Operational optimization of a three-stage nitrification moving bed biofilm reactor (NMBBR) by obtaining enriched nitrifying bacteria: Nitrifying performance, microbial community, and kinetic parameters

Science of the Total Environment 697 (2019) 134101

Contents lists available at ScienceDirect

Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv

Operational optimization of a three-stage nitrification moving bed biofilm reactor (NMBBR) by obtaining enriched nitrifying bacteria: Nitrifying performance, microbial community, and kinetic parameters Miao Zhang a,⁎, Meng Yu a, Yixin Wang a, Chengda He a, Jingjin Pang b, Jun Wu a a b

College of Environmental Science and Engineering, Yangzhou University, Yangzhou 225127, PR China Yangzhou Jieyuan Drainage Company Limited, Yangzhou 225002, PR China

H I G H L I G H T S

G R A P H I C A L

A B S T R A C T

• A three-stage NMBBR was successfully started within 18 days with NH+ 4 -N removal of 92.78%. • Noticeable differences were observed in the three stages of NMBBR by analyzing SAOR, FISH, and qPCR. • Temperature impact on nitrification performance was focused to obtain temperature coefficient. • Kinetic parameters were compared between various floc sizes and microbial species compositions. • DO diffusion played a significant role than substrate utilization.

a r t i c l e

i n f o

Article history: Received 21 July 2019 Received in revised form 23 August 2019 Accepted 23 August 2019 Available online xxxx Editor: Yifeng Zhang Keywords: Three-stage NMBBR Biofilm cultivation Microbial community Temperature Nitrification kinetic Operational optimization

⁎ Corresponding author. E-mail address: [email protected] (M. Zhang).

https://doi.org/10.1016/j.scitotenv.2019.134101 0048-9697/© 2019 Elsevier B.V. All rights reserved.

a b s t r a c t A two-sludge system consisting of A2/O (Anaerobic Anoxic Oxic) and NMBBR (Nitrification Moving Bed Biofilm Reactor) was developed. Stable and efficient denitrifying phosphorus removal can be realized by high-efficiency utilization of carbon sources in A2/O reactor with the electron acceptors of NO− x -N in a three-stage NMBBR (consisting of N1, N2, N3). The three-stage NMBBR was successfully started within 18 days without additional inoculation sludge. Then a long-term operation (22–120 d) for the optimization of nitrifying performance, microbial community, and kinetic parameters was investigated. The biofilm characteristics (MLSS and biofilm thickness) and real-time control parameters (DO and pH) initially revealed the differences of three stages, while FISH results confirmed the optimizing nitrifying bacteria populations including AOB, Nitrobacteria and Nitrospira (N1: 5.94 ± 0.12%; N2: 8.26 ± 0.42%; N 3: 10.06 ± 0.27% on day 50), basically consisting with the qPCR results (N 1 : 4.05%; N2 : 8.04%; N3: 14.14%). The specific ammonium oxidation rate (SAOR: 3.24–10.02 mg/(gMLSS·h)) and temperature coefficient (θ: 1.008–1.011) based on temperature variation (15–35 °C) exhibited a strong resistant ability to low temperature operation. Moreover, half-saturation constants (KN,AOB, K N,NOB, K O,AOB and K O,NOB) fitted by Monod equation proved that DO diffusion played a significant role than substrate utilization − (NH+ 4 -N and NO2 -N), but the diffusion resistance was negligible for flocs size smaller than 70 μm. Additionally, the dominant NOB (mainly Nitrospira) due to a higher KN,NOB and KO,NOB was more sensitive to mass transfer and diffusion resistance, which was helpful to understand the microbial competition for

2

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

short-cut nitrification between AOB and NOB. Based on the above mechanism analysis, the MBBR optimization for the design and operation was put forward. © 2019 Elsevier B.V. All rights reserved.

1. Introduction In conventional biological nitrogen removal (BNR) systems, nitrification is the rate-limiting step and nitrifying bacteria activity can be adversely affected by pH, temperature, dissolved oxygen (DO), hydraulic retention time, toxic compounds and other operational parameters (Kim et al., 2013). Moving bed biofilm reactor (MBBR) had been widely employed in domestic sewage treatment several decades ago, which showed lower head loss without clogging problems (Zhang et al., 2013b). Such reactors are filled with suspended carriers, which move and circulate by providing an attachable surface to active biomass, especially for nitrifying bacteria with low specific growth rates (Gu et al., 2014). Consequently, a longer sludge retention time (SRT) can be maintained and nitrifying bacteria enrich quickly even under low temperature (Young et al., 2017). It is well-known that nitrogen and phosphorus removals depend on the available carbon source as it provides the reduction equivalent and energy resource (Zheng et al., 2018). However, the carbon source is generally insufficient for real wastewater treatment due to the low influent carbon/total nitrogen ratio (C/N), and the addition of external carbon source increases the operational costs. Denitrifying phosphorus removal technology has received much attention because of efficient carbon sources utilization and lower energy consumption (Bassin et al., 2012). It can meet the simultaneous nitrogen and phosphorus removal by enriching denitrifying phosphorus accumulation organisms (DPAOs), and DPAOs use nitrate or nitrite as electron acceptors instead of oxygen which substantially enhanced the treatment efficiency at a lower operational cost (Zeng et al., 2017). Recently, a novel A2/O - NMBBR (Anaerobic Anoxic Oxic - Nitrification Moving Bed Biofilm Reactor) process was developed by the integration of nitrification and denitrifying phosphorus removal in a twosludge system (Zhang et al., 2016b). With the separation of SRT, A2/O reactor was operated in a shorter SRT to enrich the phosphorus accumulation organisms (PAOs), especially DPAOs for denitrifying phosphorus removal. Nitrifying bacteria were eliminated from A2/O reactor, and completed ammonium oxidation fully occurred in the following NMBBR with a longer SRT. By recycling nitrate as electron acceptor to a longer anerobic/anoxic reaction zones in the A2/O reactor, simultaneous nitrogen and phosphorus removals were achieved through efficient utilization of limited carbon source (Zhang et al., 2016a). Particularly, NMBBR consists of three stages combining with the advantages of activated sludge and biofilm, which favors the development of adapted and specialized nitrifying bacteria gradually (Rusten et al., 2006). Owing to its superiority of supplying sufficient electron acceptors, the A2/O reactor can achieve denitrifying phosphorus removal targeting to simultaneously take away nitrogen and phosphorus. However, nitrification is the key precondition for denitrifying phosphorus removal in the A2/O - NMBBR process, where aerobic ammonia oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB) both have their contributions (Ge et al., 2015). In other words, the nitrification performance depended on the AOB - NOB mutualism (Graham et al., 2007). It has been realized that kinetic parameters based on the Monod-type equations offer a valuable tool for modeling and controlling of nitrification stability (Iacopozzi et al., 2007). Transport and diffusion processes are considered to better understand the nitrification kinetics, but the biofilm kinetics is more complex, as the substrate diffusion is driven by concentration gradient across the biofilm layer (Seifi and Fazaelipoor, 2012). Besides, the variation of oxygen is one of the main factors to affect the half-saturation index during nitrifying bacteria

