 software (Applied Biosystems, USA) to have melting temperatures of 58 to 60 °C and generate PCR products of 50 to 150 bp. For HSP70 the forward primer was 5′CGGGCCGTAGTAACAAGATCA3′; and the reverse 5′ACCCTTCGAGTTGGTTCTTGG3′. The amplified region included a partial 3′-UTR sequence, in order to amplify specifically the gene under study and no other putative homologues. β-Actin was used as endogenous control in order to normalize experimental results. For β-actin the forward primer was 5′TCTGCTACGTTGCTCTTGACT3′; and the reverse 5′CTCGTTGCCAATGGTGATGAC3′. In order to validate β-actin as a housekeeping gene for our samples, statistical tests on β-actin expression values among different tissues and challenged animals were performed, and non-significant differences were found among them (p N 0.05; statistical power = 0.87). Reaction specificities were tested with melt gradient dissociation curves and electrophoresis gels of each PCR product. PCR products were sequenced and used for BLAST confirmation of specificity. RT-qPCR assays were performed in triplicate using Eco™ Real-Time PCR System (Illumina, San Diego, CA, USA). The 20 μL-volume reaction consisted in 10 μL of 2× Maxima® SYBR Green/ROX qPCR Master Mix

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

(Thermo Scientific, Rockford, IL, USA), 2 μL of cDNA and 0.3 μM (final concentration) of each primer. Initial denaturation time was 10 min at 95 °C, followed by 40 PCR cycles of 95 °C, 15 s and 60 °C, 1 min. After the PCR cycles, the purity of the PCR product was checked by the analysis of its melting curve; the thermal profile for melting curve analysis consisted of denaturation for 15 s at 95 °C, lowered to 55 °C for 15 s and then increased to 95 °C for 15 s with continuous fluorescence readings. By serial dilution of cDNA, RT-qPCR efficiency was set at 95–110%. Efficiency of HSP70 amplification was similar to that of the housekeeping gene (as it was determined by slope calculation), so the comparative CT method (also called the ΔΔCT method; Livak and Schmittgen, 2001) was applied for relative quantification of HSP70. Experiments included 8 biological replicates and three technical replicates were performed.

2.6. Thermal tolerance After the exposure period, the critical thermal minimum (CTmin) and the critical thermal maximum (CTmax) (both previously defined in the introduction) of small juveniles of L. albus were determined using the Critical Thermal Methodology (CTM, previously defined in the introduction), which involves organisms being initially acclimated to a predetermined temperature and then subjected to a continuous temperature change until the point at which a predefined sub-lethal endpoint is reached (Lutterschmidt and Hutchison, 1997). In the CTM, the increments and reductions in temperature were beyond realistic changes predicted in terms of climate change but from the methodological perspective our aim was to address relevant physiological responses to climate change stressors. To determine CTmin and CTmax, sea urchins were placed into plastic beakers suspended within a 30 L thermo-stated bath connected to a temperature-controlled, circulating water bath (Lab Companion RW-2025G). During the trials, sea urchins were exposed to a constant rate of change (increase or decrease) of ~0.05 °C min−1 (3.00 °C h−1; Table 1) and observed continuously until they reached the end-point (see below). From each exposure container, one sea urchin was selected at random and placed individually in another 1 L plastic container filled with FSW at the corresponding starting temperature for 5 min of acclimation under vigorous aeration. After a 1 °C change in water temperature, self-righting success time and time to self-right was measured at the new temperature. After successful selfrighting, the container was aerated to avoid oxygen depletion. All measurements were conducted under standard conditions of pCO2 (currentday levels). A digital thermometer (PCE-T390 4 channel thermometer) was used to monitored temperature in the exposure containers. Inability to self-right within 20 min was considered as the end-point since it involves a relatively simple procedure. Urchins were carefully placed upside down in the middle of the container. Preliminary observations showed that L. albus, like other sea urchin species (Sherman, 2015; Manríquez et al., 2017) placed in this position readily turn over with a righting manoeuvre. Those sea urchins that were unable to self-right but that displayed tube feet, spine and pedicellariae movement were given a second chance to self-right at the next measurement temperature. The CTmax and CTmin end-point were defined as the temperatures at which sea urchins first lost the ability to self-right and could not self-right after being tested again at two successive (colder or warmer) temperatures. Time to self-right was measured with a digital stopwatch. Self-righting behaviour was monitored continuously and the time needed for full righting was noted. Tube feet were categorized as either projected and actively mobile or retracted and motionless. Spines were categorized as either moving or motionless. All CTmin and CTmax measurements were performed during daytime (~10:00 to 19:00). After the end-point, each urchin was returned to the treatment conditions to evaluate their recovery capacity after 10 min and then after 2 days. Recovery was based on their abilities to adhere to the substratum and self-right, and move their pedicellariae and spines during a 20 min observation period.

5

2.7. Partial thermal polygons Upper and lower thermal tolerance for current-day and elevated pCO2 and temperature levels were calculated as the mean of the CTmin or CTmax. Partial thermal tolerance polygons were constructed for L. albus by connecting the CTmin and CTmax with CTM regressions to produce a quadrilateral figure. Considering the defined apices, the area of each partial polygon was expressed in unit °C2 with a 95% confidence interval (CI), which was calculated using the 95% CI of each CTmax/CTmin value. The area of each polygon was expressed in units °C2 considering the defined apices. In the literature these thermal tolerance polygons have been traditionally constructed to provide not only the thermal tolerance range or requirements of organisms, but also a useful method of comparison between species (Elliott, 1991; Bennett and Beitinger, 1997; Beitinger and Bennett, 2000; Calosi et al., 2008; Eme and Bennett, 2009; Boher et al., 2010; Elliot, 2010; Dabruzzi et al., 2012; Barrantes et al., 2017; Lattuca et al., 2018). The larger the area of the polygon, the wider the range in thermal tolerance of the species (Calosi et al., 2008). In the present study, partial dynamic temperature tolerance polygons were constructed for sea urchins acclimated to different temperature and pCO2 levels. The polygonal areas were further partitioned into three distinct zones and also expressed with their 95% CI: an intrinsic tolerance zone (ITZ), which is independent of previous thermal acclimation history, bounded by upper and lower acquired tolerance zones (UAZ and LAZ, respectively) that represent the thermal tolerance gained through acclimation. These areas were obtained by dividing the polygons with horizontal lines originating at the intersection of the CTM regressions with vertical lines connecting the CTmin and CTmax values at each exposure temperature (Beitinger and Bennett, 2000; Fangue and Bennett, 2003; Eme and Bennett, 2009, Dabruzzi et al., 2012; Dülger et al., 2012; Barrantes et al., 2017, Lattuca et al., 2018).

2.8. Statistical analysis Diameter and weights at the beginning of the experiments were compared with one-way ANOVA. Two-way ANOVAs, followed by a post hoc test (Tukey test) were used to evaluate the effect of pCO2 and temperature on HSP70 transcription, specific growth in terms of wet mass, buoyant weight and size. Because CTmin and CTmax (selfrighting) data failed to meet parametric assumptions, they were examined after an Aligned Rank Transformation (ART) (Wobbrock et al., 2011), followed by a post hoc test (artlm using the Tukey's method). Normality of residuals was tested using the Shapiro-Wilk test and homogeneity of variances was tested using Levene's test. Data analysis was conducted using R software (version 3.5.1; R Core Team, 2016).

3. Results 3.1. Size, growth and survival At the beginning of the exposure period, juveniles of Loxechinus albus had a mean (±SE) diameter (mm), wet mass (g) and buoyant weight (g) of 9.620 (0.006), 0.343 (0.001) and 0.056 (0.001) respectively, and no significant differences were found in these measures among the four treatment groups (Table 2). After a 30-days exposure period, the specific growth rates in terms of diameter and wet mass of sea urchins were similar among the four treatment groups and no significant effects of temperature and pCO2 were found (Table 3, Fig. 1). However, the specific growth rate in terms of buoyant weight was significantly higher in sea urchins at 20 °C compared to 15 °C (Table 3, Fig. 1). No mortality occurred during the 30-day exposure period.

