- Email: [email protected]
Organized packaging of kinetoplast DNA networks
Cell, Vol. 47, 537443,
November 21, 1986, Copyright 0 1986 by Cell Press
Organized Packaging of Kinetoplast DNA Networks
kin E. Silver, Al F. Torri, and Stephen Department of Biochemistry University of Alabama at Birmingham Schools of Medicine and Dentistry Birmingham, Alabama 35294
L. Hajduk
Summary The kinetoplast DNA (kDNA) of Trypanosoma equiperdum is organized as a complex structure of catenated circular DNA molecules. The major component of the kDNA network is the one kilobase minicircle that is present at about 10,000 copies per network. We have developed two assays to examine the structure of kDNA networks compacted in vitro with spermidine. Our results suggest that minicircles are arranged into a regular structure with an exposed domain which is DNAase I- and restriction-sensitive and a protected domain which is resistant to restriction endonucleases and DNAase I. This regularly packaged structure is dependent upon spermidine compaction and the circularity of the kDNA, but does not require supercoiled minicircles or catenated networks.
The kinetoplast DNA of trypanosomes displays several features that make it unique among mitochondrial DNAs: one, kDNA represents lo%-30% of the total cellular DNA; two, the major component of the kinetoplast is a small circular molecule, the minicircle, of approximately l-2.5 kb which
may not be transcribed;
other component
of the
three,
transcription
of the
kDNA, the maxicircle, is developmentally regulated; four, a portion of the minicircles is in a bent helical DNA conformation; and five, the kDNA is organized as a complex catenated structure of 5,000-10,000 minicircles and 50-100 maxicircles (Englund et al., 1982; Stuart, 1963; Borst and Hoeijmakers, 1979; Marini et al., 1982; Hoeijmakers et al., 1981). The maxicircle encodes several proteins and RNAs that are essential for electron transport and oxidative phosphorylation in the mitochondrion (Benne et al., 1983; Feagin and Stuart, 1985; Hensgens et al., 1984; de la Cruz et al., 1984). The minicircles do not appear to have a conventional DNA coding function, which leads to the speculation that the primary role of minicircles may be structural and the network may act as a scaffolding for segregation of the maxicircles (Borst and Hoeijmakers, 1979). The function of sequence directed bending of the minicircle DNA is also unknown (Marini et al., 1982). Recent studies, however, have suggested that in one species of trypanoend in the minicircle sequence is associated with the origin of minicircle replication (Ntambi and Englund, 1984). Bent DNA sequences have been tentatively jdentified in other organisms (Leong et al., 1985; Zahn and Blattner, 1985) and appear to be associated with transcrip-
tion promoters, replication origins, and sites of recombination. Electron microscopy of trypanosome mitoc~ondria suggests that the kDNA network is highly organized in the cell. The DNA is aligned as a regular stack of fibers within the mitochondrion at the base of the flagellum (Simpson, 1972). The appearance of purified kDNA networks is very different. KDNA networks purified and spread for electron microscopy are organized as a loose mass of catenated circles showing little organization. As a first step toward understanding the function of the kDNA network in trypanosomes, we have developed two biochemical assays to study the organization of spermidine compacted kDNA networks. The results of these studies suggest that the kDNA of the bloodstream parasite Trypanosoma equiperdum is packaged, in vitro, into a regular structure that has two distinct domains. Here we also present evidence that the bent helical region of each minicircle is on the surface of the compacted kDNA network and that the organized packaging is dependent upon the circularity of the minicircle corn onent of the kDNA network.
Results In Vitro Compaction The kDNA network exists as a highly condensed structure in the mitochondrion of trypanosomes (Simpson, 1972). The purpose of our initial experiments was to determine whether kDNA networks could be compacted in vitro. Krasnow and Cozzarelli (1982) have used sedimentation to analyze the aggregation of plasmid DNA with spermidine. Purified kDNA networks from trypanosomes have sedimentation coefficients of about 55OOS,making it difficult to analyze the compaction of kDNA by sedimentation. Compaction can, however, be assayed by fluorescence microscopy in the presence of ethidium bromide (5 pg/ml). Figure 1 shows the appearance of T. equiperdum kDNA networks after incubation with increasing concentrations of spermidine (3 mM to 6 mM). The network size sharply decreased (10x) as spermidine concentrations increased from 3.6 to 4.0 mM. (These results are consistent with unpublished studies by K. Ryan and t? b Englund.) These studies cleariy demonstrate that kD compacted in vitro with spermidine. T. equiperdum Minicircle Sequence A common feature of trypanosomes, which has hindered the study of kDNA organization, is the sequence heterogeneity of the minicircles in a kDNA network (Englund et al., 1982). In order to study the organization of compacted kDNA networks, we have used kDNA isolated from T. equiperdum since this species of trypanosome has nearly homogeneous minicircles (Frasch et al., 1980; Riou and Barrois, 1979). A partial restriction map of the T. equiperdum minicircie is presented in Figure 2A. The restriction sites on this minicircle differ from those predicted from the
Cell 538
03
4
5
6
Sperr#ne Figure 1. Compaction
Analysis of T equiperdum
kDNA
Assay conditions were as described in Experimental Procedures. kDNA networks (0.1 Kg) were incubated at 25°C for 20 min in compaction buffer in the absence of spermidine (a) or with 3.4 mM (b), 3.8 mM (c), and 6.0 mM (d) spermidine. Ethidium bromide was added to a final concentration of 0.1 uglml. Photographs of fluorescent kDNA networks were taken with a Nikon epifluorescence microscope on Kodak ektachrome 200 film. The compaction reactions were quantitated by measurement of the area of the fluorescent networks. Compaction occurred at between 3.8 mM to 4.0 mM spermidine when kDNA networks were purified as described in Experimental Procedures. kDNA purified by less rigorous protocols could require spermidine concentration as high as 5.0 mM for complete compaction.
for the minicircle from another T equiperdum isolate (Barrois et al., 1982). To define the substrate used in subsequent experiments we determined the complete sequence for the minicircle of T. equiperdum (ATCC 30019) (Figure 2B). There is a major region of homology (between bases 290 and 425) with the other T equiperdum minicircle sequence. This homology region includes a portion of the minicircle bend and a 165 bp open reading frame (ORF) adjacent to the bend. The position of the bent helical region of the minicircle is indicated and is based upon analysis of the nucleotide sequence for runs of adenine nucleotides at intervals of approximately 10 bp and anomalous mobility of restriction endonuclease fragments on polyacrylamide gels (data not shown).
41”f I GAGTCAGTCAAATTAGAI:AT~AC,TTATTGTACTTATATMTTITT/WTCTATCTATT
60 120
ATTTATTTCTTTTATAcGAGGACAGGGAATAAG.4GGGAAAATTCATTGGAGATACT'AGGG 180 TGAGAGAGTTAA'AGAGTAATTGTGGTTGGGAGTATGGAGT.4GTTAT~TTATATTGGTG 240 AA4AAGGAAGGGGT4AAAAGTCGTGTAGTAGAATAGAGGTTGATAGGIWTAAGTGATGCA 3!30 ATTTGTGGAAGTAGTTGGTA.~~TCTATAG.~ATCGTT~4TTGGCTAAAAATCGGGC --__ 360 TGAAAkA4CGG.M.ATCT$4TGGGCGTGCAGATTTCACCATACACAAAACATCGTGC~ ~_
-
Lu!l6 .L@ TTTCGGGGGTTTTTTAGGTCCG4GGTACTTCGAAAGGGGTGGT
420
u. .!lkL. TTTTCTCAGGGTTTTGAGGCAATTCGCACTTTTCTTGGGGTTCTCAGTGCACTTTAATTT
480
sequence
Restriction Analysis of Compacted kDNA Networks Fluorescence microscopy studies show that kDNA networks are compacted at 4.0 mM to 4.2 mM spermidine. To determine the nature of the compacted networks, we treated kDNA with increasing concentrations of spermidine and tested these structures for susceptibility to cleavage by restriction endonucleases. Figure 3A shows the results of a double digest of the kDNA networks with Cfol and Hinfl. The digests of uncompacted kDNA, either not treated with spermidine or treated with spermidine concentrations less than 4.0 mM, yield two major restriction fragments of 421 bp and 584 bp. Cleavage also results in a 1005 bp fragment that is probably the result of a small number of minicircles lacking the Cfol or Hinfl sites. As the spermidine concentration increases above 4.0 mM, a single 1005 bp fragment is the major product (Figure 3A). Single digests with Hinfl (Figure 38) and Cfol (data not
540
CfOl 600 -. 4TATATAT‘AATTGTAC4TAT.4CCA.4CAAACAGAATAACTiWTGCGCAGTGATGATGAT4G 660 TTAATTAATTATATAT~GTTCTAATCTAT~TATTATTATATTTAATTGAGTGGCGTGA \IboI GAATAAGGTGATATTTCAATCCTAAACAAAAGGAATGATGTAATAGATAGAACTAATGAG
720 780
TAGAGAATTT~LZTTATTATTATTGTGTATATTG~TTACATATTTATTATTTTAGTTTAG 900 TATATAGGACGCAGAAATAGCAGT.4TAAAATAAGGATAGAGTTTATAGGTAG~GT .Ybol 9617 -' TTGAAAGTTGGATCAAGTGTCAT~~TGAGGGAAGTAAAGTAAAGT~ATATAATAGATAGMACAT 1005 AATAATAATTCTAGTTTGGTAGTATATACATATCAACAACG
Figure 2. Nucleotide
Sequence
of the T. equiperdum
Minicircle
(A) A circular restriction map of the T. equiperdum minicircle. The bent helical region is indicated. The cleavage sites for Hinfl (H), Cfot (C), Mbol (M), and Taql (T), Sau96 (S), and Ddel (D) are indicated. (B) The complete nucleotide sequence of the T. equiperdum minicircie. The numbering starts at the Hinfl site. The underlined sequence indicates short, periodic runs of adenines which form a bent helix. An open reading frame of 165 nucleotides begins at position 320 and is boxed. The positions of the Taql, Cfol, Mbol, Hinfi, Sau96, and Ddel restriction sites are also indicated.