enrichment by changing oxygen availability of AOB and NOB in different layers of biofilm (Wu et al., 2017a). To optimize the design and operation, it is necessary to have appropriate kinetic expressions for the three-stage NMBBR. There has been great interest in biofilm reactors for nitrification, but most attempts involved in the organic matter (Zhu and Chen, 2002). So far, there is little information available about the nitrification kinetics of enriched nitrifying bacteria with treating real wastewater of low chemical oxygen demand (COD) concentration. The objectives of this study were: (1) to evaluate the biofilm characteristics and microbial communities for quick startup of NMBBR, and (2) to explore the impact of temperature on nitrification performance, and (3) to contrast the nitrification kinetics of AOB and NOB by considering both substrate utilization and mass diffusion. The results will provide necessary information to better understand the potentialities and constraints of MBBR systems, such as rapid startup of biofilm systems, optimum growth conditions, competition regulations of AOB and NOB, as well as kinetic model references for other microorganisms. 2. Materials and methods 2.1. Experimental equipment and carrier characteristic The continuous flow A2/O - NMBBR system was composed of an A2/ O reactor, a middle settler, and the NMBBR (Fig. 1). The A2/O reactor (working volume: 28 L) was evenly divided into eight chambers with the volume ratio (anaerobic/anoxic/aerobic) of 1:6:1 to achieve denitrifying phosphorus removal. The last chamber was an aerobic zone with DO of 1.0–1.5 mg/L to expel nitrogen gas then flew into middle settler (working volume: 10 L). The settled sludge was recycled (sludge return ratio: 100%) to the anaerobic zone of the A2/O reactor, while the supernatant flew to the NMBBR reactor (working volume: 10.5 L) to complete the oxidation of ammonia. Waste sludge was regularly discharged with a shorter SRT of 10 ± 2 d. The NMBBR (working volume: 10.5 L) was composed of three identical chambers (N1, N2, and N3) packed with cylinder polypropylene carriers (diameter 5 mm and length 3 mm). The fraction of effective working volume occupied by carriers was determined to be 45% according to Feng et al. The carrier density was 960–1000 kg/m3, enabling to suspend and move in the reactor. The effective porosity and specific surface area of the carriers were 98% and 1800 m2/m3 respectively. The DO was 3.50–4.50 mg/L for nitrification, and air diffusers were installed at the bottom of each chamber where the intensity was adjusted by the rotameter. The nitrate produced in NMBBR was recycled (nitrate recycle ratio: 300%) to the anoxic zone of the A2/O reactor acting as the electron acceptor for denitrifying phosphorus removal. The detached biofilm was regularly discharged with a longer SRT of 80 ± 2 d, which was calculated according to Gong et al. (2012). 2.2. Wastewater source and experimental arrangement The seed sludge of A2/O reactor was collected from a cyclic activated sludge system (CASS) treating domestic wastewater in Tangwang wastewater treatment plant (Yangzhou, China). Domestic wastewater was taken from a septic tank in Yangzhou University, and the wastewater characteristics were shown in Table 1. The average influent C/N ratio was 3.4, which was a typical wastewater with low C/N ratio. The experimental period lasted 120 d which was divided into three phases: 0–21 d (Run1), startup phase of biofilm incubation combining with biomass characteristics and real-time control parameters; 22–50 d (Run 2),

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

3

Fig. 1. Schematic diagram for A2/O - NMBBR process.

continuous operation of A2/O - NMBBR system to contrast biofilm micromorphology property with Run1; 51–120 d (Run3), enhanced nitrifying bacteria enrichment under long-term test. On day 50 and day 110, the biofilm samples (N1, N2, and N3) were respectively collected for microbial analysis. 2.3. Analytical methods The temperature, pH and DO were measured online using a WTW pH/DO meter (WTW Multi 340i, Germany). COD was measured using a COD quick-analysis apparatus (LH-3C, Lanzhou, China). The ammo− − nium (NH+ 4 -N), nitrate (NO3 -N), nitrite (NO2 -N), and total phosphorus (TP) concentrations were analyzed using Lachat QuikChem8500 Flow Injection Analyzer (Lachat Instrument, Milwaukee, Wisconsin). TN was detected with a TN/TOC analyzer (MultiN/C3100, Analytik Jena, AG). Portable turbidimeter (HACH 1900C, USA) was used to monitor the variation of turbidity and suspended solid (SS) was analyzed according to the standard method (Association, 1995). The nitrite accumulation rate (NAR) was calculated according to the following equation: NARð%Þ ¼


NO− 2 −N

C

 100% − C NO− 2 −N þ C NO3 −N

ð1Þ

Several carriers were selected randomly from NMBBR to estimate the quantity of the attached biomass. The carriers were dried until constant weight (M0, mg/L) was achieved, and then the net weight without

Table 1 Characteristics of raw wastewater. Items

Range

COD (mg/L) TN (mg/L) NH+ 4 -N (mg/L) NO− 3 -N (mg/L) − NO2 -N (mg/L) PO3− 4 -P (mg/L) C/N pH

123.6–267.4 52.4–78.1 47.8–72.6 0.1–1.4 0–0.1 3.9–7.2 2.3–4.2 7.12–7.26

Average 190.6 62.9 59.7 0.6 0.04 5.4 3.4 7.20

biofilm (M1, mg/L) was obtained after washing and cleaning the carriers. The mixed liquor suspended solids (MLSS) (X, mg/L) were calculated according to the equation below: X ¼ ðM 0 −M1 Þ  N=n

ð2Þ

where N was the total number of carriers (about 200 in each chamber); and n was the number of the sampled carriers (nearly one-tenth) taken out from the reactor. The biofilm morphology was observed by a digital camera (Canon 550d, Japan) which was connected to a light microscope (BX51, Olympus, Japan), and the biofilm thickness was measured by Image-Pro Plus 6.0 software (Media Cybernetics, USA) (Gong et al., 2012). The biofilm samples were also fixed using 2.5% glutaraldehyde prior to ethanol dehydration (20%, 40%, 60%, 80%, 100%, 100%, 100%) (McCutcheon and Southam, 2018), and scanning electron microscopic (SEM) (GeminiSEM 300, Germany) was conducted to elucidate the microscopic behavior of biofilm formation. 2.4. Nitrification batch experiments During long-term stable operation (Run3), one-half of plastic carriers (about 100) of N1, N2, and N3 were taken out respectively from NMBBR to be washed three times using deionized water. The carriers were then added to three reactors (working volume: 2 L), and NH4Cl was added to ensure the similar dissolved NH+ 4 -N concentration (20 ± 1 mg/L) while the temperature was controlled at 15 °C, 25 °C and 35 °C (error within 1 °C), respectively. The aeration was provided by an air blower (DO: 3–4 mg/L) and pH was maintained at 7.50 ± 0.1 by adding NaOH or HCl to avoid alkalinity limitation. Liquor samples were taken every 10 min and filtered for water quality analysis. Due to the slow growth rate of nitrifiers, it was considered that the biomass concentration was constant during the batch experiments. The impact of temperature (15–35 °C) on specific ammonium oxidation rate (SAOR) was expressed by the simplified Arrhenius equation (Zhang et al., 2014), providing a generalized estimate of temperature coefficient (θ) on the nitrification kinetics: SAORT ¼ SAOR15 θðT−15Þ

ð3Þ

4

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

where SAORT was the specific ammonia oxidation rate (mg/(gMLSS·h)) at temperature T (°C); SAOR15 was the value of SAOR at 15 °C (mg/ (gMLSS·h)); θ was the temperature coefficient (dimensionless), and SAOR was calculated according to the following equation: SAOR ¼

S0 −St X  Δt

ð4Þ

where S0 and St were the starting and ending concentrations of NH+ 4 -N, X was the MLSS concentration in Eq. (2), and Δt was the reaction time. Based on the Monod equation (Park and Bae, 2009), the half− saturation constants of KN,AOB, KN,NOB (NH+ 4 -N or NO2 -N: 1–30 mg/L, DO was set to be non-limiting condition) and KO,AOB, KO,NOB (DO: − 0.5–8.5 mg/L, NH+ 4 -N and NO2 -N concentrations were set to be nonlimiting condition) were contrasted at ambient temperature of 25 ± 2 °C. These were demonstrated in Eqs. (5)–(8): μN; AOB ¼ μ NH4 max

SNH4 SNH4 þ K N;AOB

ð5Þ

μN; NOB ¼ μ NO2 max

SNO2 SNO2 þ K N;NOB

ð6Þ

μO; AOB ¼ μ NH4 max

SO2 SO2 þ K O;AOB

ð7Þ

μO; NOB ¼ μ NO2 max

SO2 SO2 þ K O;NOB

ð8Þ

where μN,AOB and μO,AOB were the specific oxidation rate of NH+ 4 -N, and μN,NOB and μO,NOB were the specific oxidation rate of NO− 2 -N, (mg/ NO2 (gMLSS·h)); μNH4 max and μmax were the maximum specific oxidation + − rates of NH4 -N and NO2 -N, which were assumed to be constant, (mg/ (gMLSS·h)); SNH4, SNO2 and SO2 were the different concentrations of − NH+ 4 -N, NO2 -N and O2 respectively, (mg/L); KN,AOB, KN,NOB, KO,AOB and KO,NOB represented the half-saturation constants through curve fitting by Origin85, (mg/L).