6

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

Table 2 Mean (±SE) initial body parameters and the cooling and heating rates used to measure the critical thermal minima/maxima (CTmin/CTmax) in small juveniles of Loxechinus albus after a 30-day exposure period to a combination of pCO2 and temperature levels (see Table 1 for details). Treatment

N

Initial size (mm)

Initial wet mass (g)

Initial buoyant weight (g)

Cooling rate (°C min−1)

Heating rate (°C min−1)

CTmin (°C)

CTmax (°C)

C15 F15 C20 F20

8 8 8 8

9.69 (0.11) 9.44 (0.07) 9.71 (0.07) 9.65 (0.09)

0.35 (0.01) 0.32 (0.01) 0.36 (0.01) 0.37 (0.01)

0.056 (0.002) 0.055 (0.002) 0.056 (0.002) 0.059 (0.002)

0.047 (0.002) 0.050 (0.004) 0.049 (0.003) 0.049 (0.002)

0.045 (0.003) 0.047 (0.003) 0.052 (0.004) 0.048 (0.003)

6.75 (0.45) 10.71 (0.44) 11.50 (0.91) 15.25 (0.90)

26.75 (0.16) 26.50 (0.38) 27.75 (0.16) 26.75 (0.84)

Initial body parameters and cooling/heating rates were compared with 1-way ANOVA and no significant differences were found.

3.2. Cellular stress: HSP70 transcriptional levels Both, temperature and pCO2, as well as their interaction, significantly affected HSP70 levels in small juvenile L. albus (Table 4). Although statistical analyses show that HSP70 was higher at 20 °C than 15 °C, and at future than current pCO2, this result was due to the high over expression observed for the combined effects of this high temperature/pCO2 levels. Indeed, the interaction between 20 °C and future pCO2 levels induced the strongest expression of HSP70, i.e., by ~75 fold compared to the other treatments (Fig. 2). The averages of those treatments (C15, F15 and C20) were on average ~3.9 relative levels, and no significant differences were found between them (Table 4).

(DF = 1; F = 0.04; p = 0.832). CTmin at 15 and 20 °C exposure temperature treatments was on average 7.25 °C and 12.50 °C, respectively. However, CTmin at current-day and elevated pCO2 levels was on average 13.98 °C and 9.88 °C, respectively. After the CTmin and CTmax trials, full recovery was observed in all individuals (i.e. all urchins adhered to the substratum, displayed active movement of tube feet (podia), spines and pedicellariae and were able to self-right within 20 min. 3.4. Partial thermal-polygons Considering mean values of CTmin and CTmax, the thermal tolerance zone of L. albus at both temperatures (~15 and 20 °C) and pCO2

3.3. Thermal tolerance Self-righting response in L. albus was achieved by two consecutive phases. In the first one, the action of the tube feet pulled the upside down urchin to a position in which the major axis reached a perpendicular angle with the bottom (the first 90° angle). Next, the urchin rolled upright due to their own weight and the action of the tube feet (Fig. 3). Failure to self-right was always associated with a lack of appendage movement. During CTmax measurements, the average time to selfright at the exposure temperature was ~4 to 5 min across all treatments. As temperature increased above the exposure temperature, the movement of the tube feet, spines and pedicellariae decreased. The tube feet, spines and pedicellariae movement ceased at the end-point (selfrighting failure). The critical thermal maximum was significantly affected by temperature (ART analysis, DF = 1; F = 11.12; p = 0.002) but not pCO2 (DF = 1; F = 0.38; p = 0.542) and the interaction between both factors (DF = 1; F = 0.07; p = 0.789) (Fig. 4), and on average ranged between 25.75 and 26.75 °C for 15 and 20 °C exposure temperature treatments, respectively. On the other hand, the critical thermal minimum was significantly affected by temperature (ART analysis, DF = 1; F = 69.48; p b 0.0001) and pCO2 (DF = 1; F = 52.45; p b 0.0001), but not the interaction effect Table 3 Results of the 2-way ANOVA on the effect of a 30-day exposure period to contrasting temperature and pCO2 levels (see Table 1 for details) on the specific growth rate in terms of diameter, wet and buoyant weights of small juveniles of Loxechinus albus. Statistically significant values (p ≤ 0.05) are indicated in bold. Trait

Source

Diameter Temperature (cm; % day−1) pCO2 Temperature × pCO2 Residuals Wet mass Temperature −1 (g; % day ) pCO2 Temperature × pCO2 Residuals Buoyant weight Temperature −1 (g; % day ) pCO2 Temperature × pCO2 Residuals

DF MS

F

p

Comparison

1 1 1

0.0005 0.016 0.901 0.0042 0.126 0.724 0.0156 0.462 0.500

60 1 1 1

0.0338 0.5467 2.323 0.133 0.2437 1.036 0.313 0.0678 0.288 0.593

60 1 1 1

0.2353 1.3775 5.391 0.024 20 °C N 15 °C 0.0006 0.002 0.960 0.0567 0.222 0.640

60 0.2555

Fig. 1. The effect of different pCO2 and temperature levels on specific growth rate in diameter (a), wet mass (b) and buoyant weight (c) in small juvenile urchins (Loxechinus albus) during a 30-day exposure period to contrasting pCO2 (open bars: current-day; filled bars: elevated levels) and temperature levels. Data are presented as box plots, the boundaries of the boxes represent the 25th and 75th percentile; the solid line within the box is the median and the lines above and below indicates the 10th and 90th percentiles; the black dot is the mean and the points beyond the error bars are the outliers. Different letters above the box plots represent significant differences (2-way ANOVA, see Table 3 for details). Sample size in each bocplot is 8).

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469 Table 4 Results of the 2-way ANOVA and pairwise comparison on the effect of a 30-days exposure period to contrasting temperature and pCO2 levels (see Table 1 for details) on the relative transcriptional levels of HSP70 in small juveniles of Loxechinus albus. Statistically significant values (p ≤ 0.05) are indicated in bold. Source

DF MS

F

p

Comparison

Temperature 1 38,992 12.08 0.002 20 °C N 15 °C pCO2 1 22,191 7.22 0.015 FNC Temperature × pCO2 1 28,372 8.95 0.007 20°/F N 20°/C = 15°/F = 15°/C Residuals 22 3170 C represents current (500 μatm); and F future levels (1400 μatm) of pCO2.

levels (~500 vs. 1400 μatm) was 81.9 °C2 (95% CI = 73.9–90.0 °C2) and 58.2 °C2 (95% CI = 44.1–70.0 °C2) for current-day and future levels, respectively (Fig. 5). For current-day levels, the intrinsic tolerance zone (ITZ) was calculated in 66.3 °C2 (95% CI = 55.8–76.8 °C2) and the upper (UATZ) and lower (LATZ) acquired thermal tolerance zones represented 3.1% and 16.0% of the sea urchin's tolerance zone, respectively, and comprised 15.6 °C2 (UATZ = 2.5 °C2, CI = 2.5–2.5 °C2; LATZ = 13.1 °C2, CI = 10.7–15.6 °C2) of the partial polygon area. For future levels, the ITZ was 46.2 °C2 (95% CI = 30.4–58.8 °C2) and accounted for 79.43% of the partial thermal polygon. The UATZ and LATZ encompassed 12.0 °C2 (UATZ = 0.6 °C2, CI = 0.2–2.9 °C2; LATZ = 11.4 °C2, CI = 9.2–13.5 °C2) of the acclimation area and represented 1.1% and 19.5% of the sea urchin's thermal polygon, respectively. 4. Discussion Both ocean acidification (OA) and ocean warming (OW) are considered two imminent threats to marine biodiversity and ecosystem structure (Crain et al., 2008; Foo and Byrne, 2016) and studies advancing a cause-and-effect understanding of their combined effect on various life stages are needed to understand the vulnerability of marine species to projected future conditions (Hofmann and Todgham, 2010). Despite the economic and ecological importance of several sea urchin species in the world's oceans, the present study is one of only a few to investigate the combined effect of OA and OW on their benthic life stages (Gooding et al., 2009; Wolfe et al., 2013; Manríquez et al., 2017). By examining both cellular- and organismal-level responses in L. albus, an ecosystem engineer supporting one of the largest echinoderm fisheries in the world, we found clear synergistic effects of OA and OW on the thermal tolerance window and thermal stress response which may have

Fig. 2. HSP70 relative transcriptional levels in small juvenile urchins (Loxechinus albus) after a 30-day exposure period to contrasting pCO2 (open bars: current-day; filled bars: elevated levels) and temperature levels. C and F are current-day and future pCO2 levels, respectively. The asterisk denotes significant differences (2-way ANOVA, see Table 4). Open filled bars depicts present and future pCO2 levels. Numbers above boxplots indicate sample size.