shown) demonstrate that the 1005 bp product in double digests (Figure 3A) at spermidine concentrations above 4.0 mM is probably the result of Cfol cleavage. Hinfl does not digest spermidine-compacted kDNA while Cfol digestion of kDNA is unaffected by spermidine concentrations up to 8.0 mM (data not shown). To confirm that the product of the Hinfl-Cfol double digest of compacted kDNA was
Kinetoplast 539
DNA Packaging
Hinfl. The cleavage of the linearized substrate with Hinfl was unaffected by spermidine concentrations of 5.6 mM. These results show that the protection of the Hinfl site in compacted kDNA requires a circular DNA substrate and that compacted, linear kDNA substrate is cleaved by Hinfl even in the presence of high concentrations of spermidine. The linearized kDNA is condensed at 4.0 mM spermidine as judged by fluorescence microscopy. Again, this is in agreement with the spermidine concentration required for condensation of plasmid DNA as measured by sedimentation (Krasnow and Cozzarelli, 1982). Additional restriction endonucleases have been tested for their ability to cleave compacted networks (data not shown). Enzymes which cleave in the general region of the Cfol site, Ddel and Sau96, are active on spermidine-compacted networks. Digestion of spermidine-compacted kDNA with Mbol, which has cleavage sites 96 and 251 bp from the Hinfl site, results in a partial pattern of digestion. Both of the Mbol sites are partially protected from digestion in the compacted preparations. with
Figure 3. Restriction Analysis of SpermidineTreated and Plasmid DNA
kDNA Networks
Minicircle restriction fragments were separated by electrophoresis on 2% agarose gels, stained with ethidium bromide, and photographed. The arrow indicates the position of linearized, 1005 bp minicircle. Undigested kDNA networks do not enter the gels. The numbers at left indicate the size of the minicircle restriction fragments in base pairs. (A) Electrophoretic analysis of double digests of kDNA. Samples were incubated at the indicated spermidine concentrations and digested with Cfol and Hinfl for 2 hr at 37%. (B) Etectrophoretic analysis of Hinfl-digested kDNA. Samples were incubated at the indicated spermidine concentrations and digested with Hinfl. (C) The 1005 bp linearized minicircle from a double digest with Cfol and Hinfl in the presence of 5 mM spermidine (lane 1). The 1005 bp fragment was purified and digested with Taql in the absence of spermidine (lane 2). (D) Electrophoretic analysis of kDNA digested with Cfol prior to treatment with spermidine. Following spermidine treatment the kDNA was digested with Hinfl.
only Cfol cleaved minicircles, we purified the 1005 bp product of the double digest in the presence of 5 mM spermidine from agarose gels and mapped the cleavage site by digestion with Taql (Figure 3C). The Taql digest produces 810 bp and 195 bp fragments that are consistent with the first cleavage, in the presence of spermidine, being at the Cfol site on the minicircle. The lack of cleavage of kDNA with Hinfl was not due to the sensitivity of the enzyme to spermidine since the digestion of plasmid DNA with Hinfl is unaffected by spermidine concentrations up to 5.6 mM (data not shown). At this spermidine concentration the plasmid DNA is compacted into a rapidly sedimenting structure (Krasnow and Cozzarelli, 1982). We have also used the restriction assay to study the compaction of linearized kDNA (Figure 30). KDNA was digested with Cfol to linearize the minicircles, then incubated with spermidine (4.0 mM to 5.6 mfvl) and digested
DNAase Nicking of Compacted kDNA Networks To confirm the ordered arrangement of the spermidinecompacted kDNA networks we treated kDNA with pancreatic DNAase I together with DNA polymerase I and 32P-NTPs and determined the distribution of label in minicircle restriction fragments fractionate amide gels (Figure 4). The distribution of label in restriction fragments from compacted and uncompacted networks was different. In digests with Taql, Cfol, Hinfl, and Mbol the 195 bp Taql-Cfol fragment was preferentially labeled in the spermidine-compacted networks while minicircle fragments from uncompacted kDNA networks show nearly uniform labeling (Figure 4, lanes 1 and 2). Quantitation of the labeling of the spermidine-compacted kDNA shows that 62% of the total counts recovered were in the 195 bp Taql-Cfol minicircle fragment, which represents only 19% of the minicircle mass. In uncompacted kDNA networks 29% of the total counts incorporated were in the 195 bp fragment. Labeling of another portion of the minicircle, the 389 bp Hinfl-Taql fragment, also differs in t compacted and the uncompacted kDNA networks. In nick translations of uncompacted kDNA networks, 35% of the total counts incorporated were in the 389 bp fragment, which is in good agreement with this fragment representing 39% of the mass of the minicircle. In spermidinecompacted networks the 389 bp fragment is poorly labeled, with 18% of the counts incorporated. In control experiments we have studied the labeling of uncompacted and spermidine-compacted plasmid DNA. Autoradiography of restriction fragments from both compacted and uncompacted plasmid DNA showed uniform labeling (data not shown). In an attempt to more precisely map the site of DNAase I nicking, the elongation activity of polymerase I was limited by carrying out the nick translation reactions 4X in the absence of one nucleotide. Under these conditions, the incorporation of radioactivity is almost exclusively restricted to the 195 bp Taql-Cfol fragment (Figure 4, lane 3).
Cell 540
by polymerase I. These results agree with those in Figure 3D in which Cfol linearized minicircles compacted into a structure that was sensitive to digestion wi possible explanation for the preferential la 195 bp Cfol-Taql fragment would be the single-stranded regions (gaps) in this portion of the molecule. The poor labeling of the 195 bp fragments in reactions using linearized minicircles as substrate demonstrates that gaps do not contribute to the labeling. The preferential labeling of the 195 bp fragment in reactions containing the decatenated and relaxed substrates suggests that neither supercoiling nor catenation are required for ordered packaging of minicircles. Discussion
96Figure 4. Nick Translation Assay of kDNA Compaction of Substrate Conformation on Compaction
and the Effect
Uncompacted (lane 1) and spermidine-compacted (lane 2) kDNA was nick translated for 20 set as described in Experimental Procedures. Following nick translation the DNA was separated from unincorporated s*P-NTPs and digested with Hinfl, Cfol, Mbol, and Taqt. Nick translation of spermidine-compacted kDNA under conditions that limit polymerase I elongation (lane 3). Different conformations of the kDNA substrate were derived by treatment with topoisomerase I to relax the DNA (lane 4) topoisomerase II to decatenate the DNA (lane 5) or the restriction enzymes Mb01 or Hinfl to linearize the DNA (lanes 6 and 7). These samples were then compacted with 6 mM spermidine, nick translated for 20 see, digested with the restriction enzymes Taql, Cfol, Hinfl, and Mbol and analyzed on 6% polyacrylamide gels.