Table 3 Primers information of real-time quantitative PCR used in this study. Primer

Sequence (5′-3′)

Target

amoA-1F amoA-2R NSR 1113F NSR 1264R FGPS872f FGPS1269r 341f 534r

GGGGTTTCTACTGGTGGT CCCCTCKGSAAAGCCTTCTTC CCTGCTTTCAGTTGCTACCG GTTTGCAGCGCTTTGTACCG CTAAAACTCAAAGGAATTGA TTTTTTGAGATTTGCTAG CCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG

AOB amoA Nitrospira 16S rRNA Nitrobacter 16S rRNA All bacteria 16S rRNA

Annealing temperature 55 °C 53 °C 51 °C 55 °C

targeting bacteria. The standard error was calculated as the standard deviation divided by the square root of the number of images. Real-time quantitative polymerase chain reaction (qPCR) was also conducted to determine the abundances of AOB, Nitrobacter, and Nitrospira using the MX3000P PCR system (Stratagene, La Jolla, CA) equipped with the fluorescent dye SYBR-Green approach. DNA was extracted from the biofilm samples using a FastDNA® SPIN Kit for Soil (QBiogene Inc., Carlsbad, CA, USA). The primers of qPCR (Table 3) were described according to Zhang et al. with a total reaction volume of 20 μL (Zhang et al., 2017): 10 μL of SYBR Green exTaq buffer (Takara, Dalian, China), 2 μL of standard template DNA(1–10 ng), 0.3 μL of forward/reverse primer (10 mmol/L), 0.4 μL of ROX Reference Dye 50, and deionized water (7 μL). The amplification was performed by the following thermal-cycling parameters: an initial temperature at 95 °C for 3 min; followed by 40 cycles at 95 °C for 30 s, at the corresponding annealing temperature for 30 s, and extension at 72 °C for 45 s. The calibration curves were produced from a 10-fold serial dilution in each assay. A no-template control was included to check for contamination with the correlation coefficient of amplification efficiency above 0.99. 3. Results and discussions 3.1. Biofilm characteristics and real-time control parameters

2.5. Microbial analysis The fluorescence in situ hybridization (FISH) was conducted to observe the attached nitrifiers of matured biofilm including AOB and NOB of N1, N2, N3, and the oligonucleotide probes used were listed in Table 2. EUB338, EUB338-II and EUB338-III were applied together (EUBmix, for all Bacteria), as well as, NSO1225 and NSO190 (AOBmix, for Ammonia - oxidizing β-Proteobacteria), and NIT3 (NOB, for Nitrobacteria) and Ntspa662 (NOB, for Nitrospira) (Gu et al., 2012). At least 30 images were taken for each sample. FISH image analysis was performed by a digital imaging system (OLYMPUS-DP72, Japan) together with Image-Pro Plus 6.0. The pixel areas of green region conferred by FITC (all bacteria) and red region conferred by Cy3 (targeting bacteria) were counted separately (Zhang et al., 2013a), where the relative proportion roughly revealed the percentage of

Although the influent COD fluctuated in the range of 189.42–240.40 mg/L, the effluent COD was almost consistently b50 mg/L with an average removal of 81.29% in the A2/O reactor (Fig. 2a). By using the A2/O effluent (CODb50 mg/L) as influent for biofilm incubation, the biofilm of NMBBR gradually matured. However, the 2 TN (mainly NH+ 4 -N) and TP removals of the A /O reactor were closely + related to NH4 -N removal performance in the NMBBR. During the early domestication (1–9 d), NH+ 4 -N removal efficiency improved obviously, and the average concentrations of N1, N2, N3 were 36.47, 28.90, 22.57 mg/L with the maximum removal efficiency of 77.41% (Fig. 2b). Accordingly, the TN and TP removals increased from 19.63%, 49.91% to 55.17%, 67.31%, respectively (Fig. 2a). With continuous operation (10–21 d), nitrification performance further increased and changed to be stable. The A2/O effluents of TN and TP were 18.20 mg/L and

Table 2 Oligonucleotide probes of FISH used in this study. Probe EUB338a EUB338-IIa EUB338-IIIa NSO1225b NSO190b NIT3 Ntspa662 a b

Formamide solution concentration (%) 0–55

35 55 40 35

Sequence (5′-3′) GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT CGCCATTGTATTACGTGTGA CGATCCCCTGCTTTTCTCC CCTGTGCTCCATGCTCCG GGAATTCCGCGCTCCTCT

Fluorochrome labeled FITC Cy3 Cy3 Cy3 Cy3 Cy3 Cy3

Target organism Most Bacteria Planctomycetales and other Bacteria not detected by EUB338 Verrucomicrobiales and other Bacteria not detected by EUB338 Ammonia - oxidizing β-Proteobacteria Ammonia - oxidizing β-Proteobacteria Nitrobacteria Nitrospira

EUBmix is an equimolar mixture of probes EUB338, EUB338-II and EUB338-III targeting for most bacteria labeled by FITC. AOBmix is an equimolar mixture of probes NSO1225 and NSO190 targeting for Ammonia - oxidizing β-Proteobacteria labeled by Cy3.

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101 300

100

(a)

250

CODeff

200

TNinf

80

TNeff

100 60

50 6

40

5 4 3

removal efficiency(%)

150

COD傎 TN傎 TP (mg/L)

CODinf

TPinf TPeff CODre TNre TPre

20

2 1 0 0

3

6

9

12

15

Time (d)

18

0 24

21

70

100

(b) 60

+

NH4 -N(mg/L)

+

NH4 -N of N1 60

+

NH4 -N of N2

40

+

NH4 -N of N3 influent effluent removal effieiency

30

40

20

removal efficiency(%)

80 50

20 10 0 24

0 0

3

6

9

12

15

18

21

Time (d) 1200

120

Biomass thickness of N1

(c)

Biomass thickness of N2

1000

100

Biomass thickness of N3 MLSS of N2

MLSS (mg/L)

800

80

MLSS of N3

600

60

400

40

200

20

0 0

3

6

9

12

15

18

Biomass thickness (μm)

MLSS of N1

0 24

21

Time (d) Stage of N2

pH=7.78

7.9

7

7.8 7.7

8.0

8.0

7.9

7 7.9

7.8

7.8

pH=7.57

7.7

pH

7.5

7.1 7.0 0

3 4

8

12

16

20

7.3 4

7.2 7.1

DO=4.14

5 7.4

7.3 4

7.2

pH=7.31

7.5 5

7.4

7.3

6

7.6

5 7.4

pH 7 DO

6 7.6

7.5

Stage of N3 (d)

7.7

6 7.6

8

8 8.1

8.1

Stage of N1 8.0

7.0 0

DO(mg/L)

8

8.1

DO=4.22 4

8

12

16

4

7.2 7.1

3 7.0 20 0

DO=4.29 3 4

8

12

16

20

Time (d)

Fig. 2. Variation of nutrient removals, biofilm characteristics and real-time control parameters (a: COD, TN, TP removals in the A2/O reactor; b: NH+ 4 -N removal in the NMBBR; c: MLSS and biofilm thickness; d: pH and DO).

1.02 mg/L on day 15. At the end of the startup, NH+ 4 -N concentration of three stages were 14.78, 7.42, 4.10 mg/L respectively, and the final removal efficiency increased to 92.78%. The effluent TN (15.8 mg/L) and TP (0.52 mg/L) basically achieved the Class A standard, indicating a favorable denitrifying phosphorus removal by enhancing nitrifying performance.