7

important ecological and commercial consequences if current trajectories of climate change continue in the future. In the present study, the specific growth rate (in diameter and wet mass) of L. albus was not affected by pCO2 and temperature during the 30-day exposure period which agrees with a previous study conducted on juveniles of this species (Manríquez et al., 2017). Similar to our results obtained in our medium-term exposure (30-day, longer than short experiments of few hours), survival remained high (85 to 100%) throughout a 7-month exposure of the same species to similar conditions (Manríquez et al., 2017). This suggests that, in terms of growth and survival, near future levels of pCO2 and temperature may not be important threats at the organismal level for small juvenile L. albus. At the cellular level, transcriptional levels of HSP70 in small juveniles did not differ after the 30-day exposure to low pCO2 levels at either 15 °C and 20 °C. This lack of response could be predicted from the results of previous work on thermal stress tolerance of juveniles of this species in which upregulation of HSP70 was observed only during the initial 12 h but not after 48 h of exposure to a 4 °C increase in temperature (Vergara-Amado et al., 2017). Interestingly, the present study indicates that, although no up regulation of HSP70 was observed after 30-day at elevated pCO2 (1400 μatm) at 15 °C, there was a clear, strong (75fold) upregulation of HSP70 at 20 °C indicating a synergistic effect of high temperature and high pCO2 levels on the thermal stress response. Thus, juvenile L. albus exposed to near future pCO2 levels are expected to be more vulnerable to thermal stress associated either with El Niño events or due climate-driven warming. This result rejects the null hypothesis and supports the alternative hypothesis that the combined effect of elevated pCO2 and temperature alters the thermal stress response, potentially narrowing the thermal tolerance window of juvenile L. albus. This suggest the existence in juveniles L. albus of crosssusceptibility and synergism and the lack of cross-tolerance; the first stressor (pCO2) reduced the tolerance of urchins to the second stressor (temperature). The synthesis of stress proteins is an energetically expensive process (Currie et al., 1999; Liu et al., 2006; Brokordt et al., 2015) and the high levels of HSP70 transcripts observed in the present study after a 30day exposure are expected to reduce the amount of energy (in terms of ATP) available for other processes such as growth, locomotion and self-righting. The available information suggests that food availability may play an important role in modulating the sensitivity of calcifying marine invertebrates to OA (Melzner et al., 2011; Hettinger et al., 2013; Thomsen et al., 2013; Stiasny et al., 2018) and terrestrial arthropods (Chidawanyika and Terblanche, 2011; Nyamukondiwa and Terblanche, 2009). In our study, the sea urchins were fed ad libitum, a typical situation in situ (González et al., 2008), and the lack of negative effects of the stressors on growth may be due to compensatory feeding and energy intake (not examined). Therefore, any confounding effect of energy shortage due to poor feeding on differential responses to OA is unlikely. Further studies are needed, however, for a mechanistic understanding of potential energy trade-offs associated with coping with elevated pCO2 and warming in nature. The absence of significant effects of pCO2 and temperature at the organismal level (growth and survival) and the significant effect at the cellular level (expression of HSP70) suggests that the sensitivity or tolerance of this species to global stressors such as temperature and pCO2 at the organismal level may occur at higher levels of stress. In sea urchins, the self-righting reaction is an ecologically important behaviour well described in various echinoderms, i.e. asteroid and sea urchins (Jennings, 1907; Sherman, 2015; Manríquez et al., 2017) which has been commonly used as a stress indicator (Lawrence, 1975; Böttger et al., 2001; Brothers and McClintock, 2015; Sherman, 2015; Manríquez et al., 2017). In a previous study using small juvenile L. albus, self-righting success was N72% and no differences between treatments were found after exposure for 2 months to similar pCO2 and temperature levels as those used in the present study (Manríquez et al., 2017). This suggests that self-righting success is a behaviour not

8

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

Fig. 3. Small juvenile urchin (Loxechinus albus) displaying the self-righting behaviour (a-h) to return to their normal posture (h) after being placed upside down (a). During righting, the greater portion of the time (~80%) was used by the sea urchins to reach the first 90° angle (e). Moreover, the tube feet placed along the upper surface of the sea urchins remained extended. However, the tube feet located in dorsal and lateral side of the body wall of the sea urchin and located on the side towards which righting took place extended until the suckers at the distal part of each tube touched and attached to the substrate (b). Then the tube feet contracted, pulled the urchins (c–d) and once the 90° was exceeded the tube feet still remained attached (f). During the last phase of righting, the sea urchins seem to roll upright in response to both its own weight and tube feet pulling (g–h). Scale bar: 1.0 cm.

30

a

TPA= 81.9 ºC2

25

Thermal limit (ºC)

affected by projected, near-future levels of pCO2 and temperature. However, self-righting was unsuccessful (or delayed) after cooling or warming beyond a certain threshold, presumably due to impairment of the appendages linked with sea urchin locomotion and righting. A previous study reported that incremental increases in pCO2 and temperature significantly increased the metabolic rate of juvenile L. albus (Manríquez et al., 2017). Sea urchins exposure to elevated levels of pCO2 and temperature might have increased energetic demands that, coupled with the costs of maintaining elevated levels of HSP70, may restrict short-term, energy-demanding activities such as self-righting. Therefore, near-future pCO2 and temperature levels, although not impacting growth and survival, are expected to stress juvenile L. albus and re-define their thermal niche with decrements in performance if animals experience cold snaps or heat waves. Regardless of the pCO2 levels used during the exposure treatments (i.e. current-day and elevated pCO2), the loss of self-righting in L. albus increased incrementally from 15 to 20 °C. This agrees with previous work on other species of sea urchins demonstrating that the temperature at which the capacity to self-right is lost, increases with the temperature of the collection site (Sherman, 2015; Brothers and McClintock,

UATZ= 2.5 ºC2

20

ITZ= 66.3 ºC2

15 LATZ= 13.1 ºC2

10 5 30

Thermal limit (ºC)

25

b

TPA= 58.2 ºC2

UATZ= 0.6 ºC2 ITZ= 46.2 ºC2

20 15

LATZ= 11.4 ºC2

10 5

10

15

20

25

Exposure temperature (ºC) Fig. 4. The effect different pCO2 and temperature levels on CTmax (a) and CTmin (b) of small juveniles of Loxechinus albus after a 30-day exposure period to contrasting pCO2 (open bars: current-day; filled bars: elevated levels) and temperature levels. See Fig. 1 for description of box plot information. Sample size in each boxplot is 8. Means not sharing the same letter are significantly different; Aligned Rank Transformation, followed by a Tukey post hoc test.

Fig. 5. The effect of different pCO2 and temperature levels on the partial thermal polygons for small juvenile Loxechinus albus after a 30-day exposure to current-day (a) and elevated (b) pCO2 and temperature levels. In both panels, the open and filled circles represents CTmax and CTmin measurements. The bottom and top solid lines represent the CTmax and CTmin regression lines. The partial thermal tolerance zone (PTZ) t is divided into an intrinsic tolerance zone (ITZ) and upper and lower acquired tolerance zones (UATZ, LATZ).