These results suggest that spermidine compaction of kDNA networks produces a domain within the minicircles which is preferentially labeled during nick translation with DNAase I. This DNAase I hypersensitive region is approximately 180° from the protected Hinfl site identified in Figure 3. Effect of kDNA Conformation on Packaging If the kDNA networks are organized into regular structures upon compaction with spermidine, these structures may be influenced by the conformation of the DNA substrate. To test this possibility, we treated kDNA with calf thymus topoisomerase I to produce relaxed substrate, with calf thymus topoisomerase II to produce monomeric relaxed minicircles, and with the restriction enzymes Hinfl or Mbol to produce linearized substrate. The enzymatically modified substrates were compacted with spermidine and the effect of the various treatments on the ordered packaging of the kDNA was tested (Figure 4). Relaxed, compacted networks (lane 4) and decatenated, compacted monomeric minicircles (lane 5) were preferentially labeled in the 195 bp fragment. Linearized, compacted minicircles (lanes 8 and 7) did not show preferential labeling of the 195 bp fragment. However, the single-stranded cohesive ends of the restriction fragments were efficiently labeled
The kDNA network of trypanosomes is ture in that it is composed of thousands far DNA molecules. The function of the network structure has been the subject of much conjecture, yet little is known about the organization of the network in the native compacted state. In this paper we present evidence that the kDNA network is packaged, in the presence of spermidine, into an ordered structure in vitro. Our experiments show that the ordered packaging requires the kDNA to be in a circular conformation but that the packaging is independent of supercoiling and catenation of minicircles. The compaction of kDNA occurs at the same spermidine concentrations as the aggregation of plasmid DNA (Krasnow and Cozzarelli, 1982). The spermidine-compacted lasmid DNA forms aggregates that are readily digested y restriction endonucleases and uniformly labeled by nick translation with DNAase I and polymerase I. The kDNA, either as a catenated network or as monomeric circles, compacts into a structure that has distinct domains with regard to restriction endonuclease sensitivity and DNAase I nicking. Spermidine-compacted, linear kDNA is not organized as a structure recognized in either our restriction protection assays or the nick translation assays as ordered. The regular packaging of monomeric minicir cles is surprising. However, we have recently described an interesting correlation in the organization of the kDN of Bodo caudatus, a nonparasitic member of the order Kinetoplastidae (Hajduk et al., unpublished results). The kDNA of this organism is organized as a compacted structure in vivo yet is composed of noncatenated circular BNA. It is likely that the organized packaging of the kDNA network is due to an inherent feature of minicircles. The most obvious candidate is the bent helical region of the minicircle (Marini et al., 1982; 1984; Kidane et al., 1984), which is a universal feature of minicircles (Ntambi et al,, 1994). Studies of the Leishmania tarentolae minicircle bend and synthetic oligonucleotide fragments have identified several requirements for sequence-directed DNA bending: one, short runs of three to six adenine nucleotides; two, the regular phasing of these runs of adenines at lo-11 bp intervals, approximately in phase with the turns of the DNA helix; and three, a minimum of three phased runs of adenines (Wu and Crothers, 1984; Hagerman, 1986; Koo
Kinetoplast 541
DNA Packaging
9mt / DNA
Figure 5. Schematic
Model of the In Vitro Packaging of kDNA
The bent helical region of the minicircle DNA is indicated by hatching. Supercoiled, catenated minicircles and relaxed monomeric minicircles are depicted in this drawing.
et al., 1986; Diekmann and Wong, 1985; Trifonov, 1985). A portion of the T. equiperdum minicircie sequence, from nucleotides 260 to 315, meets these requirements. Restriction fragments containing this portion of the minicircle also show the anomalous mobilities on polyacrylamide gels which is characteristic of bent DNA (Marini et al., 1982). The bent helical region of the T. equiperdum minicircle is adjacent to the Taql, Ddel, and Sau96 restriction sites in a portion of the minicircle accessible to restriction digestion in the spermidine-compacted networks. In addition, the bend is adjacent to the 195 bp Taql-Cfol fragment which is preferentially labeled in short nick translation experiments. Marini et al. (1982) first postulated that the bend might facilitate and stabilize the regular in situ packaging of the kDNA in trypanosomatids. They proposed that the kDNA network is arranged as a single tier of minicircles organized as a disk-like structure with each DNA molecule aligned parallel to the long axis of the cell. Their model is supported by electron microscopy of the kinetoplast in situ in which the height of the kDNA disk is approximately half the contour length of the minicircles (Delain and Riou, 1969; Simpson and de Silva, 1971). Our in vitro results suggest that the compacted kDNA network is arranged as double tier structure with the bent region of each minicircle directed toward the exterior of the network (Figure 5). In our model the DNA at the interior of the kDNA netork would be densely packed. This might present a rather inhospitable environment for many enzymes or interfere wit!? the accessibility of the kDNA located in this portion of the network to enzymes. As in the previous model, the bent portion of each minicircle would be on the surface of the compacted kDNA network and accessible to enzymes in the mitochondrial matrix. We propose that
the regular packaging of the T. equiperdu directed by the bent helical region of the minicircles. A thorough deletion analysis of the sequences required for the regular packaging of the kDNA is underway. Another interesting feature of our model is the position of the minicircle open reading frame (ORF) in compacted kDNA. The minicircle ORF is immediately downstream of the bent helical region (see Figure 2b). It is located in the portion of the minicircle exposed to cleavage by restriction endonucleases and hypersensitive to nicking with DNAase I in compacted kDNA networks. This portion of the minicircle, on the exterior of the co should be available for transcription. revious studies (Hoeijmakers and Borst, 1978) have failed to detect minicircle transcripts in trypanosomes. suggests that minicircles may have a coding function. Shlomai and Zadok (1984) used minicircle DNA fragments from C. fasciculata to prepare a fusion protein in E. coli. Antibodies against this fusion p the kinetoplast of intact trypan results are suggestive of minicir tification of the sequence encoding the fusion protein and characterization of the protein product have not been reported. The organized structure of the A network in vivo t often suggested may have several functions. The function for the kDNA network is that it forms a scaffolding for the segregation of the maxicircle kDNA (Borst and Hoeijmakers, 1979). for a chromatin is that the network structure substitut matrix and may be involved in the regulation of maxicircle transcription. We have recently shown (~i~~elo~i and Hajduk, unpublished results) that the transcription of some maxicircle genes is developm ted in Trypanosoma brucei. Changes in the the kDNA network during the developmen trypanosomes may be analogous to alterations in chromatin structure seen in eukaryotic nuclei which are as ed with activation of tissue and development specif @s(reviewed by Weintraub, 1985). Experimental
Procedures
Growth of Cells and Isolation of kDNA ~etwo~ka Trypanosoma equiperdum (ATCC 30019) was obtained from Dr. W. S. Cosgrove at the University of Georgia and was stored at -196% in 7.5% dimethyl sulphoxide. Female Wistar rats were infected by intraperitoneal injection of thawed frozen stocks. This strain produces acute infections in rats, killing the host in 4-6 days with maximum parasitemias of log/ml. Trypanosomes were harvested when cell densities reached approximately 5 x lO*/ml and were separated from blood cells by diethylaminoethyl-cellulose chromatography (Lanham, 1966). kDNA networks were prepared as described by Fairlamb et al. (1976). We find that less extensive purification schemes result in kDNA networks which require higher concentrations of spermidine for compaction. We typically recover about 15-25 gg of kDNA from 1 x lOlo cells. kDNA Compaction Assay T. equiperdum kDNA networks were incubated at 25% in 20 $ reactions containing 0.1 w DNA, 25 mM Tris-HCI (pH 7.5), 15 mM KCI, 2 mM MgCl2, 1 mM dithiothreitol (compaction buffer) and spermidine concentrations varying from 3 mM to 6 mM. Following incubation for 20 min, 1 itl of ethidium bromide was added (10 pglml in buffer contain-
Cell 542
ing an equal concentration of spermidine as the sample). Networks were photographed using a Nikon epi-fluorescence microscope at 1000x on Kodak ektachrome 200 film. Compaction was defined as a decrease in the area of the fluorescent networks. The photographic negatives were enlarged ten times and the area of the networks was determined. Cloning and Sequencing of Minicircles Minicircle restriction fragments were generated by double digests with Hinfl-Cfol and Taql-Hinfl and the ends repaired by treatment with Sl nuclease prior to blunt end ligation into pUC 9. Inserts from clones containing the Cfol-Hinfl and Hinfl-Taql minicircle restriction fragments were isolated and labeled by incubation with the Klenow fragment of DNA polymerase I. The minicircle recombinant fragments were aequenced by the chemical degradation method. Degradation products were analyzed on 6% or 20% polyacrylamide/urea gels (Maxam and Gilbert, 1980). Sequences were analyzed (Devereux et al., 1984) with a Vax 11/750 computer operated by the Comprehensive Cancer Center at the University of Alabama at Birmingham. Restriction Cleavage Assay of Compaction The kDNA and plasmid DNAs were incubated in compaction buffer as described above and the compaction verified by fluorescence microscopy. Restriction endonuclease digestion of the DNA was at 37°C in 30 ul reactions. Spermidine (from 10 mM or 50 mM stocks) was added to give final concentrations ranging from 3 mM to 10 mM. Reactions were stopped by the addition of 5 ul of 500 mM EDTA and samples run on 1% agarose gels in 40 mM Tris-HCI, 20 mM sodium acetate, and 1 mM EDNA (pH 7.6) (TAE) at 1 volt/cm for 12-16 hr. The relative mobilities of minicircles to marker fragments were determined from photographs of ethidium-bromide-stained gels. To test the influence of substrate conformation on the restriction cleavage assay, kDNA networks were first cleaved with Cfol, phenol extracted, and compacted as above prior to treatment with the second restriction endonuclease Hinfl. Nick Translation Assay of Compaction Plasmid DNA or kDNA was incubated in compaction buffer and 8 mM spermidine as described above and the compaction of the DNA confirmed by fluorescence microscopy. The nick translation assays were carried out in compaction buffer at 10°C in 50 ul reactions containing 0.3-0.5 ug of DNA and 20 pM of each of three deoxyribonucleotide triphosphates, the other dNTP was @P-labeled with specific activities of 3000 cilmmol. To limit the elongation activity of polymerase I we also carried out the nick translation assay at 4°C in the absence of one of the cold dNTPs. Reactions were initiated by the addition of 0.08 U of DNA polymerase I (Bethesda Research Laboratories) and 9 pg DNAase I (Bethesda Research Laboratories) and stopped after 20 set by the addition of an equal volume of neutralized phenol. Samples were digested with Hinfl, Cfol, and Mbol at 3PC for 2 hr and with Taql for 1 hr at 65OC and electrophoresed on 8% polyacrylamide gels at 1 volt/cm for 12-16 hr. The gels were stained with ethidium bromide to check the completion of the digests, dried, and autoradiographed for 12-48 hr at -7OOC. The incorporation of counts into the minicircle restriction fragments was determined by counting of gel slices dissolved in 30% HaOs, 0.1 M NaOH at 65OC for 48 hr in an LKB scintillation counter. Relaxation and Decatenation of kDNA Restriction endonucleases were purchased from Boehringer Mannheim and Bethesda Research Laboratories. Calf thymus type I and II topoisomerase were gifts from Dr. L. Liu, Johns Hopkins University School of Medicine. Relaxation of supercoiled DNA by type I topoisomerase was performed in 20 pl reaction mixtures containing 1 ug kDNA and 2 ng of the calf thymus type I topoisomerase, IO mM Tris-HCI (pH 7.99, 50 mM KCI, 100 mM NaCI, 0.1 mM MgCIa, 50 uglml bovine serum albumin. Reactions were at 30°C for 30 min and were stopped by the addition of SDS (to O.t”/o) and EDTA (to 10 mM). For decatenation of kDNA the reactions were as above except that ATP was added to a final concentration of 1 mM and the amount of type II topoisomerase used in the reactions was 0.5 ug. The relaxation efficiency was established by parallel reactions containing a mixture of plasmid and kDNA followed by agarose gel electrophoresis. The completion of the decate-
nation reactions was estimated oortion of the reaction mixture.