5

Additionally, biofilm characteristics directly revealed the formation process of biomass attaching to carriers (Hu et al., 2013). As shown in Fig. 2c, biofilm thickness and MLSS both showed a rising trend in accordance with the improved nitrification performance. After 15 days' acclimation, the biofilm thickness of three stages (from N1 to N3) was 104.30, 79.15, 53.28 μm while average MLSS was 912.16, 771.80, 593.68 mg/L respectively. In a similar oxic MBBR, the biofilm MLSS was less 900 mg/L after 17–20 days' operation, and it didn't exceed 1300 mg/L until 30 days later (Gong et al., 2012). It was likely the larger specific surface area resulted in the lower detach rate and higher growth rate of biofilm (Zhang et al., 2013a) even under low NH+ 4 -N loading (0.03–0.05 kgN/(m3·d)). Polypropylene carriers with large porosity also avoided clogging problems, but due to the short startup time, the biomass (982.5–990.7 mg/L) was much lower than traditional activated sludge processes (3000–4000 mg/L). Real-time control parameters including pH and DO (Peng et al., 2007) were commonly used for optimizing energy requirements of BNR processes. As shown in Fig. 2d, the average pH values were 7.78, 7.57 and 7.31 (from N1 to N3), and obviously the decrease was due to the consumption of alkalinity during NH+ 4 -N oxidation although the influent pH ranged from 7.12 to 7.26 (Table 1). Although heterotrophic nitrification performed by a wide range of microorganisms (e.g. heterotrophic bacteria (HBs), fungi, and actinomycetes (Yang et al., 2019)) could contribute to NH+ 4 -N oxidation by utilizing organic matter, the negligible undegradable COD (b50 mg/L) in NMBBR cannot provide enough energy and it is considered autotrophic nitrifiers contribute much more significantly than the heterotrophic nitrifiers. Thereinto, due to relatively more residual COD in N1, the CO2 stripping resulted in a higher pH than the latter two stages. Meanwhile, acid production and alkalinity reduction led to the reduced pH through NH+ 4 -N oxidization during the aerobic condition (Hernandez-Ramirez et al., 2019), where the more obvious nitrification, the more pH decreased. Especially after 18 days' acclimation, pH dropped to 7.65, 7.50 and 7.20 with a more remarkable decline in N3, suggesting the improved nitrification performance. However, DO variations (4.14, 4.22, 4.29 mg/L) were not so prominent, which exhibited a balance between the aeration rates and the biomass activities (Gu et al., 2012). The lower value (4.14 mg/L) and violent fluctuation of DO in N1 could be due to the presence of a small amount of organic matter (CODb50 mg/L), where more oxygen was consumed by the ordinary HBs. By contrast, the latter two stages (N2: 4.22 mg/L; N3: 4.29 mg/L) were less affected by COD, which was beneficial to the enrichment of nitrifying bacteria (Steuernagel et al., 2018). Therefore, the variations of pH and DO both revealed that biofilm matured within 18 days, and it was feasible to accelerate the nitrification startup by applying a real-time control strategy. Furthermore, it's worth noting that the turbidity of the NMBBR effluent was relatively low (15–20 NTU), and the average SS content was 20–35 mg/L, only accounting for 2–4% of the total biomass, which was negligible. Generally, the biofilm formation can be divided into several stages, including initial exposure, irreversible adhesion, biofilm maturation, aging and shedding, among which the initial attachment determines the formation rate and biofilm stability (Huang et al., 2014). On the one hand, the higher specific surface area and longer SRT facilitated the deposition and attachment of bacterial cells to the carrier surface (Simões et al., 2010). On the other hand, thanks to the low effluent COD (Fig. 2a), a balance between biofilm growth and detachment was gradually generated for the functional nitrifiers by capture and consumption of NH+ 4 -N. Consequently, the three-stage NMBBR realized a rapid start-up even without additional inoculation sludge. 3.2. Micromorphology property and microbial community structure SEM has been intensively used to characterize the microstructure and composition distribution of bacteria (Lei et al., 2009), which was intended to confirm the presence of absorbed biomass. Just as SEM

6

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

(a)10 d

(b)18 d

(c)30 d

(d)45 d

Fig. 3. SEM images of biofilm microstructure during Run1 (0–21 d) and Run2 (22–50 d).

images showed, the floc structure was loose and biofilm microbial morphology was given priority to inorganic matter during the first 10 days, which was also accompanied by a small amount of Bacillus (Fig. 3a). In Fig. 3b, larger floc aggregation could be observed with the increasing biomass, and the biophases were diverse due to the nature of mature biofilm (18 days). With the continuous operation of 30 days, biofilm thickness further increased and microorganisms attached inside the carriers had better capability to resist detachment force (Gong et al., 2012), which led to Coccoid and Bacillus microorganisms account for the dominant proportion (Fig. 3c). Interestingly, a lot of filaments extended out of the flocs on day 45 (Fig. 3d), filamentous bacteria served as the backbones tangled up sludge flocs (Yang et al., 2013) and played positive roles in retaining biomass, leading to the compact and dense biofilm structure, which insured a longer SRT for nitrifying bacteria growth. FISH was further performed to exhibit the shift of functional microbial community structure. Specific probes for AOB and NOB (Nitrobacteria and Nitrospira) were applied to detect biofilm samples (N1, N2 and N3) on day 50. The results showed that AOB accounted for 2.02 ± 0.12% (Fig. 4a–b), and Nitrobacteria and Nitrospira were 0.67 ± 0.08%(Fig. 4c–d) and 3.30 ± 0.24% (Fig. 4e–f) respectively, with the total nitrifiers of 5.94 ± 0.12% in the first stage of N1. FISH images of N2 and N3 were not shown, but the distribution and comparison of nitrifying bacteria were revealed in Fig. 4g. The total nitrifiers showed a rising trend, where the latter two samples reached to 8.26 ± 0.42% (N2) and 10.06 ± 0.27% (N3). The maximum percentage was statistically equal to the relative abundance of AOB (6.5–7.0%) and NOB (2.3–3.8%) in a pilot nitrifying MBBR reactor operated at various NH+ 4 -N loading rates (0.51–2.36 gN/(m2·d)) (Young et al., 2017). Moreover, AOB and NOB populations were simultaneously improved (AOB: from 2.02% to 4.38%; NOB: from 3.92% to 5.68%) when the total nitrifying bacteria increased, so there was partial nitrite

accumulated in this study (NAR = 20–25%). Comparing with N1, AOB population increased by 2.33% while Nitrospira only increased by 1.46% in sample N3. Nitrobacteria in three samples was all of the negligible relative abundance (0.45–0.92%) indicating Nitrospira was the primary NOB. This finding was not consistent with previous studies which revealed that Nitrobacteria was the dominant NOB in nitrifying systems (Cho et al., 2014). The main reason could be attributed to the propensity to preferentially grow of Nitrospira at lower nitrite concentrations (Kim et al., 2011). However, the total nitrifying bacteria was still less abundant (only 5.94–10.06%) and low COD concentration was considered to promote HBs dominating nitrifying bacteria (AOB and NOB). Because it is highly incredible that nitrifiers would be able to compete with HBs due to a higher proliferation rate (Zhang and Lin, 2000). On the other hand, the HBs are believed to be responsible for the assimilation of soluble COD to promote nitrifying biofilm formation and development (Kindaichi et al., 2004), so the quantitative analysis of total microbial communities was further studied by qPCR. As shown in Fig. 4h, the qPCR results were used to demonstrate the nitrifiers abundance comprised by AOB, Nitrobacteria as well as Nitrospira. Although the gene copy number (total bacteria: 3.16–3.95 × 10 6 (copies/g dry sludge); AOB: 0.76–2.07 × 10 5 (copies/g dry sludge); Nitrobacteria: 2.05–2.18 × 10 4 (copies/g dry sludge); Nitrospira: 0.46–2.16 × 10 5 (copies/g dry sludge)) was much lower than partial nitritation and simultaneously phosphorus removal granular sludge reactor (total bacteria: 0.4–2.1 × 1011 (copies/g dry sludge) (Zhang et al., 2017)) and partial nitrification-anammox process (AOB: 4.45–8.89 × 109 (copies/g dry sludge); Nitrobacteria: 0.28–4.45 × 108 (copies/g dry sludge); Nitrospira: 1.97–6.16 × 109 (copies/g dry sludge) (Miao et al., 2016)), the variation trends of qPCR were consistent with the FISH results (Fig. 4g). The AOB gene ratio of all bacteria increased from 2.08% to 6.55%, and Nitrospira enriched from 1.26% to 6.90%