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

2015). The time required to self-right also appears to depend on water temperature (Kleitman, 1941; Collin and Chan, 2016), e.g. being longer in winter than in summer (Sherman, 2015). Since sea urchins in different treatments were similar in size, differences in the time to self-right are mainly linked with the time required for the tube feet to make contact with the substratum and the force of pull they apply. In our study, increments in time to self-right were recorded along with reductions in the movement of tube feet, spines and pedicellariae. In fact, when sea urchins reached the end-points, the anatomic structures associated with righting were motionless. This suggests that the effect of stressful pCO2 and temperature levels on righting capacity is mediated by impairment of these structures. Future studies are needed to evaluate the effect of the variables measured on adhesion capacity and protraction force of tube foot of L. albus. Available information suggest that the availability of calcium might affect the mechanical properties that are presumably directly linked to the elastic network of micro-fibrils of echinoderms tube feet (Santos et al., 2005). A successful and rapid self-righting reaction is of obvious survival advantage since L. albus is abundant within intertidal rocky shores exposed to high wave action (Vásquez et al., 1984; Moreno et al., 2011) where overturning may occur. The high values for CTmax (between ~25 °C and 27 °C) suggest that juveniles of L. albus are well adapted to cope with the increased environmental temperatures projected to occur from climate change within the water bodies along the Chilean coast. This finding may have been expected based on the large (50°) range in latitudes (and ranges in abiotic factors) inhabited by this species (Vásquez, 2001; Molinet et al., 2012) but generalizing sensitivity based solely on geographical distribution may not always be warranted. For example, projected future levels of pCO2 had a significant and negative effect on energy acquisition (i.e. clearance and absorption) in the edible mussel Mytilus chilensis (Duarte et al., 2014), a species that co-occurs with L. albus across a 20° range in latitudes (i.e. from central Chile ~ 35°S to southern Patagonia ~ 56°S; Krapivka et al., 2007). The Beneficial Acclimation Hypothesis (BAH) predicts that animal acclimated to a particular environment have enhanced performance (fitness advantage) at that environment in comparison with animals acclimated to other environment (Leroi et al., 1994). Some empiric evidence indicated that in individuals that are acclimated to chronic labortory-induced conditions at low temperatures, the tolerance to high temperatures is lower than individuals acclimated to high temperatures (Iannacone and Alvariño, 2007). On the other hand, other studies have shown lack of phenotypic plasticity and therefore the support for BAH is tipically deficient (Deere and Chown, 2006). The predictions of this physiological hypothesis are in line with our results and suggest that during the acclimation period the experimental individuals acquiered resistance to changes in temperature through phenotypic plasticity. The shape of each species' CTM-polygon is known to reflect, in part, its thermal niche (Bennett and Beitinger, 1997; Boher et al., 2010), suggesting that polygons may be potentially useful in several important areas of research such as to understand population fluctuations (Eme and Bennett, 2009), biogeographic patterns (Boher et al., 2010) and to provide a baseline for thermal aquaculture condition (Das et al., 2004). Moreover, thermal-polygons also provide an estimation of how well an organism may ameliorate seasonal or chronic shifts in sea temperatures that may demand readjustment in temperature tolerance and may be useful indices of how a marine species would respond to changes in the global change (Eme and Bennett, 2009). In the present study, the relative effects of two experimental temperatures (i.e., 15 °C and 20 °C) and pCO2 levels on temperature tolerance were estimated from a geometrical partitioning of CTM-polygons. Considering the areal units of °C2, L. albus displayed a large ITZ under current-day and future levels of temperature and pCO2, and a moderate ability to acquire additional heat or cold tolerance through acclimation to temperature and/or pCO2. In particular, LAZs were 5.25- (present day conditions) and 19.16- (future conditions) times greater than UAZs, indicating

9

that acclimation to any of these two environmental factors plays a major role in low rather than in high thermal tolerance. Thus, the observed reduction of ~29% in the PPTZ could be a consequence of a reduction in cold tolerance after exposure to elevated pCO2 and temperature levels compared to controls. Therefore, thermal stress to cold temperatures is expected when L. albus experiences near-future conditions of elevated pCO2. Hence, it is possible that, under projected, near-future climate conditions, L. albus and other, similar species will be able to tolerate warming of average temperatures of ~4 °C but not cooling. Regional cooling associated with both the intensification of upwellingfavourable wind stress and the ENSO cold-phase (La Niña), is expected to affect the central and northern Chilean coast (17–27 °S, Falvey and Garreaud, 2009). These negative thermal anomalies result in a highly variable environment, which highlight the need to better represent both the low and high extremes in temperature within regional climate models if we hope to have robust projections of the potential abiotic drivers changing coastal invertebrate communities in Chile and elsewhere in the future. Most of studies calculating thermal tolerance polygons to assess how acclimate temperatures affects the size of the range in tolerable temperatures have been conducted with marine and fresh water fish (Bennett and Beitinger, 1997; Eme and Bennett, 2009; King and Sardella, 2017). Exceptions are studies on an estuarine crab (Cumillaf et al., 2016), fresh water beetles (Calosi et al., 2008) and various species of terrestrial flies (Boher et al., 2010). Only one previous study, however, has calculated CTM-polygons after exposure to temperature plus an interacting factor (King and Sardella, 2017). In that study, the effect of acclimatization temperature on the thermal tolerance polygons was modulated by water salinity (King and Sardella, 2017). Therefore, to our best knowledge, the present study is the first to evaluate the simultaneous effect of temperature and pCO2 levels on the upper and lower thermal tolerance in a marine invertebrate. At the organismal level, one stressor may either increase tolerance to a second stressor (cross-tolerance) or cause the organisms to be more susceptible to the second stressor (cross-susceptibility) (Todgham and Stillman, 2013). Exposure to high pCO2 levels did not provide cross-tolerance since the CTmax of the individuals L. albus was slightly lower at high versus control pCO2 levels but it is important to note that the expresion of HSP70 was measured 4 days after the CTmax trials. Cross-tolerance is though to involve the induction of protective factors such as heat shock proteins (Todgham et al., 2005). Our study indicated that acclimatization to hight pCO2 levels induced an up regulation of HSP70 at the high temperature (20 °C) but this did not confer extra protection in terms of tolerating warmer temperatures. This suggest that juveniles L. albus are more susceptible to high temperatures at elevated pCO2 levels than at control levels.

5. Conclusion and future perspectives Overall our results suggest that even species that naturally experience an extremely diverse spectrum of pCO2 and temperature levels as result of their large latitudinal range (Torres et al., 2011; Vargas et al., 2017) can be affected by chronic exposure to OA and OW. Future work on the thermal tolerance of L. albus, or other similar species with a wide distribution range, under elevated near-future pCO2 and temperature levels should consider the use of a larger array of exposure treatments to better understand chronic (sub-lethal) and acute (lethal) thresholds of both pCO2 temperature levels when compared with current-day levels. In addition, work on various populations of these species across their distribution range could reveal the effect of local genetic adaptations and phenotypic plasticity, allowing us to make predictions regarding the ecological repercussions of global climate change, such as changes in the southern distribution limit of this species. The contrasting effects of pCO2 and temperature at the organismal level (growth and survival) and at the cellular level (expression of HSP70) highlight the need to take into account the organismal level when