by agarose gel etectrophoresis
of a
Acknowledgments We thank Jeff Esko, Pat Higgins, Bob Wells, Emil Michelotti, Mark Sullivan, and Susan Rohrer for helpful suggestions and stimulating discussions. We are also grateful to Leroy Liu, Johns Hopkins University School of Medicine, for generous gifts of type I and II topoisomerase; Kathy Ryan and Paul Englund, Johns Hopkins University School of Medicine, for sharing unpublished results; Jeff Engler for his assistance with the computer analysis of the DNA sequence; Bill Cr?sgrove, University of Georgia, for the trypanosome stock and encouragement; and Mona Williams for help in preparing the manuscript. This work was supported by a grant At21401 from the National lnstitutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received August 15, 1986. References Barrois, M., Riou, G., and Galibert, F. (1981). Complete nucleotide sequence of minicircle kinetoplast DNA from T?ypanosoma equiperdum. Proc. Natl. Acad. Sci. USA 78, 3323-3327. Benne, R., DeVries, B. F., Van Den nucleotide sequence of a segment drial maxi-circle DNA that contains some unusual unassigned reading 6941.
Burg, J., and Klauer, B. (1983). The of Tvpanosoma brucei mitochonthe gene for apocytochrome b and frames. Nucl. Acids Res. 77, 6925-
Borst, R, and Hoeijmakers, J. H. J. (1979). Kinetoplast 2, 20-40.
DNA. Plasmid
de la Cruz, V., Neckelmann, N., and Simpson, L. (1984). Sequence of six genes and several open reading frames in the kinetoplast maxicircle DNA of Leishmania tarentolae. J. Biol. Chem. 259, 15136-15147. Delain, E., and Riou, G. (1969). Ultrastructure du DNA du Kinetoplast de Trypanosoma cruzicultive in vitro. C. R. Acad. Sci. Paris Ser. D 288, 1225-1227. Devereux, J., Haeberli, P, and Smithies, 0. (1984). A comprehensive set of sequence programs for the VAX. Nucl. Acids Res. 72, 387-395. Diekmann, S., and Wang, J. C. (1985). On the sequence determinants and flexibility of kinetoplast DNA fragment with abnormal gel electrophoretic mobilities. J. Mol. Biol. 186, I-11. Englund, R T, Hajduk, S. L., and Marini, J. C. (1982). The molecular biology of trypanosomes. Ann. Rev. Biochem. 57, 695-726. Fairlamb, A. H., Weisloget, t? O., Hoeijmakers, J. H. J., and Worst, R (1978). Isolation and characterization of kinetoplast DNA from bloodstream form of Trypanosoma brucei. J. Cell Biol. 76, 293-309. Feagin, J. E., and Stuart, K. (1985). Differential expression of mitochondrial genes between life cycle states of Trypanosoma bfucei. Proc. Natl. Acad. Sci. USA 82, 3380-3384. Frasch, A. C. C., Hajduk, S. L., Hoeijmakers, J. H, J., Borst, F’., Brunel, F., and Davison, J. (1980). The kinetoplast DNA of Eypanosoma equiperdum. Biochem. Biophys. Acta 607, 397-410. Hagerman, R J. (1986). Sequence-dependence of the curvature of DNA: a test of the phasing hypothesis. Biochemistry 24, 7034-7037. Hensgens, L. A. M., Brakenhoff, J., De Vries, B., Sloof, R, Tromp, M. C., Van Boom, J. H., and Benne, R. (1984). The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Twpanosoma brucei mitochondrial maxi-circle DNA. Nucl. Acids Res. 12, 7324-7344. Hoeijmakers, J. H. J., and Borst, R (1978). RNA from the insect trypanosome Crithidia luciliae contains transcripts of the maxicircle and not of the minicircle component of kinetoplast DNA. Biochem. Siophys. Acta 527, 407-411. Hoeijmakers,
J. H. J., Snijders, A., Janssen,
J. W. G., and Borst, P.
Kinetoplast 543
DNA Packaging
(1981). Transcription of kinetoplast DNA in T~panosoma
brucei blood-
stream and culture forms. Plasmid 5, 329-350. Kidane, G. Z., Hughes, D., and Simpson, L. (1984). Sequence heterogeneity and anomalous electrophoretic mobility of kinetoplast minicircle DNA from Leishmania tarentolae. Gene 27, 265-277. Kitchen, P, Klein, V. A., Fein, B. I., and Englund, P T (1984). Gapped minicircles. A novel replication intermediate of kinetoplast DNA. J. Biol. Chem. 259, 15532-15539. Koo, H. S., Wu, H-M., and Crothers, D. M. (1986). DNA bending of adeninethymine tracts. Nature 320, 501-506. Krasnow, M. A., and Cozzarelli, N. R. (1982). Catenation of DNA rings by topoisomerases. J. Biol. Chem. 257, 2687-2693. Lanham, S. M. (1968). Separation of trypanosomes from the blood of infected rats and mice by anion-exchangers. Nature 278, 1273-1274. Leong, J. M., Nunes-Duby, S., Lesser, C. F., Youderian, F!, Susskind, M. M., and Landy, A. (1986). The @SOand P22 attachment sites. J. Biol. Chem. 260, 4468-4477. Marini, J. C., Levene, S. D., Crothers, D. M., and Englund, F! T. (1982). Bent helical structure in kinetoplast DNA. Proc. Nab. Acad. Sci. USA 79, 7664-7668. Marini, J. C., Effron, P N., Goodman, T C., Singleton, C. K., Wells, R. D., Warteli, R. M., and Englund, P T (1984). Physical characterization of a kinetopiast DNA fragment with unusual properties. J. Biol. Chem. 259, 8974-8979. Maxam, A. M., and Gilbert, W. (1980). Sequencing end-labeled DNA by base-specific chemical cleavages. Meth. Enzymol. 68, 499-580. Ntambi, J. M., and Englund, F! T. (1985). A gap at a unique location in newly replicated kinetoplast DNA minicircles from TTpanosoma equiperdum. J. Siol. Chem. 260, 5574-5579. Ntambi, J. M., Marini, J. C., Bangs, J. D., Hajduk, S. L., Jimenez, H. E., Kitchen, P A., Klein, V. A., Ryan, K. A., and Englund, P T (1984). Presence of a bent helix in fragments of kinetoplast DNA minicircles from several trypanosomatid species. Mol. Biochem. Parasitol. 12, 273-286. Shlomai, J., and Zadok, A. (1984). Kinetoplast minicircles of trypanosomatids encode for a protein product. Nucl. Acids Res. 72, 80178028. Simpson, L. (1972). The kinetoplast Cytol. 32, 139-267.
of the hemoflagetlates.
Int. Rev.
Simpson, L., and da Silva, A. (1971). Isolation and characterization of kinetoplast DNA from Leishmania tarentolae. J. Mol. Biol. 56443-453. Stuart, K. (1983). Kinetoplast DNA, mitochondrial ence. Mol. Biochem. Parasitol. 9, 93-104.
DNA with a differ-
Trifonov, E. N. (1985). Curved DNA. C. Ft. C. Crit. Revs. Biochem. 89-106. Weintraub, H. (1985). Assembly and propagation of repressed derepressed chromosomal states. Cell 42, 705-711.
19, and
Wu, H-M., and Crothers, D. M. (1984). The locus of sequence directed and protein induced DNA bending. Nature 308, 509-513. Zahn, K., and Blattner, F. R. (1985). Sequence-induced DNA curvature at the bacteriophage origin of replication. Nature 377; 451-453.