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

(a)

(b)

(c)

(d)

(e)

(f)

Nirospira Nitrobacteria AOB

(g) 12

10.06%

10

Percentage(%)

8.26% 8 6

5.94%

4 2

AOB

6

Nitrospira

Nitrobacteria

Total bacteria

5.0x10

6

(h)

4.0x10

Gene number (copies/gdry sludge)

14

7

6

3.0x10

6

2.0x10

6

1.0x10

4

2.08% 1.26% 0.71%

4.13% 3.39%

2.5x10

0.52%

4

6.55% 6.90% 0.69%

2.0x10

4

1.5x10

4

1.0x10

3

5.0x10 0

N1

N2

N3

Stages

0.0 N1

N2

N3

Stages

Fig. 4. Microbial results of AOB, Nitrobacteria and Nirospira in biofilm samples on day 50 (a and b: total bacteria and targeting bacteria of AOB in N1; c and d: total bacteria and targeting bacteria of Nitrobacteria in N1; e and f: total bacteria and targeting bacteria of Nitrospira in N1; g and h: distribution and comparison of AOB, Nitrobacteria and Nirospira in N1, N2 and N3 by FISH and qPCR).

whereas Nitrobacter maintained a lower ratio of 0.52–0.71%. The total nitrifier content of three stages was 4.05%, 8.04%, and 14.14% (a little higher than FISH results in N 3 ), respectively, confirming an optimized nitrifier activity and improved nitrifying performance. 3.3. Effect of temperature on nitrifying performance In order to evaluate the biological stability of biofilm, batch tests were conducted after 110 days' operation. Nitrifying bacteria are sensitive to temperature (Zhang et al., 2013a), which makes it a key factor to influence bioconversion and nitrifying performance (Salvetti et al., 2006). As shown in Fig. 5a, SAOR showed a rising trend

of microbial activity and reaction rate when temperature varied from 15 °C to 35 °C. Even at low temperature (15 °C), SAOR maintained 3.24–5.04 mg/(gMLSS·h) which was much higher than AAO - MBR process at temperature of 19.6 °C (1.32 mg/(gMLSS·h)) (Chen et al., 2010). When temperature was controlled at 25 °C - 35 °C, it changed from 6.56 to 8.31 mg/(gMLSS·h) to 8.78–10.02 mg/(gMLSS·h), consisting with the research conclusions that SAOR was positively related to temperature(2.8–4.1 °C: SAOR = 0.77–1.11 mg/(gMLSS·h); 7.2–28.3 °C: SAOR = 4.13–38.38 mg/(gMLSS·h) in the MBBR for low ammonia concentration polluted raw water (Zhang et al., 2014); 10–35 °C: SAOR = 0.5–9.8 mg/(gMLSS·h) in a nitrification SBR of low ammonia synthetic wastewater (Liu et al., 2019)) (Table 4). Interestingly, SAOR increased with the negative decrement of attached biomass (Fig. 2c) under the

8

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

for municipal sewage (24–38 °C: θ = 1.040–1.060) (Sarioglu et al., 2017), a post-carbon removal MBBR nitrification through the temperature transition from 20 °C to 1 °C (θ = 1.086–1.090) (Young et al., 2017), a nitrifying MBBR system with cold-shock conditions (1–10 °C: θ = 1.049–1.149) (Ahmed et al., 2019), and the SBR treatment systems at low temperature (2–15 °C: θ = 1.02–1.40 (Oleszkiewicz and Berquist, 1988); 14 °C: θ = 1.04–1.07 (Xiaoguang et al., 2018)) (Table 4). The comparison manifested that our three-stage NMBBR technology was more resilient in low temperature operation. However, many other operation parameters (e.g. reactor configuration, ammonia concentration, DO, hydraulic retention time, and carrier characteristics (Pöpel and Fischer, 1998)) also played important roles in countering the effect of temperature on nitrification. For example, free ammonia in high-strength NH+ 4 -N wastewater inhibited the activity and growth of nitrifiers (Joo et al., 2005), and low DO resulted in a negative impact on the nitrification rate (Zhang et al., 2014). Obviously, the effect of temperature on nitrification rate showed a negligible influence (θ = 1.086–1.109) under ammonia-limiting conditions (NH+ 4 -N: 0.9–4.3 mg/L), while a much higher dependence (θ = 1.023–1.081) was observed with oxygen-limiting conditions (DO: 1.5–3.0 mg/L) (Salvetti et al., 2006) (Table 4), indicating the profound impact of operation parameters on MBBR design. Hence, reactors that are operated under ammonia-limiting conditions can be designed without regard to temperature effect; on the contrary, temperature effects have to be taken into account if under oxygen-limiting conditions. In addition, the three stages exhibited various levels of NAR when temperature varied (Fig. 5b). The NAR of N3 ranged from 25.59% to 56.05% as temperature increased from 15 °C to 35 °C, which was much higher than that of N2 (17.67%–35.89%) and N1 (3.16%–8.64%). The reason lies in a kinetic advantage of AOB with maximum specific growth rates over NOB at higher temperatures (Kowalski et al., 2019). On the other hand, due to the differences in the microbial community on day 110 (Table 5), AOB and NOB populations were further optimized than day 50 (Fig. 4g). AOB increased from 2.02 to 4.35% to 4.07–11.89%, while Nitrobacteria and Nitrospira enriched from 0.45 to 0.92%, 3.30–4.76% to 0.49–1.01%, 5.70–14.20%, respectively. Specifically, although the AOB and NOB (including Nitrobacteria and Nitrospira) contents enhanced simultaneously, the relatively high nitrifiers of latter two stages (N2 and N3) were more conducive to promote nitrite accumulation than N1. Actually, the NAR was fluctuant during the longterm continuous operation in the A2/O - NMBBR process (NAR reduced to 10–15% on day 110), which has been reached a consensus that the symbiotic relationship between AOB and NOB changed with the variation of environmental factors (e.g. NH+ 4 -N loading, DO concentration, temperature, etc.) (Wells et al., 2011). In that case, the maintenance of stable NAR especially the latter two stages is crucial for further saving aeration consumption and limited carbon source in the continuous A2/ O - NMBBR operation. In other words, it is necessary to understand and predict how environmental factors determine the biological characteristics and behavior rules of AOB and NOB. 3.4. Nitrification kinetic analysis of AOB and NOB Fig. 5. Effects of temperature on nitrifying performance including SAOR, θ and NAR.

same temperature (15, 25, 35 °C), which further implied that the reproduction ability of nitrifier in three chambers was gradually optimized. In other words, the effective improvement of nitrifiers, which in turn partially compensated for the significant decrease in biomass during NH+ 4 N removals. Temperature coefficient (θ) describing the dependence of SAOR on temperature was recommended of 1.12 in activated sludge model 2 (ASM2) (10–25 °C) (Henze et al., 2000). The result of this study (15–35 °C: θ = 1.008–1.011) was much lower than an MBR operated