10

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

comparing the potential effects of global stressors such as temperature and pCO2. Supplementary data to this article can be found online at https://doi. org/10.1016/j.scitotenv.2019.07.275. Acknowledgements This study was financed by the Project ‘Climate driven Changes in the Habitat Suitability of Marine Organisms’ (CLIMAR, ELAC2015/T010495) funded by the Network of the European Union, Latin America and the Caribbean Countries on Joint Innovation and Research Activities. Due to restriction of this grant, most of the operational costs associated with this study were covered by personal funds (P.H.M.). Similarly, a significant part of the living expenses of the Chilean researches when traveling abroad in the framework of this grant were covered by personal funds. P.H.M. acknowledges funds provided by The National Fund for Scientific and Technological Development, Chile (FONDECYT), Grant No. 1130839 and Celulosa Arauco and Constitución SA for financial contributions used to purchase equipment required to set-up part of the experimental mesocosm. Sergio Castillo (ww.celsiusequipos.cl) is acknowledged for his important assistance in the initial set-up and periodic maintenance of the temperature control units and the electric system that support the experimental functioning. During the final part of this study and editing of this article P.H.M. was under the tenure of the Project FONDECYT Grants No 1181609 and No 1171056. References Andrew, N.L., Agastuna, Y., Ballesteros, E., Bazhin, A., Creaser, E.P., Barnes, D.K., Botsford, L.W., Bradbury, A., Campbell, A., Dixon, J.D., Einarsson, S., Gerring, P., Hebert, K., Hunter, M., Hurt, S.B., Johnson, C.R., Juinio-Menez, M.A., Kalvass, P., Miller, R.J., Moreno, C.A., Palleiro, J.S., Rivas, D., Robinson, S.M., Schroeter, S.C., Stenek, R.C., Vadas, R.I., Woodby, D.A., Xiaoqu, Z., 2002. Status and management of world sea urchin fisheries. Oceanogr. Mar. Biol. Annu. Rev. 40, 343–425. https://doi.org/10.1201/ 9780203180594.ch7. Barrantes, M.E., Lattuca, M.E., Vanella, F.A., Fernández, D.A., 2017. Thermal ecology of Galaxias platei (Pisces, Galaxiidae) in South Patagonia: perspectives under a climate change scenario. Hydrobiologia 802, 255–267. https://doi.org/10.1007/s10750-0173275-3. Beitinger, T.L., Bennett, W.A., 2000. Quantification of the role of acclimation temperature in temperature tolerance of fishes. Environ. Biol. Fish 58, 277–288. https://doi.org/ 10.1023/A:1007618927527. Bennett, W.A., Beitinger, T.L., 1997. Temperature tolerance of the sheepshead minnow, Cyprinodon variegatus. Copeia 1, 77–87. https://doi.org/10.2307/1447842. Boher, F., Godoy-Herrera, R., Bozinivic, F., 2010. The interplay between thermal toleranceand life history is associated with the biogeography of Drosophila species. Evol. Ecol. Res. 12, 973–986. Böttger, S.A., McClintock, J.B., Klinger, T.S., 2001. Effects of inorganic and organic phosphates on feeding, feeding absorption, nutrient allocation, growth and righting responses of the sea urchin Lytechinus variegatus. Mar. Biol. 138, 741–751. https://doi. org/10.1007/s002270000476. Briffa, M., de la Haye, K., Munday, P.L., 2012. High CO₂ and marine animal behaviour: potential mechanisms and ecological consequences. Mar. Pollut. Bull. 64, 1519–1528. https://doi.org/10.1016/j.marpolbul.2012.05.032. Brokordt, K., Pérez, H., Herrera, C., Gallardo, A., 2015. Reproduction reduces HSP70 expression capacityin Argopecten purpuratus scallops subject tohypoxia and heat stress. Aquat. Biol. 23, 265–274. https://doi.org/10.3354/ab00626. Brothers, C.J., McClintock, J.B., 2015. The effects of climate-induced elevated seawater temperature on the covering behavior, righting response, and Aristotle's lantern reflex of the sea urchin Lytechinus variegatus. J. Exp. Mar. Biol. Ecol. 467, 33–38. https://doi.org/10.1016/j.jembe.2015.02.019. Bustos, E., Godoy, C., Olave, S., Trocoso, R., 1991. Desarrollo de técnicas de producción de semillas y repoblación de recursos bentónicos. I. Investigaciones en el erizo chileno Loxechinus albus (Molina 1782). Cap.I. PNUD-IFOP (ed). pp. 1–60. Byrne, M., Przeslawski, R., 2013. Multistressor impacts of warming and acidification of the ocean on marine invertebrates' life histories. Integr. Comp. Biol. 53, 582–596. https:// doi.org/10.1093/icb/ict049. Byrne, M., Ho, M., Selvakumaraswamy, P., Nguyen, H.D., Dworjanyn, S.A., Davis, A.R., 2009. Temperature, but not pH, compromises sea urchin fertilization and early development under near-future climate change scenarios. Proc. R. Soc. Lond. Ser. B 276, 1883–1888. https://doi.org/10.1098/rspb.2008.1935. Byrne, M., Ho, M.A., Koleits, L., Price, C., King, C.K., Virtue, P., Tilbrook, B., Lamare, M., 2013. Vulnerability of the calcifying larval stage of the Antarctic sea urchin Sterechinus neumayeri to near-future ocean acidification and warming. Glob. Chang. Biol. 19, 2264–2275. https://doi.org/10.1111/gcb.12190. Byrne, M., Smith, A.M., West, S., Collard, M., Dubois, P., Graba-Landry, A., Dworjanyn, S.A., 2014. Warming influences Mg2+ content, while warming and acidification influence

calcification and test strength of a sea urchin. Environ. Sci. Technol. 48, 12620–12627. doi.org/10.1021/es5017526. Cai, W., Wang, G., Dewitte, B., Wu, L., Santoso, A., Takahashi, K., Yang, Y., Carréric, A., McPhaden, M.J., 2018. Increased variability of eastern Pacific El Niño under greenhouse warming. Nature 564, 201–206. https://doi.org/10.1038/s41586-018-0776-9. Epub 2018 Dec 12. Calosi, P., Bilton, D.T., Spicer, J.I., Atfield, A., 2008. Thermal tolerance and geographical range size in the Agabus brunneus group of European diving beetles (Coleoptera: Dytiscidae). J. Biogr. 35, 295–305. https://doi.org/10.1111/j.1365-2699.2007.01787.x. Castilla, J.C., 1990. El erizo chileno Loxechinus albus: Importancia pesquera, historia de vida, cultivo en laboratorio y repoblación natural. In: Hernández, A. (Ed.), Cultivos de moluscos en América Latina. CIID Canadá, Santiago, pp. 83–98. Castilla, J.C., Moreno, C.A., 1984. Sea urchins and Macrocystis pyrifera: experimental test of their ecological relations in southern Chile. Proceedings of the International Echinoderm Conference, pp. 257–263 Tampa Bay, Florida. Chidawanyika, F., Terblanche, J.S., 2011. Rapid thermal responses and thermal tolerance in adult codling moth Cydia pomonella (Lepidoptera: Tortricidae). J. Insect Physiol. 57 (815), 108–117. https://doi.org/10.1016/j.jinsphys.2010.09.013. Collin, R., Chan, K.Y.K., 2016. The sea urchin Lytechinus variegatus lives close to the upper thermal limit for early development in a tropical lagoon. Ecol. Evol. 6, 5623–5634. https://doi.org/10.1002/ece3.2317. Crain, C.M., Kroeker, K., Halpern, B.S., 2008. Interactive and cumulative effects of multiple human stressors in marine systems. Ecol. Lett. 11, 1304–1315. https://doi.org/ 10.1111/j.1461-0248.2008.01253.x. Cumillaf, J.P., Blanc, J., Paschke, K., Gebahuer, P., Díaz, F., Re, D., Chimal, M.E., Vasquez, J., Rosas, C., 2016. Thermal biology of the subpolar-temperate estuarine crab Hemigrapsus crenulatus (Crustacea: Decapoda: Varunidae). Biol. Open. 5, 220–228. https://doi.org/10.1242/bio.013516. Cummings, V.J., Hewitt, A., Van Rooyen, K., Currie, S., Beard, S., Thrush, S., Norkko, J., Barr, N., Heath, P., Halliday, N.J., Sedcole, R., Gomez, A., McGraw, C., Metcalf, V., 2011. Ocean acidification at high latitudes: potential effects on functioning of the antarctic bivalve Laternula elliptica. PLoS One 6 (1), e16069. https://doi.org/10.1371/journal. pone.0016069. Currie, S., Tufts, B.L., Moyes, C.D., 1999. Influence of bioenergetic stress on heat shock protein gene expression in nucleated red blood cells of fish. Am. J. Physiol. 276, R990–R996. https://doi.org/10.1152/ajpregu.1999.276.4.R990. Dabruzzi, T., Bennett, W.A., Rummer, J.L., Fangue, N.A., 2012. Thermal ecology of juvenile Ribbontail Stingray, Taeniura lymma (Forsskål, 1775), from a Mangal Nursery in the Banda Sea. Hydrobiologia 701, 37–49. https://doi.org/10.1007/s10750-012-1249-z. Das, T., Pal, A.K., Chakraborty, S.K., Manush, S.M., Chatterjee, N., Mukherjee, S.C., 2004. Thermal tolerance and oxygen consumption of Indian Major Carps acclimated to four temperatures. J. Therm. Biol. 29, 157–163. https://doi.org/10.1016/j. jtherbio.2004.02.001. Dayton, P.K., 1985. Ecology of kelp communities. Annual Review of Ecology and Systematic 16, 215–245. https://doi.org/10.1146/annurev.es.16.110185.001243. Dayton, P.K., Rosenthal, R., Mahen, L.C., 1973. Kelp communities in the Chilean archipelago: R/V Hero cruise 72-5. Antarct. J. US 8, 34–35. Dean, T.A., Schroeter, S.C., Dixon, J.D., 1984. Effects of grazing by two species of sea urchins (Srongylocentrotus franciscanus and Lytechinus anamesus) on recruitment and survival of two species of kelp (Macrocystis pyrifera and Pterygophora californica). Mar. Biol. 78, 301–313. Deere, J.A., Chown, S.L., 2006. Testing the beneficial acclimation hypothesis and its alternatives for locomotor performance. Am. Nat. 168, 630–644. https://doi.org/10.1007/ s00300-007-0349-0. Dickson, A.G., Millero, F.J., 1987. A comparison of the equilibrium constants for the dissociation of carbonic acid in seawater media. Deep-Sea Research, Part A, Oceanographic Research Papers 34, 1733–1743. https://doi.org/10.1016/0198-0149(87)90021-5. Dickson, A.G., Sabine, C.L., Christian, J.R., 2007. Guide to best practices for CO2 measurements. PICES Special Publication vol. 3. PICES, Sidney, BC. DOE (US Department of Energy), 1994. Handbook of methods for the analysis of the various parameters of the carbon dioxide system in sea water; version 2. Dickson AG, Goyet C (eds). ORNL/CDIAC-74. Domenici, P., Gonzales-Calderon, D., Ferrari, R.S., 2003. Locomotor performance in the sea urchin performance in the sea urchin Paracentrotus lividus. J. Mar. Biol. Assoc. U. K. 83, 285–292. https://doi.org/10.1017/S0025315403007094h. Domenici, P., Claireaux, G., J McKenzie, D.J., 2007. Environmental constraints upon locomotion and predator–prey interactions in aquatic organisms: an introduction. Philosophical transactions of the Royal Society of London. Series B 362, 1929–1936. https://doi.org/10.1098/rstb.2007.2078. Domenici, P., Torres, R., Manríquez, P.H., 2017. Effects of elevated carbon dioxide and temperature on locomotion and the repeatability of lateralization in a keystone marine mollusc. J. Exp. Biol. 220, 667–676. https://doi.org/10.1242/jeb.151779. Duarte, C., Navarro, J.M., Acuña, K., Torres, R., Manríquez, P.H., Lardies, M.A., Vargas, C.A., Lagos, N.A., Aguilera, V., 2014. Combined effects of temperature and ocean acidification on the juvenile individuals of the mussel Mytilius chilensis. J. Sea Res. 85, 308–315. https://doi.org/10.1016/j.seares.2013.06.002. Dülger, N., Kumlu, M., Türkmen, S., Ölçülü, A., Eroldoĝan, O.T., Yılmaz, H.A., Öçal, N., 2012. Thermal tolerance of European Sea Bass (Dicentrarchus labrax) juveniles acclimated to three temperature levels. J.Thermal Biol. 37, 79–82. https://doi.org/10.1016/j. jtherbio.2011.11.003. Durrant, H.M.S., Clark, G.F., Dworjanyn, S.A., Byrne, M., Johnston, E.L., 2013. Seasonal variation in the effects of ocean warming and acidification on a native bryozoan, Celleporaria nodulosa. Mar. Biol. 160, 1903–1911. https://doi.org/10.1007/s00227012-2008-4. Elliot, A., 2010. A comparison of thermal polygons for British freshwater teleosts. Freshwater Forum. vol. 5 pp. 178–184.