November 21, 1986, Copyright 0 1986 by Cell Press
Organized Packaging of Kinetoplast DNA Networks
kin E. Silver, Al F. Torri, and Stephen Department of Biochemistry University of Alabama at Birmingham Schools of Medicine and Dentistry Birmingham, Alabama 35294
L. Hajduk
Summary The kinetoplast DNA (kDNA) of Trypanosoma equiperdum is organized as a complex structure of catenated circular DNA molecules. The major component of the kDNA network is the one kilobase minicircle that is present at about 10,000 copies per network. We have developed two assays to examine the structure of kDNA networks compacted in vitro with spermidine. Our results suggest that minicircles are arranged into a regular structure with an exposed domain which is DNAase I- and restriction-sensitive and a protected domain which is resistant to restriction endonucleases and DNAase I. This regularly packaged structure is dependent upon spermidine compaction and the circularity of the kDNA, but does not require supercoiled minicircles or catenated networks.
The kinetoplast DNA of trypanosomes displays several features that make it unique among mitochondrial DNAs: one, kDNA represents lo%-30% of the total cellular DNA; two, the major component of the kinetoplast is a small circular molecule, the minicircle, of approximately l-2.5 kb which
may not be transcribed;
other component
of the
three,
transcription
of the
kDNA, the maxicircle, is developmentally regulated; four, a portion of the minicircles is in a bent helical DNA conformation; and five, the kDNA is organized as a complex catenated structure of 5,000-10,000 minicircles and 50-100 maxicircles (Englund et al., 1982; Stuart, 1963; Borst and Hoeijmakers, 1979; Marini et al., 1982; Hoeijmakers et al., 1981). The maxicircle encodes several proteins and RNAs that are essential for electron transport and oxidative phosphorylation in the mitochondrion (Benne et al., 1983; Feagin and Stuart, 1985; Hensgens et al., 1984; de la Cruz et al., 1984). The minicircles do not appear to have a conventional DNA coding function, which leads to the speculation that the primary role of minicircles may be structural and the network may act as a scaffolding for segregation of the maxicircles (Borst and Hoeijmakers, 1979). The function of sequence directed bending of the minicircle DNA is also unknown (Marini et al., 1982). Recent studies, however, have suggested that in one species of trypanoend in the minicircle sequence is associated with the origin of minicircle replication (Ntambi and Englund, 1984). Bent DNA sequences have been tentatively jdentified in other organisms (Leong et al., 1985; Zahn and Blattner, 1985) and appear to be associated with transcrip-
tion promoters, replication origins, and sites of recombination. Electron microscopy of trypanosome mitoc~ondria suggests that the kDNA network is highly organized in the cell. The DNA is aligned as a regular stack of fibers within the mitochondrion at the base of the flagellum (Simpson, 1972). The appearance of purified kDNA networks is very different. KDNA networks purified and spread for electron microscopy are organized as a loose mass of catenated circles showing little organization. As a first step toward understanding the function of the kDNA network in trypanosomes, we have developed two biochemical assays to study the organization of spermidine compacted kDNA networks. The results of these studies suggest that the kDNA of the bloodstream parasite Trypanosoma equiperdum is packaged, in vitro, into a regular structure that has two distinct domains. Here we also present evidence that the bent helical region of each minicircle is on the surface of the compacted kDNA network and that the organized packaging is dependent upon the circularity of the minicircle corn onent of the kDNA network.
Results In Vitro Compaction The kDNA network exists as a highly condensed structure in the mitochondrion of trypanosomes (Simpson, 1972). The purpose of our initial experiments was to determine whether kDNA networks could be compacted in vitro. Krasnow and Cozzarelli (1982) have used sedimentation to analyze the aggregation of plasmid DNA with spermidine. Purified kDNA networks from trypanosomes have sedimentation coefficients of about 55OOS,making it difficult to analyze the compaction of kDNA by sedimentation. Compaction can, however, be assayed by fluorescence microscopy in the presence of ethidium bromide (5 pg/ml). Figure 1 shows the appearance of T. equiperdum kDNA networks after incubation with increasing concentrations of spermidine (3 mM to 6 mM). The network size sharply decreased (10x) as spermidine concentrations increased from 3.6 to 4.0 mM. (These results are consistent with unpublished studies by K. Ryan and t? b Englund.) These studies cleariy demonstrate that kD compacted in vitro with spermidine. T. equiperdum Minicircle Sequence A common feature of trypanosomes, which has hindered the study of kDNA organization, is the sequence heterogeneity of the minicircles in a kDNA network (Englund et al., 1982). In order to study the organization of compacted kDNA networks, we have used kDNA isolated from T. equiperdum since this species of trypanosome has nearly homogeneous minicircles (Frasch et al., 1980; Riou and Barrois, 1979). A partial restriction map of the T. equiperdum minicircie is presented in Figure 2A. The restriction sites on this minicircle differ from those predicted from the
Cell 538
03
4
5
6
Sperr#ne Figure 1. Compaction
Analysis of T equiperdum
kDNA
Assay conditions were as described in Experimental Procedures. kDNA networks (0.1 Kg) were incubated at 25°C for 20 min in compaction buffer in the absence of spermidine (a) or with 3.4 mM (b), 3.8 mM (c), and 6.0 mM (d) spermidine. Ethidium bromide was added to a final concentration of 0.1 uglml. Photographs of fluorescent kDNA networks were taken with a Nikon epifluorescence microscope on Kodak ektachrome 200 film. The compaction reactions were quantitated by measurement of the area of the fluorescent networks. Compaction occurred at between 3.8 mM to 4.0 mM spermidine when kDNA networks were purified as described in Experimental Procedures. kDNA purified by less rigorous protocols could require spermidine concentration as high as 5.0 mM for complete compaction.
for the minicircle from another T equiperdum isolate (Barrois et al., 1982). To define the substrate used in subsequent experiments we determined the complete sequence for the minicircle of T. equiperdum (ATCC 30019) (Figure 2B). There is a major region of homology (between bases 290 and 425) with the other T equiperdum minicircle sequence. This homology region includes a portion of the minicircle bend and a 165 bp open reading frame (ORF) adjacent to the bend. The position of the bent helical region of the minicircle is indicated and is based upon analysis of the nucleotide sequence for runs of adenine nucleotides at intervals of approximately 10 bp and anomalous mobility of restriction endonuclease fragments on polyacrylamide gels (data not shown).
41”f I GAGTCAGTCAAATTAGAI:AT~AC,TTATTGTACTTATATMTTITT/WTCTATCTATT
60 120
ATTTATTTCTTTTATAcGAGGACAGGGAATAAG.4GGGAAAATTCATTGGAGATACT'AGGG 180 TGAGAGAGTTAA'AGAGTAATTGTGGTTGGGAGTATGGAGT.4GTTAT~TTATATTGGTG 240 AA4AAGGAAGGGGT4AAAAGTCGTGTAGTAGAATAGAGGTTGATAGGIWTAAGTGATGCA 3!30 ATTTGTGGAAGTAGTTGGTA.~~TCTATAG.~ATCGTT~4TTGGCTAAAAATCGGGC --__ 360 TGAAAkA4CGG.M.ATCT$4TGGGCGTGCAGATTTCACCATACACAAAACATCGTGC~ ~_
-
Lu!l6 .L@ TTTCGGGGGTTTTTTAGGTCCG4GGTACTTCGAAAGGGGTGGT
420
u. .!lkL. TTTTCTCAGGGTTTTGAGGCAATTCGCACTTTTCTTGGGGTTCTCAGTGCACTTTAATTT
480
sequence
Restriction Analysis of Compacted kDNA Networks Fluorescence microscopy studies show that kDNA networks are compacted at 4.0 mM to 4.2 mM spermidine. To determine the nature of the compacted networks, we treated kDNA with increasing concentrations of spermidine and tested these structures for susceptibility to cleavage by restriction endonucleases. Figure 3A shows the results of a double digest of the kDNA networks with Cfol and Hinfl. The digests of uncompacted kDNA, either not treated with spermidine or treated with spermidine concentrations less than 4.0 mM, yield two major restriction fragments of 421 bp and 584 bp. Cleavage also results in a 1005 bp fragment that is probably the result of a small number of minicircles lacking the Cfol or Hinfl sites. As the spermidine concentration increases above 4.0 mM, a single 1005 bp fragment is the major product (Figure 3A). Single digests with Hinfl (Figure 38) and Cfol (data not
540
CfOl 600 -. 4TATATAT‘AATTGTAC4TAT.4CCA.4CAAACAGAATAACTiWTGCGCAGTGATGATGAT4G 660 TTAATTAATTATATAT~GTTCTAATCTAT~TATTATTATATTTAATTGAGTGGCGTGA \IboI GAATAAGGTGATATTTCAATCCTAAACAAAAGGAATGATGTAATAGATAGAACTAATGAG
720 780
TAGAGAATTT~LZTTATTATTATTGTGTATATTG~TTACATATTTATTATTTTAGTTTAG 900 TATATAGGACGCAGAAATAGCAGT.4TAAAATAAGGATAGAGTTTATAGGTAG~GT .Ybol 9617 -' TTGAAAGTTGGATCAAGTGTCAT~~TGAGGGAAGTAAAGTAAAGT~ATATAATAGATAGMACAT 1005 AATAATAATTCTAGTTTGGTAGTATATACATATCAACAACG
Figure 2. Nucleotide
Sequence
of the T. equiperdum
Minicircle
(A) A circular restriction map of the T. equiperdum minicircle. The bent helical region is indicated. The cleavage sites for Hinfl (H), Cfot (C), Mbol (M), and Taql (T), Sau96 (S), and Ddel (D) are indicated. (B) The complete nucleotide sequence of the T. equiperdum minicircie. The numbering starts at the Hinfl site. The underlined sequence indicates short, periodic runs of adenines which form a bent helix. An open reading frame of 165 nucleotides begins at position 320 and is boxed. The positions of the Taql, Cfol, Mbol, Hinfi, Sau96, and Ddel restriction sites are also indicated.