Nitrification kinetics have been widely investigated with the purpose of optimizing design and operation of MBBR (Zhang et al., 2014), where the half-saturation constants reflect both the external mass diffusion and intrinsic transfer resistance under a single limiting-substrate condition. As shown in Fig. 6(a)–(d), μN,AOB, μO,AOB and μN,NOB, μO,NOB − were strongly influenced by the substrate utilization of NH+ 4 -N, NO2 N and mass diffusion on DO, but the relationship between them and the half-saturation constants (KN,AOB, KN,NOB, KO,AOB and KO,NOB) fitted well (regression coefficients R2 ≥ 0.93 in all cases). Of course, it was generally accepted that higher half-saturation constant was derived under higher diffusion resistance (large floc size or biofilm thickness), so KN,AOB (0.28 mg/L), KN,NOB (0.31 mg/L), KO,AOB (0.76 mg/L) and KO,NOB (1.10 mg/L) resulted at a larger floc diameter

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

9

Table 4 Comparison of nitrifying performance based on the influence of temperature. NH+ 4 -N concentrationa (mg/L)

Temperature (°C)

b NH+ 4 -N removal efficiency (%)

SAOR (mg/(gMLSS·h))

AAO-MBR MBBR

15–19 2.0

96.68 /

SBR MBR MBBR MBBR SBR

40–60 65 22.7 40 /

1.32–2.58 0.77–1.11 4.13–38.38 0.5–9.8 / /

SBR MBBR

40 0.9–4.3 1.32–37.1 20

10–30 2.8–4.1 7.2–28.3 10–35 24–38 1–20 1–10 7–15 2–7 14 13.4–22 12.5–28.1 15–35

Process

NMBBR a b

72.1 ± 4.9 96.9 90.7 85.62 /

θ

/

55 90 86.3 98.5

/ / / 3.24–10.02

Country

References

/ 1.109–1.119

China China

Chen et al. Zhang et al.

/ 1.040–1.060 1.086–1.090 1.049–1.149 1.02 1.40 1.04–1.072 1.086–1.109 1.023–1.081 1.008–1.011

Canada London Canada Canada Canada London Milan

Liu et al. Sarioglu et al. Young et al. Ahmed et al. Oleszkiewicz and Berquist Liu et al. Salvetti et al.

China

This study

The influent concentration of NH+ 4 -N. The maximum removal efficiency of NH+ 4 -N.

of 155 μm (N1). In contrast, the kinetic constants of the latter two stages were much lower reflecting a tighter affinity which was consistent with the variation of biofilm thickness (N2:108μm; N3:70 μm) (Table 5). In other words, it can be operated at low DO concentrations to save aeration energy due to the lower intrinsic KO,AOB and KO,NOB values. However, KO,AOB (0.15–0.76 mg/L) and KO,NOB (0.22–1.10 mg/L) varied within a broad range over KN,AOB (0.10–0.28 mg/L) and KN,NOB (0.17–0.31 mg/L) (Table 5). By comparing with the kinetic parameters of CAS (floc size: 733 μm) and MBR (floc size: 90 μm), the half-saturation constants of KN,AOB (0.14, 0.13 mg/L) and KN,NOB (0.28, 0.17 mg/L) did not change significantly while KO,AOB (0.79, 0.18 mg/L) and KO,NOB (0.47, 0.13 mg/L) exhibited a major difference attributed to the effects of mass transfer and diffusion resistance (Manser et al., 2005). The results clearly revealed that DO diffusion played a significant role than substrate utilization − (NH+ 4 -N and NO2 -N), but the diffusion resistance was negligible for flocs size smaller than 70 μm in this study (N3: 0.10–0.22 mg/L). From this point of view, it is crucial to strengthen the O2 transport efficiency for saving energy and reducing consumption in practical engineering application. Generally, larger floc size resulted in more aggregation of suspended cells and sludge floc formation, which made it difficult for nitrifiers to remain active at a high biofilm thickness. To be specific, the microbial distribution in different floc layers affected the mass transfer and nitrifier kinetics of AOB and NOB (Manser et al., 2005). Both groups are regarded as prevailing nitrifier with high substrate affinities (Gieseke et al., 2001), KN,AOB (0.10–0.28 mg/L) and KN,NOB (0.17–0.31 mg/L) in this study were similar with the conclusions of Manser et al.(KN,AOB: 0.13–0.14 mg/L; KN,NOB: 0.17–0.28 mg/L) (Manser et al., 2005), but much lower than Stehr et al.(KN,AOB:0.42–1.05 mg/L) (Stehr et al.,

2010). Additionally, the community composition revealed that NOB was dominated by Nirospira (21.71%) than AOB (17.88%) in a nitrification SBR (Wu et al., 2017b), which demonstrated that the fewer bacteria enrichment had a stronger impact on the KO,AOB (1.15 mg/L) than KO,NOB (0.45 mg/L). In the three-stage NMBBR, NOB (including Nitrobacteria and Nirospira, 6.37–15.21%) was more enriched than AOB (4.07–11.89%), but this resulted in higher KO,NOB (0.22–1.10 mg/L) than KO,AOB (0.15–0.76 mg/L) at a high NOB percentage condition (Table 5). It should be emphasized that NO− 2 -N is normally produced within the flocs, and NOB due to a higher KO,NOB are more sensitive to DO than AOB. Therefore, it is widely used as a control strategy to wash-out NOB to realize short-cut nitrification by DO limitation technique. The kinetic analysis was carried out with the following functions: (i) to obtain the maximum specific growth rate (μN,AOB, μO,AOB and μN, NOB, μO,NOB) for superior nitrification performance, (ii) to investigate the effect of operation conditions (e.g. DO, temperature, biomass, − NH+ 4 -N, NO2 -N) on the bioactivity of AOB and NOB, so as to determine the optimum growth conditions, (iii) to suppress or eliminate NOB growth for short-cut nitrification through the affinity constants (KN, AOB, KN,NOB, KO,AOB and KO,NOB), and (iv) to develop reliable models for the design and optimization of MBBR systems by using the stoichiometry and kinetic parameters. 3.5. MBBR optimization for the design and operation MBBR process has many considerable advantages over traditional activated sludge treatment: excellent treatment of water quality, small footprint, lower energy consumption, and reasonable cost

Table 5 Estimation of half-saturation constants for AOB and NOB. Process

Denitrification SBR Nitrification SBR MBR CASa NMBBR(N1) NMBBR(N2) NMBBR(N3) a b

Floc size (μm)

50 280 90 733 155 108 70

Nitrifier percentage(%) AOB

0.68 17.88 / / 4.07 7.92 11.89

NOB Nitrobacteria

Nitrospira

/ / / / 0.67 0.49 1.01

1.12 21.71 / / 5.70 10.18 14.20

Conventional activated sludge. Data of biofilm thickness (floc size) and percentages of AOB and NOB on day 110.

KN,AOB (mg/L)

KN,NOB (mg/L)

KO,AOB (mg/L)

KO,NOB (mg/L)

/ / 0.13 0.14 0.28 0.16 0.10

/ / 0.17 0.28 0.31 0.20 0.17

0.19 1.15 0.18 0.79 0.76 0.59 0.15

0.26 0.45 0.13 0.47 1.10 0.86 0.22

Country

References

China

Wu et al.

Switzerland

Manser et al.

China

This studyb

10

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

Fig. 6. Fitting curves of half-saturation constants based on the Monod equation (a:KN,AOB; b:KN,NOB; c:KO,AOB; d:KO,NOB).