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469 Elliott, J.M., 1991. Tolerance and resistance to thermal stress in juvenile Atlantic salmon, Salmo salar. Freshw. Biol. 25, 61–70. https://doi.org/10.1111/j.1365-2427.1991. tb00473.x. Eme, J., Bennett, W.A., 2009. Critical thermal tolerance polygons of tropical marine fishes from Sulawesi, Indonesia. J. Therm. Biol. 34, 220–225. https://doi.org/10.1016/j. jtherbio.2009.02.005. Estes, J.A., Duggins, D.O., 1995. Sea otters and kelp forests in Alaska: generality and variation in a community ecological paradigm. Ecol. Monogr. 65, 75–100. https://doi. org/10.2307/2937159. Falvey, M., Garreaud, R.D., 2009. Regional cooling in a warming world: recent temperature trends in the southeast Pacific and along the west coast of subtropical South America (1979–2006). J. Geophys. Res. 114, 16. https://doi.org/10.1029/ 2008JD010519. Fangue, N.A., Bennett, W.A., 2003. Thermal tolerance responses of laboratory acclimated and seasonally acclimatized Atlantic stingray (Dasyatis sabina). Copeia 2003, 315–325. Filbee-Dexter, K., Scheibling, R.E., 2012. Hurricane-mediated defoliation of kelp beds and pulsed delivery of kelp detritus to offshore sedimentary habitats. Mar. Ecol. Prog. Ser. 455, 51–64. https://doi.org/10.3354/meps09667. Findlay, H.S., Kendall, M.A., Spicer, J.I., Widdicombe, S., 2009. Post-larval development of two intertidal barnacles at elevated CO2 and temperature. Mar. Biol. 157, 725–735. https://doi.org/10.1007/s00227-009-1356-1. Foo, S.A., Byrne, M., 2016. Acclimatization and adaptive capacity of marine species in a changing ocean. Adv. Mar. Biol. 74, 69–116. https://doi.org/10.1016/bs. amb.2016.06.001. Garcia, E., Clemente, S., Hernandez, J.C., 2015. Ocean warming ameliorates the negative effects of ocean acidification on Paracentrotus lividus larval development and settlement. Mar. Environ. Res. 110, 61–68. https://doi.org/10.1016/j. marenvres.2015.07.010. Godbold, J.A., Solan, M., 2013. Long-term effects of warming and ocean acidification are modified by seasonal variation in species responses and environmental conditions. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 368, 1–19. https://doi.org/10.1098/ rstb.2013.0186. González, S.J., Cáceres, C.W., Ojeda, F.P., 2008. Feeding and nutritional ecology of the edible sea urchin Loxechinus albus in the northern Chilean coast. Rev. Chil. Hist. Nat. 81, 575–584. https://doi.org/10.4067/S0716-078X2008000400010. González-Aravena, M., Calfo, C., Mercado, L., Morales-Lange, B., Bethke, J., De Lorgeri, J., Cárdenas, C.A., 2018. HSP70 from the Antarctic sea urchin Sterechinus neumayeri: molecular characterization and expression in response to heat stress. Biol. Res. 51, 8. https://doi.org/10.1186/s40659-018-0156-9. Gooding, R.A., Christopher Harley, C.D.G., Tang, E., 2009. Elevated water temperature and carbon dioxide concentration increase the growth of a keystone echinoderm. Proc. Natl. Acad. Sci. U. S. A. 106, 9316–9321. https://doi.org/10.1073/ pnas.0811143106. Guisado, C., Castilla, J.C., 1987. Historia de vida, reproducción y avances en el cultivo del erizo chileno Loxechinus albus (Molina 1782) (Echinoidea: Echinidae). In: Arana, P. (Ed.), Manejo y Desarrollo Pesquero. Escuela de Ciencias del Mar, Universidad Católica de Valparaíso, Valparaíso, pp. 59–68. Gvoždík, L., 2012. Plasticity of preferred body temperatures as means of coping with climate 916 change? Biol. Lett. 8, 262–265. https://doi.org/10.1098/rsbl.2011.0960. Gvoždík, L., 2018. Just what is the thermal niche? Oikos 127, 17011-710 doi: 918 10.1111/ oik.05563. Haraldsson, C., Anderson, L.G., Hasselöv, M., Hulth, S., Olsson, K., 1997. Rapid, high precision potentiometric titration of alkalinity in ocean and sediment pore waters. DeepSea Research, Part I, Oceanographic Research Papers 44, 2031–2044. https://doi.org/ 10.1016/S0967-0637(97)00088-5. Hardy, N., Byrne, M., 2014. Early development of congeneric sea urchins (Heliocidaris) with contrasting life history modes in a warming and high CO2 ocean. Mar. Environ. Res. 102, 78–87. https://doi.org/10.1016/j.marenvres.2014.07.007. Harrold, C., Pearse, J.S., 1987. The ecological role of echinoderms in kelp forests. In: Jangoux, M., Lawrence, J.M. (Eds.), Echinoderm Studies 2. Balkema, Rotterdam, pp. 137–233. Harrold, C., Reed, D., 1985. Food availability, sea urchin grazing and kelp forest community structure. Ecology 66, 1160–1169. https://doi.org/10.2307/1939168. Hettinger, A., Sanford, E., Hill, T.M., Hosfelt, J.D., Russell, A.D., Gaylord, B., 2013. The influence of food supply on the response of Olympia oyster larvae to ocean acidification. Biogeosciences 10, 6629–6638. https://doi.org/10.5194/bg-106629. Hofmann, G.E., Todgham, A.E., 2010. Living in the now:physiological mechanisms to tolerate a rapidly changing environment. Annu. Rev. Physiol. 72, 127–145. https://doi. org/10.1146/annurev-physiol-021909-135900. Hook, S.E., Gallagher, E.P., Batley, G.E., 2014. The role of biomarkers in the assessment of aquatic ecosystem health. Integrative Environmental Assessment and Management 10, 327–341. https://doi.org/10.1002/ieam.1530. Huey, R.B., Stevenson, R.D., 1979. Integrating thermal physiology and ecology of ectotherms: a discussion of approaches. American Zoology 19, 357–366. https://doi.org/ 10.1093/icb/19.1.357. Iannacone, J., Alvariño, L., 2007. Influencia de la aclimatación en la tolerancia a altas temperaturas del chanchito de la humedad Porcellio laevis (Isopoda: Porcellionidae). Biologist (Lima) 5 (939), 60–64. IPCC (Intergovernmental Panel on Climate Change), 2014. Summary for policymakers. Climate change 2014 synthesis report. Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. IPCC, Geneva. Jennings, H.S., 1907. Behavior of the starfish Asterias forreri de Loriol. University of California Publications in Zoology 4, 53–185.