shown) demonstrate that the 1005 bp product in double digests (Figure 3A) at spermidine concentrations above 4.0 mM is probably the result of Cfol cleavage. Hinfl does not digest spermidine-compacted kDNA while Cfol digestion of kDNA is unaffected by spermidine concentrations up to 8.0 mM (data not shown). To confirm that the product of the Hinfl-Cfol double digest of compacted kDNA was
Kinetoplast 539
DNA Packaging
Hinfl. The cleavage of the linearized substrate with Hinfl was unaffected by spermidine concentrations of 5.6 mM. These results show that the protection of the Hinfl site in compacted kDNA requires a circular DNA substrate and that compacted, linear kDNA substrate is cleaved by Hinfl even in the presence of high concentrations of spermidine. The linearized kDNA is condensed at 4.0 mM spermidine as judged by fluorescence microscopy. Again, this is in agreement with the spermidine concentration required for condensation of plasmid DNA as measured by sedimentation (Krasnow and Cozzarelli, 1982). Additional restriction endonucleases have been tested for their ability to cleave compacted networks (data not shown). Enzymes which cleave in the general region of the Cfol site, Ddel and Sau96, are active on spermidine-compacted networks. Digestion of spermidine-compacted kDNA with Mbol, which has cleavage sites 96 and 251 bp from the Hinfl site, results in a partial pattern of digestion. Both of the Mbol sites are partially protected from digestion in the compacted preparations. with
Figure 3. Restriction Analysis of SpermidineTreated and Plasmid DNA
kDNA Networks
Minicircle restriction fragments were separated by electrophoresis on 2% agarose gels, stained with ethidium bromide, and photographed. The arrow indicates the position of linearized, 1005 bp minicircle. Undigested kDNA networks do not enter the gels. The numbers at left indicate the size of the minicircle restriction fragments in base pairs. (A) Electrophoretic analysis of double digests of kDNA. Samples were incubated at the indicated spermidine concentrations and digested with Cfol and Hinfl for 2 hr at 37%. (B) Etectrophoretic analysis of Hinfl-digested kDNA. Samples were incubated at the indicated spermidine concentrations and digested with Hinfl. (C) The 1005 bp linearized minicircle from a double digest with Cfol and Hinfl in the presence of 5 mM spermidine (lane 1). The 1005 bp fragment was purified and digested with Taql in the absence of spermidine (lane 2). (D) Electrophoretic analysis of kDNA digested with Cfol prior to treatment with spermidine. Following spermidine treatment the kDNA was digested with Hinfl.
only Cfol cleaved minicircles, we purified the 1005 bp product of the double digest in the presence of 5 mM spermidine from agarose gels and mapped the cleavage site by digestion with Taql (Figure 3C). The Taql digest produces 810 bp and 195 bp fragments that are consistent with the first cleavage, in the presence of spermidine, being at the Cfol site on the minicircle. The lack of cleavage of kDNA with Hinfl was not due to the sensitivity of the enzyme to spermidine since the digestion of plasmid DNA with Hinfl is unaffected by spermidine concentrations up to 5.6 mM (data not shown). At this spermidine concentration the plasmid DNA is compacted into a rapidly sedimenting structure (Krasnow and Cozzarelli, 1982). We have also used the restriction assay to study the compaction of linearized kDNA (Figure 30). KDNA was digested with Cfol to linearize the minicircles, then incubated with spermidine (4.0 mM to 5.6 mfvl) and digested
DNAase Nicking of Compacted kDNA Networks To confirm the ordered arrangement of the spermidinecompacted kDNA networks we treated kDNA with pancreatic DNAase I together with DNA polymerase I and 32P-NTPs and determined the distribution of label in minicircle restriction fragments fractionate amide gels (Figure 4). The distribution of label in restriction fragments from compacted and uncompacted networks was different. In digests with Taql, Cfol, Hinfl, and Mbol the 195 bp Taql-Cfol fragment was preferentially labeled in the spermidine-compacted networks while minicircle fragments from uncompacted kDNA networks show nearly uniform labeling (Figure 4, lanes 1 and 2). Quantitation of the labeling of the spermidine-compacted kDNA shows that 62% of the total counts recovered were in the 195 bp Taql-Cfol minicircle fragment, which represents only 19% of the minicircle mass. In uncompacted kDNA networks 29% of the total counts incorporated were in the 195 bp fragment. Labeling of another portion of the minicircle, the 389 bp Hinfl-Taql fragment, also differs in t compacted and the uncompacted kDNA networks. In nick translations of uncompacted kDNA networks, 35% of the total counts incorporated were in the 389 bp fragment, which is in good agreement with this fragment representing 39% of the mass of the minicircle. In spermidinecompacted networks the 389 bp fragment is poorly labeled, with 18% of the counts incorporated. In control experiments we have studied the labeling of uncompacted and spermidine-compacted plasmid DNA. Autoradiography of restriction fragments from both compacted and uncompacted plasmid DNA showed uniform labeling (data not shown). In an attempt to more precisely map the site of DNAase I nicking, the elongation activity of polymerase I was limited by carrying out the nick translation reactions 4X in the absence of one nucleotide. Under these conditions, the incorporation of radioactivity is almost exclusively restricted to the 195 bp Taql-Cfol fragment (Figure 4, lane 3).
Cell 540
by polymerase I. These results agree with those in Figure 3D in which Cfol linearized minicircles compacted into a structure that was sensitive to digestion wi possible explanation for the preferential la 195 bp Cfol-Taql fragment would be the single-stranded regions (gaps) in this portion of the molecule. The poor labeling of the 195 bp fragments in reactions using linearized minicircles as substrate demonstrates that gaps do not contribute to the labeling. The preferential labeling of the 195 bp fragment in reactions containing the decatenated and relaxed substrates suggests that neither supercoiling nor catenation are required for ordered packaging of minicircles. Discussion
96Figure 4. Nick Translation Assay of kDNA Compaction of Substrate Conformation on Compaction
and the Effect
Uncompacted (lane 1) and spermidine-compacted (lane 2) kDNA was nick translated for 20 set as described in Experimental Procedures. Following nick translation the DNA was separated from unincorporated s*P-NTPs and digested with Hinfl, Cfol, Mbol, and Taqt. Nick translation of spermidine-compacted kDNA under conditions that limit polymerase I elongation (lane 3). Different conformations of the kDNA substrate were derived by treatment with topoisomerase I to relax the DNA (lane 4) topoisomerase II to decatenate the DNA (lane 5) or the restriction enzymes Mb01 or Hinfl to linearize the DNA (lanes 6 and 7). These samples were then compacted with 6 mM spermidine, nick translated for 20 see, digested with the restriction enzymes Taql, Cfol, Hinfl, and Mbol and analyzed on 6% polyacrylamide gels.