(Sutherland, 2010). It also has the potential to upgrade and retrofit the existing WWTPs that are facing increasing treatment demands, especially in the case of low temperature regions, high-strength ammonia nitrogen sewage (e.g. coking, synthetic ammonia or industrial wastewater, landfill leachate and domestic wastewater (Peng et al., 2018)) and limited land space conditions. In addition to the above superiorities, the three-stage NMBBR in this study is more favorable for good shock loading resistance, easy operation, low aeration consumption, and efficient nitrifier enrichment. Particularly, the main contributions of this research are as follows. Firstly, natural biofilm formation is feasible for wastewater streams containing a high TN level but a relatively low COD concentration (Fig. 2). Secondly, the multistage series mode is conducive to nitrifier enrichment by overcoming the defects of negative organic effect and low growth rate (Fig. 4g and h). Thirdly, operation parameters play significant roles in influencing the biological characteristics and microscopic behaviors of AOB and NOB (Fig. 5 and Table 4). Eventually, the Monod equation proved as a useful tool to determine the kinetic parameters could be extended to other microorganisms using different substrates as carbon or energy source (Fig. 6 and Table 5). Nevertheless, there are still many aspects to be fully addressed. For example, the mechanisms of NOB inhibition, microbial compositions of the dominant HBs, energy distribution and competition of AOB and NOB during growth and maintenance processes, etc. In this regard, many researchers put more interests in MBBR optimization, which is widely used for wastewater treatment. Based on this study of the three-stage NMBBR, it's expected to provide the basic information required for the MBBR design and operation.

4. Conclusions A three-stage NMBBR was operated for 120 d to obtain enriched nitrifying bacteria treating domestic wastewater of low C/N ratio. The larger specific surface area resulted in the higher biological growth rate and compact biofilm structure proved by SEM figures, and the real-time control strategy of DO and pH accelerated the nitrification startup. FISH and qPCR results both showed that the relative populations of AOB and NOB were simultaneously improved accompanying with partial nitrite accumulated, but Nitrobacteria was negligible while Nitrospira was the dominant NOB. Moreover, the performance was contrasted by nitrification kinetics with different floc sizes and microbial community compositions. Accordingly, the implementation of short-cut nitrification by DO limitation technique was discussed for the practical engineering operation. Combining with contributions and limitations of the three-stage NMBBR, it's expected to provide the basic reference for the MBBR design and operation. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments This research was financially supported by the Natural Science Foundation of China (Grants No. 51808482 and No. 51478410), Natural Science Foundation of Jiangsu Province (Grants No. BK20170506),

M. Zhang et al. / Science of the Total Environment 697 (2019) 134101

Postdoctoral Science Foundation (Grants No. 2018M632392), and Jiangsu Open Research Project of Water Environmental Protection Technology and Equipment Engineering Laboratory (Grants No. W1803). References Ahmed, W., Tian, X., Delatolla, R., 2019. Nitrifying moving bed biofilm reactor: performance at low temperatures and response to cold-shock. Chemosphere 229, 295–302. Association, A.P.H., 1995. Water environment federation. Standard Methods for the Examination of Water and Wastewater, p. 19. Bassin, J.P., Kleerebezem, R., Dezotti, M., van Loosdrecht, M.C., 2012. Simultaneous nitrogen and phosphate removal in aerobic granular sludge reactors operated at different temperatures. Water Res. 46 (12), 3805–3816. Chen, W., D, W., Ning-wei, Z., Xiao-ying, Z., Ji, L., Peng-cheng, Y., 2010. Enhanced Ammonia removal and nitrification rate of A/A/O-MBR combined process. J. Civ. Architect. Environ. Eng. 32 (4), 90–95. Cho, K.H., Kim, J.-O., Kang, S., Park, H., Kim, S., Kim, Y.M., 2014. Achieving enhanced nitrification in communities of nitrifying bacteria in full-scale wastewater treatment plants via optimal temperature and pH. Sep. Purif. Technol. 132, 697–703. Ge, S.J., Wang, S.Y., Yang, X., Qiu, S., Li, B.K., Peng, Y.Z., 2015. Detection of nitrifiers and evaluation of partial nitrification for wastewater treatment: a review. Chemosphere 140, 85–98. Gieseke, A., Purkhold, U., Wagner, M., Amann, R., Schramm, A., 2001. Community structure and activity dynamics of nitrifying bacteria in a phosphate-removing biofilm. Appl.environ.microbiol 67 (3), 1351–1362. Gong, L., Jun, L., Yang, Q., Wang, S., Ma, B., Peng, Y., 2012. Biomass characteristics and simultaneous nitrification–denitrification under long sludge retention time in an integrated reactor treating rural domestic sewage. Bioresour. Technol. 119, 277–284. Graham, D.W., Knapp, C.W., Van Vleck, E.S., Bloor, K., Lane, T.B., Graham, C.E., 2007. Experimental demonstration of chaotic instability in biological nitrification. ISME J. 1 (5), 385–393. Gu, S.B., Wang, S.Y., Yang, Q., Yang, P., Peng, Y.Z., 2012. Start up partial nitrification at low temperature with a real-time control strategy based on blower frequency and pH. Bioresour. Technol. 112, 34–41. Gu, Q., Sun, T., Wu, G., Li, M., Qiu, W., 2014. Influence of carrier filling ratio on the performance of moving bed biofilm reactor in treating coking wastewater. Bioresour. Technol. 166, 72–78. Henze, M., Gujer, W., Mino, T., Van Loosdrecht, M., 2000. Activated Sludge Models ASM1, ASM2, ASM2d and ASM3: Scientific and Technical Report No. 9. IWA Task Group on Mathematical Modelling for Design and Operation of Biological Wastewater Treatment. IWA Publishing, London. Hernandez-Ramirez, A.G., Martinez-Tavera, E., Rodriguez-Espinosa, P.F., Mendoza-Pérez, J.A., Tabla-Hernandez, J., Escobedo-Urías, D.C., Jonathan, M.P., Sujitha, S.B., 2019. Detection, provenance and associated environmental risks of water quality pollutants during anomaly events in River Atoyac, Central Mexico: a real-time monitoring approach. Sci. Total Environ. 669, 1019–1032. Hu, X.B., Xu, K., Wang, Z., Ding, L.L., Ren, H.Q., 2013. Characteristics of biofilm attaching to carriers in moving bed biofilm reactor used to treat vitamin C wastewater. Scanning 35 (5), 283–291. Huang, H., Ren, H., Ding, L., Geng, J., Xu, K., Zhang, Y., 2014. Aging biofilm from a full-scale moving bed biofilm reactor: characterization and enzymatic treatment study. Bioresour. Technol. 154 (2), 122–130. Iacopozzi, I., Innocenti, V., Marsili-Libelli, S., Giusti, E., 2007. A modified Activated Sludge Model No. 3 (ASM3) with two-step nitrification-denitrification. Environ. Model Softw. 22 (6), 847–861. Joo, H.S., Hirai, M., Shoda, M., 2005. Nitrification and denitrification in high-strength ammonium by Alcaligenes faecalis. Biotechnol. Lett. 27 (11), 773–778. Kim, Y.M., Cho, H.U., Lee, D.S., Park, D., Park, J.M., 2011. Influence of operational parameters on nitrogen removal efficiency and microbial communities in a full-scale activated sludge process. Water Res. 45 (17), 5785–5795. Kim, Y.M., Park, H., Cho, K.H., Park, J.M., 2013. Long term assessment of factors affecting nitrifying bacteria communities and N-removal in a full-scale biological process treating high strength hazardous wastewater. Bioresour. Technol. 134C (2), 180–189. Kindaichi, T., Ito, T., Okabe, S., 2004. Ecophysiological interaction between nitrifying bacteria and heterotrophic bacteria in autotrophic nitrifying biofilms as determined by microautoradiography-fluorescence in situ hybridization. Appl. Environ. Microbiol. 70 (3), 1641. Kowalski, M.S., Devlin, T.R., di Biase, A., Oleszkiewicz, J.A., 2019. Controlling cold temperature partial nitritation in moving bed biofilm reactor. Chemosphere 227, 216–224. Lei, J., Huaiyang, Z., Xiaotong, P., Zhonghao, D., 2009. The use of microscopy techniques to analyze microbial biofilm of the bio-oxidized chalcopyrite surface. Miner. Eng. 22 (1), 37–42. Liu, X., Chowdhury, M.M.I., Zaman, M., Kim, M., Nakhla, G., 2019. Acute and chronic toxicity of nickel to nitrifiers at different temperatures. J. Environ. Sci. 82, 169–178. Manser, R., Gujer, W., Siegrist, H., 2005. Consequences of mass transfer effects on the inetics of nitrifiers. Water Res. 39 (19), 4633–4642. McCutcheon, J., Southam, G., 2018. Advanced biofilm staining techniques for TEM and SEM in geomicrobiology: implications for visualizing EPS architecture, mineral nucleation, and microfossil generation. Chem. Geol. 498, 115–127. Miao, Y., Zhang, L., Yang, Y., Peng, Y., Li, B., Wang, S., Zhang, Q., 2016. Start-up of singlestage partial nitrification-anammox process treating low-strength swage and its restoration from nitrate accumulation. Bioresour. Technol. 218, 771–779.