11

Kenneth, R.N.A., Maynard, J.A., Diaz-Pulido, G., Mumby, P.J., Marshall, P.A., Cao, L., HoeghGuldberg, O., 2011. Ocean acidification and warming will lower coral reef resilience. Glob. Chang. Biol. 17, 1789–1808. https://doi.org/10.1111/j.1365-2486.2010.02364.x. Keppel, E.A., Scrosati, R.A., Courtenay, S.C., 2015. Interactive effects of ocean acidification and warming on subtidal mussels and sea stars from Atlantic Canada. Mar. Biol. Res. 11, 337–348. https://doi.org/10.1080/17451000.2014.932914. King, M., Sardella, B., 2017. The effects of acclimation temperature, salinity, and behavior on the thermal tolerance of Mozambique tilapia (Oreochromis mossambicus). Journal of Experimental Zoology, Part A: Ecological and Integrative Physiology 327, 417–422. https://doi.org/10.1002/jez.2113. Kleitman, N., 1941. The effect of temperature on the righting of echinoderms. Biol. Bull. 80, 292–298. https://doi.org/10.2307/1537716. Krapivka, S., Toro, J.E., Alcapán, A.C., Astorga, M., Presa, C., Pérez, M., Guiñez, R., 2007. Shell-shape variation along the latitudinal range of the Chilean blue mussel Mytilus chilensis (Hupe 1854). Aquac. Res. 38, 1770–1777. https://doi.org/10.1111/j.13652109.2007.01839.x. Lattuca, M.E., Boy, C.C., Vanella, F.A., Barrantes, M.E., Fernández, D.A., 2018. Thermal responses of three native fishes from estuarine areas of the Beagle Channel, and their implications for climate change. Hydrobiologia 808, 235–249. https://doi.org/ 10.1007/s10750-017-3424-8. Lawrence, J.M., 1975. On the relationships between marine plants and sea urchins. Oceanogr. Mar. Biol. Annu. Rev. 13, 213–286. https://doi.org/10.1038/hdy.1975.24. Leroi, A.M., Bennett, A.F., Lenski, R.E., 1994. Temperature acclimation and competitive fitness: an 968 experimental test of the beneficial acclimation assumption. Proc. Natl. Acad. Sci. U. S. A. 91, 1917–1921. Lewis, E., Wallace, D.W.R., 1998. Program Developed for CO2 System Calculations, ORNL/ CDIAC-105. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, U.S. Department of Energy, Oak Ridge, TN. Liu, W., Gampert, L., Nething, K., Steinacker, J.M., 2006. Response and function of skeletal muscle heat shock protein 70. Front. Biosci. 11, 2802–2827. https://doi.org/10.2741/ 2011. Liu, W., Huang, X., Lin, J., He, M., 2012. Seawater acidification and elevated temperature affect gene expression patterns of the pearl oyster Pinctada fucata. PLoS One 7 (3), e33679. https://doi.org/10.1371/journal.pone.0033679. Liu, W., Yu, Z., Huang, X., Shi, Y., Lin, J., Zhang, H., Yi, X., He, M., 2017. Effect of ocean acidification on growth, calcification, and gene expression in the pearl oyster, Pinctada fucata. Mar. Environ. Res. 130, 174–180. https://doi.org/10.1016/j. marenvres.2017.07.013. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔC method. Methods 25, 402–408. https://doi. T org/10.1006/meth.2001.1262. Lord, J.P., Barry, J.P., Graves, D., 2017. Impact of climate change on direct and indirect species interactions. Mar. Ecol. Prog. Ser. 571, 1–11. https://doi.org/10.3354/meps12148. Lutterschmidt, W.I., Hutchison, V.H., 1997. The critical thermal maximum: history and critique. Can. J. Zool. 75, 1561–1574. https://doi.org/10.1139/z97-783. Magnuson, J.J., Crowder, L.B., Medvick, P.A., 1979. Temperature as an Ecological Resource. Am. Zool. 19, 331–343. Manríquez, P.H., Jara, M.E., Seguel, M.E., Torres, R., Alarcon, E., Lee, M.R., 2016. Ocean acidification and increased temperature have both positive and negative effects on early ontogenetic traits of a rocky shore keystone predator species. PLoS One 11 (3), e0151920. https://doi.org/10.1371/journal.pone.0151920. Manríquez, P.H., Torres, T., Matson, P.G., Lee, M.R., Jara, M.E., Seguel, M.E., Sepúlveda, F., Pereira, L., 2017. Effects of ocean warming and acidification on the early benthic ontogeny of an ecologically and economically important echinoderm. Mar. Ecol. Prog. Ser. 563, 169–184. https://doi.org/10.3354/meps11973. Meinshausen, M., Smith, S.J., Calvin, K., Daniel, J.S., Kainuma, M.L.T., Lamarque, J.-F., Matsumoto, K., Montzka, S.A., Raper, S.C.B., Riahi, K., Thomson, A., Velders, G.J.M., van Vuuren, D.P.P., 2011. The RPC greenhouse gas concentrations and their extensions from 1765 to 2300. Climate Change 109, 213–241. https://doi.org/10.1007/ s10584-011-0156-z. Mehrbach, C., Culberson, C.H., Hawley, J.E., Pytkowicz, R.M., 1973. Measurement of the apparent dissociation constants of carbonic acid in seawater at atmospheric pressure. Limnol. Oceanogr. 18, 897–907. Melzner, F., Stange, P., Trubenbach, K., Thomsen, J., Casties, I., Panknin, U., Gorb, S.N., Gutowska, M.A., 2011. Food supply and seawater pCO2 impact calcification and internal shell dissolution in the blue mussel Mytilus edulis. PLoS One 6 (9), e24223. https:// doi.org/10.1371/journal.pone.0024223. Micael, J., Alves, M.J., Costa, A.C., Jones, M.B., 2009. Exploitation and conservation of echinoderms. Oceanogr. Mar. Biol. Annu. Rev. 47, 191–208. https://doi.org/10.1201/ 9781420094220.ch4. Molinet, C., Moreno, C.A., Niklitschek, E.J., Matamala, M., Neculman, M., Arévalo, A., Codjambassis, J., Díaz, P., Díaz, M., 2012. Reproduction of the sea urchin Loxechinus albus across a bathymetric gradient in the Chilean Inland Sea. Rev. Biol. Mar. Oceanogr. 47, 257–272. https://doi.org/10.4067/S0718-19572012000200008. Moreno, C.A., Molinet, C., Díaz, P., Díaz, M., Codjambassis, J., Arévalo, A., 2011. Bathymetric distribution of the Chilean sea urchin (Loxechinus albus, Molina) in the inner seas of Northwest Patagonia: implications for management. Fish Research 110, 305–311. https://doi.org/10.1016/j.fishres.2011.04.020. Nagelkerken, I., Munday, P.L., 2016. Animal behaviour shapes the ecological effects of ocean acidification and warming: moving from individual to community-level responses. Glob. Chang. Biol. 22, 974–989. https://doi.org/10.1111/gcb.13167. Nguyen, H.D., Byrne, M., Thomson, M., 2013. Hsp70 expression in the south-eastern Australia sea urchins Heliocidaris erythrogramma and H. tuberculata. Echinoderms in a Changing World, Craig Johnson (ed). Taylor & Francis Group, London, pp. 213–217. Norderhaug, K.M., Christie, H., 2009. Sea urchin grazing and kelp re-vegetation in the NE Atlantic. Mar. Biol. Res. 5, 515–528. https://doi.org/10.1080/17451000902932985.