These results suggest that spermidine compaction of kDNA networks produces a domain within the minicircles which is preferentially labeled during nick translation with DNAase I. This DNAase I hypersensitive region is approximately 180° from the protected Hinfl site identified in Figure 3. Effect of kDNA Conformation on Packaging If the kDNA networks are organized into regular structures upon compaction with spermidine, these structures may be influenced by the conformation of the DNA substrate. To test this possibility, we treated kDNA with calf thymus topoisomerase I to produce relaxed substrate, with calf thymus topoisomerase II to produce monomeric relaxed minicircles, and with the restriction enzymes Hinfl or Mbol to produce linearized substrate. The enzymatically modified substrates were compacted with spermidine and the effect of the various treatments on the ordered packaging of the kDNA was tested (Figure 4). Relaxed, compacted networks (lane 4) and decatenated, compacted monomeric minicircles (lane 5) were preferentially labeled in the 195 bp fragment. Linearized, compacted minicircles (lanes 8 and 7) did not show preferential labeling of the 195 bp fragment. However, the single-stranded cohesive ends of the restriction fragments were efficiently labeled
The kDNA network of trypanosomes is ture in that it is composed of thousands far DNA molecules. The function of the network structure has been the subject of much conjecture, yet little is known about the organization of the network in the native compacted state. In this paper we present evidence that the kDNA network is packaged, in the presence of spermidine, into an ordered structure in vitro. Our experiments show that the ordered packaging requires the kDNA to be in a circular conformation but that the packaging is independent of supercoiling and catenation of minicircles. The compaction of kDNA occurs at the same spermidine concentrations as the aggregation of plasmid DNA (Krasnow and Cozzarelli, 1982). The spermidine-compacted lasmid DNA forms aggregates that are readily digested y restriction endonucleases and uniformly labeled by nick translation with DNAase I and polymerase I. The kDNA, either as a catenated network or as monomeric circles, compacts into a structure that has distinct domains with regard to restriction endonuclease sensitivity and DNAase I nicking. Spermidine-compacted, linear kDNA is not organized as a structure recognized in either our restriction protection assays or the nick translation assays as ordered. The regular packaging of monomeric minicir cles is surprising. However, we have recently described an interesting correlation in the organization of the kDN of Bodo caudatus, a nonparasitic member of the order Kinetoplastidae (Hajduk et al., unpublished results). The kDNA of this organism is organized as a compacted structure in vivo yet is composed of noncatenated circular BNA. It is likely that the organized packaging of the kDNA network is due to an inherent feature of minicircles. The most obvious candidate is the bent helical region of the minicircle (Marini et al., 1982; 1984; Kidane et al., 1984), which is a universal feature of minicircles (Ntambi et al,, 1994). Studies of the Leishmania tarentolae minicircle bend and synthetic oligonucleotide fragments have identified several requirements for sequence-directed DNA bending: one, short runs of three to six adenine nucleotides; two, the regular phasing of these runs of adenines at lo-11 bp intervals, approximately in phase with the turns of the DNA helix; and three, a minimum of three phased runs of adenines (Wu and Crothers, 1984; Hagerman, 1986; Koo
Kinetoplast 541
DNA Packaging
9mt / DNA
Figure 5. Schematic
Model of the In Vitro Packaging of kDNA
The bent helical region of the minicircle DNA is indicated by hatching. Supercoiled, catenated minicircles and relaxed monomeric minicircles are depicted in this drawing.
et al., 1986; Diekmann and Wong, 1985; Trifonov, 1985). A portion of the T. equiperdum minicircie sequence, from nucleotides 260 to 315, meets these requirements. Restriction fragments containing this portion of the minicircle also show the anomalous mobilities on polyacrylamide gels which is characteristic of bent DNA (Marini et al., 1982). The bent helical region of the T. equiperdum minicircle is adjacent to the Taql, Ddel, and Sau96 restriction sites in a portion of the minicircle accessible to restriction digestion in the spermidine-compacted networks. In addition, the bend is adjacent to the 195 bp Taql-Cfol fragment which is preferentially labeled in short nick translation experiments. Marini et al. (1982) first postulated that the bend might facilitate and stabilize the regular in situ packaging of the kDNA in trypanosomatids. They proposed that the kDNA network is arranged as a single tier of minicircles organized as a disk-like structure with each DNA molecule aligned parallel to the long axis of the cell. Their model is supported by electron microscopy of the kinetoplast in situ in which the height of the kDNA disk is approximately half the contour length of the minicircles (Delain and Riou, 1969; Simpson and de Silva, 1971). Our in vitro results suggest that the compacted kDNA network is arranged as double tier structure with the bent region of each minicircle directed toward the exterior of the network (Figure 5). In our model the DNA at the interior of the kDNA netork would be densely packed. This might present a rather inhospitable environment for many enzymes or interfere wit!? the accessibility of the kDNA located in this portion of the network to enzymes. As in the previous model, the bent portion of each minicircle would be on the surface of the compacted kDNA network and accessible to enzymes in the mitochondrial matrix. We propose that
the regular packaging of the T. equiperdu directed by the bent helical region of the minicircles. A thorough deletion analysis of the sequences required for the regular packaging of the kDNA is underway. Another interesting feature of our model is the position of the minicircle open reading frame (ORF) in compacted kDNA. The minicircle ORF is immediately downstream of the bent helical region (see Figure 2b). It is located in the portion of the minicircle exposed to cleavage by restriction endonucleases and hypersensitive to nicking with DNAase I in compacted kDNA networks. This portion of the minicircle, on the exterior of the co should be available for transcription. revious studies (Hoeijmakers and Borst, 1978) have failed to detect minicircle transcripts in trypanosomes. suggests that minicircles may have a coding function. Shlomai and Zadok (1984) used minicircle DNA fragments from C. fasciculata to prepare a fusion protein in E. coli. Antibodies against this fusion p the kinetoplast of intact trypan results are suggestive of minicir tification of the sequence encoding the fusion protein and characterization of the protein product have not been reported. The organized structure of the A network in vivo t often suggested may have several functions. The function for the kDNA network is that it forms a scaffolding for the segregation of the maxicircle kDNA (Borst and Hoeijmakers, 1979). for a chromatin is that the network structure substitut matrix and may be involved in the regulation of maxicircle transcription. We have recently shown (~i~~elo~i and Hajduk, unpublished results) that the transcription of some maxicircle genes is developm ted in Trypanosoma brucei. Changes in the the kDNA network during the developmen trypanosomes may be analogous to alterations in chromatin structure seen in eukaryotic nuclei which are as ed with activation of tissue and development specif @s(reviewed by Weintraub, 1985). Experimental
Procedures
Growth of Cells and Isolation of kDNA ~etwo~ka Trypanosoma equiperdum (ATCC 30019) was obtained from Dr. W. S. Cosgrove at the University of Georgia and was stored at -196% in 7.5% dimethyl sulphoxide. Female Wistar rats were infected by intraperitoneal injection of thawed frozen stocks. This strain produces acute infections in rats, killing the host in 4-6 days with maximum parasitemias of log/ml. Trypanosomes were harvested when cell densities reached approximately 5 x lO*/ml and were separated from blood cells by diethylaminoethyl-cellulose chromatography (Lanham, 1966). kDNA networks were prepared as described by Fairlamb et al. (1976). We find that less extensive purification schemes result in kDNA networks which require higher concentrations of spermidine for compaction. We typically recover about 15-25 gg of kDNA from 1 x lOlo cells. kDNA Compaction Assay T. equiperdum kDNA networks were incubated at 25% in 20 $ reactions containing 0.1 w DNA, 25 mM Tris-HCI (pH 7.5), 15 mM KCI, 2 mM MgCl2, 1 mM dithiothreitol (compaction buffer) and spermidine concentrations varying from 3 mM to 6 mM. Following incubation for 20 min, 1 itl of ethidium bromide was added (10 pglml in buffer contain-
Cell 542
ing an equal concentration of spermidine as the sample). Networks were photographed using a Nikon epi-fluorescence microscope at 1000x on Kodak ektachrome 200 film. Compaction was defined as a decrease in the area of the fluorescent networks. The photographic negatives were enlarged ten times and the area of the networks was determined. Cloning and Sequencing of Minicircles Minicircle restriction fragments were generated by double digests with Hinfl-Cfol and Taql-Hinfl and the ends repaired by treatment with Sl nuclease prior to blunt end ligation into pUC 9. Inserts from clones containing the Cfol-Hinfl and Hinfl-Taql minicircle restriction fragments were isolated and labeled by incubation with the Klenow fragment of DNA polymerase I. The minicircle recombinant fragments were aequenced by the chemical degradation method. Degradation products were analyzed on 6% or 20% polyacrylamide/urea gels (Maxam and Gilbert, 1980). Sequences were analyzed (Devereux et al., 1984) with a Vax 11/750 computer operated by the Comprehensive Cancer Center at the University of Alabama at Birmingham. Restriction Cleavage Assay of Compaction The kDNA and plasmid DNAs were incubated in compaction buffer as described above and the compaction verified by fluorescence microscopy. Restriction endonuclease digestion of the DNA was at 37°C in 30 ul reactions. Spermidine (from 10 mM or 50 mM stocks) was added to give final concentrations ranging from 3 mM to 10 mM. Reactions were stopped by the addition of 5 ul of 500 mM EDTA and samples run on 1% agarose gels in 40 mM Tris-HCI, 20 mM sodium acetate, and 1 mM EDNA (pH 7.6) (TAE) at 1 volt/cm for 12-16 hr. The relative mobilities of minicircles to marker fragments were determined from photographs of ethidium-bromide-stained gels. To test the influence of substrate conformation on the restriction cleavage assay, kDNA networks were first cleaved with Cfol, phenol extracted, and compacted as above prior to treatment with the second restriction endonuclease Hinfl. Nick Translation Assay of Compaction Plasmid DNA or kDNA was incubated in compaction buffer and 8 mM spermidine as described above and the compaction of the DNA confirmed by fluorescence microscopy. The nick translation assays were carried out in compaction buffer at 10°C in 50 ul reactions containing 0.3-0.5 ug of DNA and 20 pM of each of three deoxyribonucleotide triphosphates, the other dNTP was @P-labeled with specific activities of 3000 cilmmol. To limit the elongation activity of polymerase I we also carried out the nick translation assay at 4°C in the absence of one of the cold dNTPs. Reactions were initiated by the addition of 0.08 U of DNA polymerase I (Bethesda Research Laboratories) and 9 pg DNAase I (Bethesda Research Laboratories) and stopped after 20 set by the addition of an equal volume of neutralized phenol. Samples were digested with Hinfl, Cfol, and Mbol at 3PC for 2 hr and with Taql for 1 hr at 65OC and electrophoresed on 8% polyacrylamide gels at 1 volt/cm for 12-16 hr. The gels were stained with ethidium bromide to check the completion of the digests, dried, and autoradiographed for 12-48 hr at -7OOC. The incorporation of counts into the minicircle restriction fragments was determined by counting of gel slices dissolved in 30% HaOs, 0.1 M NaOH at 65OC for 48 hr in an LKB scintillation counter. Relaxation and Decatenation of kDNA Restriction endonucleases were purchased from Boehringer Mannheim and Bethesda Research Laboratories. Calf thymus type I and II topoisomerase were gifts from Dr. L. Liu, Johns Hopkins University School of Medicine. Relaxation of supercoiled DNA by type I topoisomerase was performed in 20 pl reaction mixtures containing 1 ug kDNA and 2 ng of the calf thymus type I topoisomerase, IO mM Tris-HCI (pH 7.99, 50 mM KCI, 100 mM NaCI, 0.1 mM MgCIa, 50 uglml bovine serum albumin. Reactions were at 30°C for 30 min and were stopped by the addition of SDS (to O.t”/o) and EDTA (to 10 mM). For decatenation of kDNA the reactions were as above except that ATP was added to a final concentration of 1 mM and the amount of type II topoisomerase used in the reactions was 0.5 ug. The relaxation efficiency was established by parallel reactions containing a mixture of plasmid and kDNA followed by agarose gel electrophoresis. The completion of the decate-
nation reactions was estimated oortion of the reaction mixture.