11

Oleszkiewicz, J.A., Berquist, S.A., 1988. Low temperature nitrogen removal in sequencing batch reactors. Water Res. 22 (9), 1163–1171. Park, S., Bae, W., 2009. Modeling kinetics of ammonium oxidation and nitrite oxidation under simultaneous inhibition by free ammonia and free nitrous acid. Process Biochem. 44 (6), 631–640. Peng, Y.Z., Gao, S.Y., Wang, S.Y., Bai, L., 2007. Partial nitrification from domestic wastewater by aeration control at ambient temperature. Chin. J. Chem. Eng. 15 (1), 115–121. Peng, P., Huang, H., Ren, H., Ma, H., Lin, Y., Geng, J., Xu, K., Zhang, Y., Ding, L., 2018. Exogenous N-acyl homoserine lactones facilitate microbial adhesion of high ammonia nitrogen wastewater on biocarrier surfaces. Sci. Total Environ. 624, 1013–1022. Pöpel, H.J., Fischer, A., 1998. Combined influence of temperature and process loading on the effluent concentration of biological treatment. Water Sci. Technol. 38 (8), 129–136. Rusten, B., Eikebrokk, B., Ulgenes, Y., Lygren, E., 2006. Design and operations of the Kaldnes moving bed biofilm reactors. Aquac. Eng. 34 (3), 322–331. Salvetti, R., Azzellino, A., Canziani, R., Bonomo, L., 2006. Effects of temperature on tertiary nitrification in moving-bed biofilm reactors. Water Res. 40 (15), 2981–2993. Sarioglu, M., Sayi-Ucar, N., Cokgor, E., Orhon, D., van Loosdrecht, M.C.M., Insel, G., 2017. Dynamic modeling of nutrient removal by a MBR operated at elevated temperatures. Water Res. 123, 420–428. Seifi, M., Fazaelipoor, M.H., 2012. Modeling simultaneous nitrification and denitrification (SND) in a fluidized bed biofilm reactor. Appl. Math. Model. 36 (11), 5603–5613. Simões, M., Simões, L.C., Vieira, M.J., 2010. A review of current and emergent biofilm control strategies. LWT Food Sci. Technol. 43 (4), 573–583. Stehr, G., Böttcher, B., Dittberner, P., Rath, G., Koops, H.P., 2010. The ammonia-oxidizing nitrifying population of the River Elbe estuary. FEMS Microbiol. Ecol. 17 (3), 177–186. Steuernagel, L., de Léon Gallegos, E.L., Azizan, A., Dampmann, A.-K., Azari, M., Denecke, M., 2018. Availability of carbon sources on the ratio of nitrifying microbial biomass in an industrial activated sludge. Int. Biodeterior. Biodegradation 129, 133–140. Sutherland, K., 2010. The rise of membrane bioreactors. Filtr. Sep. 47 (5), 14–16. Wells, G.F., Park, H.-D., Eggleston, B., Francis, C.A., Criddle, C.S., 2011. Fine-scale bacterial community dynamics and the taxa–time relationship within a full-scale activated sludge bioreactor. Water Res. 45 (17), 5476–5488. Wu, J., Yong, L., Miao, Z., 2017a. Activated sludge floc morphology and nitrifier enrichment can explain the conflicting reports on the oxygen half-saturation index for ammonium oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB): the anomaly of oxygen half-saturation index for AO. J. Chem. Technol. Biotechnol. 92. Wu, J., Yong, L., Miao, Z., Li, Y., 2017b. Effect of nitrifiers enrichment and diffusion on their oxygen half-saturation value measurements. Biochem. Eng. J. 123, 110–116. Xiaoguang, L., Mingu, K., George, N., 2018. Performance and kinetics of nitrification of low ammonia wastewater at low temperature. Water Environ. Res. 90 (6), 498–509. Yang, X., Peng, Y., Ren, N., Guo, J., Tang, X., Song, J., 2013. Nutrient removal performance and microbial community structure in an EBPR system under the limited filamentous bulking state. Bioresour. Technol. 144, 86–93. Yang, L., Wang, X.-H., Cui, S., Ren, Y.-X., Yu, J., Chen, N., Xiao, Q., Guo, L.-K., Wang, R.-H., 2019. Simultaneous removal of nitrogen and phosphorous by heterotrophic nitrification-aerobic denitrification of a metal resistant bacterium Pseudomonas putida strain NP5. Bioresour. Technol. 285, 121360. Young, B., Delatolla, R., Kennedy, K., Laflamme, E., Stintzi, A., 2017. Low temperature MBBR nitrification: microbiome analysis. Water Res. 111, 224–233. Zeng, W., Bai, X.L., Guo, Y., Li, N., Peng, Y.Z., 2017. Interaction of "Candidatus Accumulibacter" and nitrifying bacteria to achieve energy-efficient denitrifying phosphorus removal via nitrite pathway from sewage. Enzym. Microb. Technol. 105, 1–8. Zhang, Z., Lin, R., 2000. Drainage Works. China Building Industry Press, Beijing, pp. 30–32. Zhang, S., Wang, Y., He, W., Wu, M., Xing, M., Yang, J., Gao, N., Yin, D., 2013a. Responses of biofilm characteristics to variations in temperature and NH4+-N loading in a moving-bed biofilm reactor treating micro-polluted raw water. Bioresour. Technol. 131, 365–373. Zhang, S., Wang, Y., He, W., Xing, M., Wu, M., Yang, J., Gao, N., Sheng, G., Yin, D., Liu, S., 2013b. Linking nitrifying biofilm characteristics and nitrification performance in moving-bed biofilm reactors for polluted raw water pretreatment. Bioresour. Technol. 146, 416–425. Zhang, S., Wang, Y., He, W., Wu, M., Xing, M., Yang, J., Gao, N., Pan, M., 2014. Impacts of temperature and nitrifying community on nitrification kinetics in a moving-bed biofilm reactor treating polluted raw water. Chem. Eng. J. 236, 242–250. Zhang, M., Peng, Y., Wang, C., Wang, C., Zhao, W., Zeng, W., 2016a. Optimization denitrifying phosphorus removal at different hydraulic retention times in a novel anaerobic anoxic oxic-biological contact oxidation process. Biochem. Eng. J. 106, 26–36. Zhang, M., Wang, C., Peng, Y., Wang, S., Jia, F., Zeng, W., 2016b. Organic substrate transformation and sludge characteristics in the integrated anaerobic anoxic oxic–biological contact oxidation (A2/O–BCO) system treating wastewater with low carbon/nitrogen ratio. Chem. Eng. J. 283, 47–57. Zhang, J., Zhang, Q., Li, X., Miao, Y., Sun, Y., Zhang, M., Peng, Y., 2017. Rapid start-up of partial nitritation and simultaneously phosphorus removal (PNSPR) granular sludge reactor treating low-strength domestic sewage. Bioresour. Technol. 243, 660–666. Zheng, X., Zhou, W.N., Wan, R., Luo, J.Y., Su, Y.L., Huang, H.N., Chen, Y.G., 2018. Increasing municipal wastewater BNR by using the preferred carbon source derived from kitchen wastewater to enhance phosphorus uptake and short-cut nitrificationdenitrification. Chem. Eng. J. 344, 556–564. Zhu, S., Chen, S., 2002. The impact of temperature on nitrification rate in fixed film biofilters. Aquac. Eng. 26 (4), 221–237.