12

P.H. Manríquez et al. / Science of the Total Environment 693 (2019) 133469

Nyamukondiwa, C., Terblanche, J.S., 2009. Thermal tolerance in adult Mediterranean and Natal fruit flies (Ceratitis capitata and Ceratitis rosa): Effects of age, gender and feeding status. J. Therm. Biol. 34, 406–414. https://doi.org/10.1016/j.jtherbio.2009.09.002. Oyarzun, D., Brierley, C.M., 2019. The future of coastal upwelling in the Humboldt current from model projections. Clim. Dyn. 52, 599–615. Pistevos, J.C.A., Calosi, P., Widdicombe, S., Bishop, J.D.D., 2011. Will variation among genetic individuals influence species responses to global climate change? OIKOS 120, 675–689. https://doi.org/10.1111/j.1600-0706.2010.19470.x. Pörtner, H.O., 2008. Ecosystem effects of ocean acidification in times of ocean warming: A physiologist's view. Mar. Ecol. Prog. Ser. 373, 203–217. Portner, H.O., 2010. Oxygen- and capacity-limitation of thermal tolerance: a matrix for integrating climate-related stressor effects in marine ecosystems. J. Exp. Biol. 213, 881–893. Prada, F., Caroselli, E., Mengoli, S., Brizi, L., Fantazzini, P., Capaccioni, B., Pasquini, L., Fabricius, K.E., Dubinsky, Z., Falini, G., Goffredo, S., 2017. Ocean warming and acidification synergistically increase coral mortality. Scientific Report 7, 40842. https://doi. org/10.1038/srep40842. R Core Team, 2016. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna. Rodolfo-Metalpa, R., Martin, S., Ferrier-Pages, C., Gattuso, J.P., 2010. Response of the temperate coral Cladocoraca espitosa to mid-and long-term exposure to pCO2 and temperature levels projected for the year 2100 AD. Biogeosciences 7, 289–300. https:// doi.org/10.5194/bg-7-289-2010 (2010). Rodriguez, A., Hernández, J.C., Brito, A., Clemente, S., 2017. Effects of ocean acidification on juvenile sea urchins: predator-prey interactions. J. Exp. Mar. Biol. Ecol. 429, 31–40. https://doi.org/10.1016/j.jembe.2017.04.005. Santos, R., Gorb, S., Jamar, V., Flammang, P., 2005. Adhesion of echinoderm tube feet to rough surfaces. J. Exp. Biol. 208, 2555–2567. https://doi.org/10.1242/jeb.01683. Sherman, E., 2015. Can sea urchins beat the heat? Sea urchins, thermal tolerance and climate change. Peer J 3, e1006. https://doi.org/10.7717/peerj.1006. Steneck, R.S., 1998. Human influences on coastal ecosystems: does overfishing create trophic cascades? Trends in Ecology and Evolution 13, 429–430. https://doi.org/ 10.1016/S0169-5347(98)01494-3. Stiasny, M.H., Mittermayer, F.H., Göttler, G., Bridges, C.R., Falk-Petersen, I.-B., Puvanendran, V., Mortensen, A., Reusch, T.B.H., Clemmesen, C., 2018. Effects of parental acclimation and energy limitation in response to high CO2 exposure in Atlantic cod. Scientific Report 8, 8348. https://doi.org/10.1038/s41598-018-26711-y. Tertschnig, W.O., 1989. Diel activity patterns and foraging dynamics of the sea urchin Tripneustes ventricosus in atropical seagrass community and a reef environment (Virgin Islands). Marine Ecology (Berlin) 10, 3–21. https://doi.org/10.1111/j.14390485.1989.tb00063.x. Thomsen, J., Casties, I., Pansch, C., Körtzinger, A., Melzner, F., 2013. Food availability outweighs ocean acidification effects in juvenile Mytilus edulis: laboratory and field experiments. Glob. Chang. Biol. 19, 1017–1027. https://doi.org/10.1111/gcb.12109. Timmermann, A., Oberhuber, J., Bacher, A., Esch, M., Latif, M., Roeckner, E., 1999. Increased El Niño frequency in a climate model forced by future greenhouse warming. Nature 268, 694–696. https://doi.org/10.1038/19505. Todgham, A.E., Stillman, J.H., 2013. Physiological responses to shifts in multiple environmental stressors: relevance in a changing world. Integr. Comp. Biol. 53, 539–544. Todgham, A.E., Schulte, P.M., Iwama, G.K., 2005. Cross-tolerance in the tidepool sculpin: the role of heat shock proteins. Physiol. Biochem. Zool. 78, 133–144.

Torres, R., Turner, D.R., Rutllant, J., Lefèvre, N., 2003. Continued CO2 outgassing in an upwelling area off northern Chile during the development phase of El Niño 1997−1998 (July 1997). J. Geophys. Res. 108 (C10), 3336. https://doi.org/10.1029/2000JC000569. Torres, R., Pantoja, S., Harada, N., González, H.E., Daneri, G., Frangopulos, M., Rutllant, R.A., Duarte, C.A., Rúiz-Halpern, S., Mayol, E., Fukasawa, M., 2011. Air-sea CO2 fluxes along the coast of Chile: from CO2 outgassingin central northern upwelling waters to CO2 uptake in southern Patagonian fjords. Jounal of Geophysical Research 116, 1–17. https://doi.org/10.1029/2010JC006344. Torres, R., Manríquez, P.H., Duarte, C., Navarro, J.M., Lagos, N.A., Vargas, C.A., Lardies, M.A., 2013. Evaluation of a semiautomatic system for longterm seawater carbonate chemistry manipulation. Rev. Chil. Hist. Nat. 86, 443–451. https://doi.org/10.4067/S0716078X2013000400006. Tuya, F., Cisneros-Aguirre, J., Ortega-Borges, L., Haroun, R.J., 2007. Bathymetric segregation of sea urchins on reefs of the Canarian Archipelago: role of flow-induced forces. Estuar. Coast. Shelf Sci. 73, 481–488. https://doi.org/10.1016/j.ecss.2007.02.007. Ubaldo, J.P., Uy, Frederick A., Dy, D.T., 2008. Temperature tolerance of some species of Philippine intertidal echinoderms. The Philippine Scientist 44, 105–119. https://doi. org/10.3860/psci.v44i0.381. Vargas, C.A., Lagos, N.A., Lardies, M.A., Duarte, C., Manríquez, P.H., Aguilera, V.M., Broitman, B., Widdicombe, Dupont, S., 2017. Species-specific responses to ocean acidification should account for local adaptation and adaptive plasticity. Nat. Ecol. Evol. 0084. https://doi.org/10.1038/s41559-017-0084. Vásquez, J.A., 2001. Ecology of Loxechinus albus. In: Lawrence, J.M. (Ed.), Edible Sea Urchins: Biology and Ecology. Developments in Aquaculture and Fisheries Science. vol. 32. Elsevier, Amsterdam, pp. 161–175. Vásquez, J.A., Donoso, G., 2013. Ecology of Loxechinus albus. Laurence JM (ed) Sea Urchins: Biology and Ecology. Elsevier, Amsterdam, pp. 285–296. Vásquez, J.A., Castilla, J.C., Santelices, B., 1984. Distributional patterns and diet of four species of sea urchin giant kelp forest (Macrocystis pyrifera) of Puerto Toro, Navarino Island. Chile. Mar. Ecol. Prog. Ser. 19, 55–63. https://doi.org/10.3354/meps019055. Vergara-Amado, J., Silva, A.X., Manzia, C., Nespolo, R.F., Cárdenas, L., 2017. Differential expression of stress candidate genes for thermal tolerance in the sea urchin Loxechinus albus. J. Theor. Biol. 68, 104–109. https://doi.org/10.1016/j.jtherbio.2017.03.009. Wang, J., Dong, Y., Ding, M., Russell, B., 2018. Ocean acidification increases the sensitivity and variability of physiological responses of an intertidal limpet to thermal stress. Biogeosci. Discuss. 15, 2803–2817. https://doi.org/10.5194/bg-15-2803-2018. Watson, S.A., Southgate, P.C., Miller, G.M., Moorhead, J.A., Knauer, J., 2012. Ocean acidification and warming reduce juvenile survival of the fluted giant clam, Tridacna squamosal. Molluscan Research 32, 177–180. Wobbrock, J.O., Findlater, L., Gergle, D., Higgins, J.J., 2011. The Aligned Rank Transform for Nonparametric Factorial Analyses Using Only ANOVA Procedures. Proceedings of the International Conference on Human Factors in Computing Systems, CHI. 2011 pp. 7–12 Vancouver, BC, Canada, May. Wolfe, K., Dworjanyn, S.A., Byrne, M., 2013. Effects of ocean warming and acidification on survival, growth and skeletal development in the early benthic juvenile sea urchin (Heliocidaris erythrogramma). Glob. Chang. Biol. 19, 1–12. https://doi.org/10.1111/ gcb.12249. doi:10.1111/gcb.12249. Zittier, Z.M., Hirse, T., Pörtner, H.O., 2013. The synergistic effects of increasing temperature and CO2 levels on activity capacity and acid–base balance in the spider crab, Hyasaraneus. Mar. Biol. 160, 2049–2062. https://doi.org/10.1007/s00227-0122073-8.