by agarose gel etectrophoresis
of a
Acknowledgments We thank Jeff Esko, Pat Higgins, Bob Wells, Emil Michelotti, Mark Sullivan, and Susan Rohrer for helpful suggestions and stimulating discussions. We are also grateful to Leroy Liu, Johns Hopkins University School of Medicine, for generous gifts of type I and II topoisomerase; Kathy Ryan and Paul Englund, Johns Hopkins University School of Medicine, for sharing unpublished results; Jeff Engler for his assistance with the computer analysis of the DNA sequence; Bill Cr?sgrove, University of Georgia, for the trypanosome stock and encouragement; and Mona Williams for help in preparing the manuscript. This work was supported by a grant At21401 from the National lnstitutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received August 15, 1986. References Barrois, M., Riou, G., and Galibert, F. (1981). Complete nucleotide sequence of minicircle kinetoplast DNA from T?ypanosoma equiperdum. Proc. Natl. Acad. Sci. USA 78, 3323-3327. Benne, R., DeVries, B. F., Van Den nucleotide sequence of a segment drial maxi-circle DNA that contains some unusual unassigned reading 6941.
Burg, J., and Klauer, B. (1983). The of Tvpanosoma brucei mitochonthe gene for apocytochrome b and frames. Nucl. Acids Res. 77, 6925-
Borst, R, and Hoeijmakers, J. H. J. (1979). Kinetoplast 2, 20-40.
DNA. Plasmid
de la Cruz, V., Neckelmann, N., and Simpson, L. (1984). Sequence of six genes and several open reading frames in the kinetoplast maxicircle DNA of Leishmania tarentolae. J. Biol. Chem. 259, 15136-15147. Delain, E., and Riou, G. (1969). Ultrastructure du DNA du Kinetoplast de Trypanosoma cruzicultive in vitro. C. R. Acad. Sci. Paris Ser. D 288, 1225-1227. Devereux, J., Haeberli, P, and Smithies, 0. (1984). A comprehensive set of sequence programs for the VAX. Nucl. Acids Res. 72, 387-395. Diekmann, S., and Wang, J. C. (1985). On the sequence determinants and flexibility of kinetoplast DNA fragment with abnormal gel electrophoretic mobilities. J. Mol. Biol. 186, I-11. Englund, R T, Hajduk, S. L., and Marini, J. C. (1982). The molecular biology of trypanosomes. Ann. Rev. Biochem. 57, 695-726. Fairlamb, A. H., Weisloget, t? O., Hoeijmakers, J. H. J., and Worst, R (1978). Isolation and characterization of kinetoplast DNA from bloodstream form of Trypanosoma brucei. J. Cell Biol. 76, 293-309. Feagin, J. E., and Stuart, K. (1985). Differential expression of mitochondrial genes between life cycle states of Trypanosoma bfucei. Proc. Natl. Acad. Sci. USA 82, 3380-3384. Frasch, A. C. C., Hajduk, S. L., Hoeijmakers, J. H, J., Borst, F’., Brunel, F., and Davison, J. (1980). The kinetoplast DNA of Eypanosoma equiperdum. Biochem. Biophys. Acta 607, 397-410. Hagerman, R J. (1986). Sequence-dependence of the curvature of DNA: a test of the phasing hypothesis. Biochemistry 24, 7034-7037. Hensgens, L. A. M., Brakenhoff, J., De Vries, B., Sloof, R, Tromp, M. C., Van Boom, J. H., and Benne, R. (1984). The sequence of the gene for cytochrome c oxidase subunit I, a frameshift containing gene for cytochrome c oxidase subunit II and seven unassigned reading frames in Twpanosoma brucei mitochondrial maxi-circle DNA. Nucl. Acids Res. 12, 7324-7344. Hoeijmakers, J. H. J., and Borst, R (1978). RNA from the insect trypanosome Crithidia luciliae contains transcripts of the maxicircle and not of the minicircle component of kinetoplast DNA. Biochem. Siophys. Acta 527, 407-411. Hoeijmakers,
J. H. J., Snijders, A., Janssen,
J. W. G., and Borst, P.
Kinetoplast 543
DNA Packaging
(1981). Transcription of kinetoplast DNA in T~panosoma
brucei blood-
stream and culture forms. Plasmid 5, 329-350. Kidane, G. Z., Hughes, D., and Simpson, L. (1984). Sequence heterogeneity and anomalous electrophoretic mobility of kinetoplast minicircle DNA from Leishmania tarentolae. Gene 27, 265-277. Kitchen, P, Klein, V. A., Fein, B. I., and Englund, P T (1984). Gapped minicircles. A novel replication intermediate of kinetoplast DNA. J. Biol. Chem. 259, 15532-15539. Koo, H. S., Wu, H-M., and Crothers, D. M. (1986). DNA bending of adeninethymine tracts. Nature 320, 501-506. Krasnow, M. A., and Cozzarelli, N. R. (1982). Catenation of DNA rings by topoisomerases. J. Biol. Chem. 257, 2687-2693. Lanham, S. M. (1968). Separation of trypanosomes from the blood of infected rats and mice by anion-exchangers. Nature 278, 1273-1274. Leong, J. M., Nunes-Duby, S., Lesser, C. F., Youderian, F!, Susskind, M. M., and Landy, A. (1986). The @SOand P22 attachment sites. J. Biol. Chem. 260, 4468-4477. Marini, J. C., Levene, S. D., Crothers, D. M., and Englund, F! T. (1982). Bent helical structure in kinetoplast DNA. Proc. Nab. Acad. Sci. USA 79, 7664-7668. Marini, J. C., Effron, P N., Goodman, T C., Singleton, C. K., Wells, R. D., Warteli, R. M., and Englund, P T (1984). Physical characterization of a kinetopiast DNA fragment with unusual properties. J. Biol. Chem. 259, 8974-8979. Maxam, A. M., and Gilbert, W. (1980). Sequencing end-labeled DNA by base-specific chemical cleavages. Meth. Enzymol. 68, 499-580. Ntambi, J. M., and Englund, F! T. (1985). A gap at a unique location in newly replicated kinetoplast DNA minicircles from TTpanosoma equiperdum. J. Siol. Chem. 260, 5574-5579. Ntambi, J. M., Marini, J. C., Bangs, J. D., Hajduk, S. L., Jimenez, H. E., Kitchen, P A., Klein, V. A., Ryan, K. A., and Englund, P T (1984). Presence of a bent helix in fragments of kinetoplast DNA minicircles from several trypanosomatid species. Mol. Biochem. Parasitol. 12, 273-286. Shlomai, J., and Zadok, A. (1984). Kinetoplast minicircles of trypanosomatids encode for a protein product. Nucl. Acids Res. 72, 80178028. Simpson, L. (1972). The kinetoplast Cytol. 32, 139-267.
of the hemoflagetlates.
Int. Rev.
Simpson, L., and da Silva, A. (1971). Isolation and characterization of kinetoplast DNA from Leishmania tarentolae. J. Mol. Biol. 56443-453. Stuart, K. (1983). Kinetoplast DNA, mitochondrial ence. Mol. Biochem. Parasitol. 9, 93-104.
DNA with a differ-
Trifonov, E. N. (1985). Curved DNA. C. Ft. C. Crit. Revs. Biochem. 89-106. Weintraub, H. (1985). Assembly and propagation of repressed derepressed chromosomal states. Cell 42, 705-711.
19, and
Wu, H-M., and Crothers, D. M. (1984). The locus of sequence directed and protein induced DNA bending. Nature 308, 509-513. Zahn, K., and Blattner, F. R. (1985). Sequence-induced DNA curvature at the bacteriophage origin of replication. Nature 377; 451-453.