- Email: [email protected]
Overexpression of LYRM1 induces mitochondrial impairment in 3T3-L1 adipocytes
Molecular Genetics and Metabolism 101 (2010) 395–399
Contents lists available at ScienceDirect
Molecular Genetics and Metabolism j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / y m g m e
Overexpression of LYRM1 induces mitochondrial impairment in 3T3-L1 adipocytes Xin-Guo Cao a,1, Chun-Zhao Kou b,1, Ya-Ping Zhao b, Chun-Lin Gao b, Chun Zhu a, Chun-Mei Zhang a, Chen-Bo Ji b, Da-Ni Qin a, Min Zhang a,⁎, Xi-Rong Guo b,⁎ a b
Nanjing Maternal and Child Health Hospital of Nanjing Medical University, Nanjing 210004, China Institute of Pediatrics, Nanjing Medical University, Nanjing 210029, China
a r t i c l e
i n f o
Article history: Received 10 August 2010 Accepted 10 August 2010 Available online 19 August 2010 Keywords: LYRM1 3T3-L1 adipocyte Insulin resistance Mitochondrial dysfunction
a b s t r a c t Homo sapiens LYR motif containing 1 (LYRM1) is a recently discovered gene involved in adipose tissue homeostasis and obesity-associated insulin resistance. The exact mechanism by which LYRM1 induces insulin resistance has not yet been fully elucidated. In this study, we demonstrated that the overexpression of LYRM1 in 3T3-L1 adipocytes resulted in reduced insulin-stimulated glucose uptake, an abnormal mitochondrial morphology, and a decrease in intracellular ATP synthesis and mitochondrial membrane potential. In addition, LYRM1 overexpression led to excessive production of intracellular of reactive oxygen species. Collectively, our results indicated that the overexpression of LYRM1 caused mitochondrial dysfunction in adipocytes, which might be responsible for the development of LYRM1-induced insulin resistance. © 2010 Elsevier Inc. All rights reserved.
1. Introduction Obesity has become an important global public health problem in the recent decades [1]. Common obesity (complex polygenic obesity) results from interactions between genetic, environmental, and psychosocial factors [2]. Identifying the genes involved in obesity would help elucidate the genetic basis of the disease. In our earlier studies, we isolated and characterized LYRM1, a novel human gene that was expressed at a high level in the omental adipose tissue of obese patients. The 122-amino-acid LYRM1 protein is encoded by a 4-exon gene mapped to chromosome 16. There is evidence showing that LYRM1 promotes preadipocyte proliferation and inhibits apoptosis of preadipocytes [3,4]. To date, there are no reports on LYRM1 and insulin-stimulated glucose uptake. A series of diverse experiments support the notion that mitochondrial defects play a critical role in obesity-associated insulin resistance [5,6]. One study demonstrated that obesity/diabetes is accompanied by impaired mitochondria in the adipose tissue of db/db mice [7]. Mitochondrial dysfunction in adipose tissue has been linked to obesity/diabetes in humans as well [8,9]. Hepatic mitochondrial dysfunction precedes the development of nonalcoholic fatty liver disease and insulin resistance in Otsuka Long-Evans Tokushima Fatty rats [10]. A study proposed that the molecular mechanism for insulin resistance caused by mitochondrial dysfunction involves the accumulation of lipid metabolites and an increase in the reactive oxygen species (ROS) attributable to the mitochondrial dysfunction-activated ⁎ Corresponding authors. E-mail addresses: [email protected] (M. Zhang), [email protected] (X.-R. Guo). 1 These authors contributed equally to this work. 1096-7192/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ymgme.2010.08.010
serine/threonine kinase. This leads to an increase in the serine phosphorylation of insulin receptor substrate-1 (IRS-1), which, in turn, blocks the tyrosine phosphorylation of IRS-1 and subsequently results in insulin resistance [11]. Genetic factors, oxidative stress, mitochondrial biogenesis, and aging may affect mitochondrial function, leading to insulin resistance and various pathological conditions [12]. The purpose of this study was to investigate the relationship between LYRM1, insulin-stimulated glucose uptake, and mitochondrial dysfunction in 3T3-L1 adipocytes. 2. Materials and methods 2.1. Cell culture and differentiation of 3T3-L1 preadipocytes 3T3-L1 preadipocytes were stably transfected with either an empty expression vector (pcDNA3.1Myc/His B) or a LYRM1 expression vector as described previously [4]. Three colonies expressing LYRM1 and three with the empty vector were selected for study. The transfected cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco Laboratories, Grand Island, NY, USA) supplemented with 10% calf serum (Gibco, Carlsbad, CA, USA) and 100 μg/mL neomycin (G418; Roche, Basel, Switzerland). Two days after complete confluence (day 0), the cells were cultured for 48 h in DMEM supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), 0.5 mmol/L 1-methyl-3-isobutylxanthine (Sigma, St. Louis, MO, USA), 1 μmol/L dexamethasone (Sigma, St. Louis, MO, USA), 10 μg/mL insulin (Sigma, St. Louis, MO, USA), and 100 μg/mL G418. From day 2 to day 4, the medium was supplemented with 10% fetal bovine serum and 10 μg/mL insulin. The cells were then transferred to DMEM containing 10% FBS and 100 μg/mL G418 for the remaining culture period. The cultures were replenished every
396
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
2 days. Ten days after the induction of differentiation, more than 90% of the cells exhibited typical adipocyte morphology. 2.2. Glucose uptake Uptake of 2-deoxy-D-[3H]glucose (Amersham Biosciences, Piscataway, NJ, USA) was assayed as described previously but with minor modifications [13]. The stably transfected cells were cultured in sixwell plates and induced into mature adipocytes. On day 10 of differentiation, the cells were serum-starved in DMEM containing 0.5% FBS for 3 h. The cells were then washed twice with phosphatebuffered saline (PBS) and incubated in KRP–HEPES buffer [30 mmol/L HEPES (pH 7.4), 10 mmol/L NaHCO3, 120 mmol/L NaCl, 4 mmol/L KH2PO4, 1 mmol/L MgSO4, and 1 mmol/L CaCl2] in the presence or absence of 100 nmol/L insulin for 30 min at 37 °C. Labeled 2-deoxy-D[3H]glucose was added to produce a final concentration of 2 μCi/mL. After 10 min at 37 °C, the reaction was terminated by washing 3 times with ice-cold PBS supplemented with 10 mmol/L D-glucose. The cells were solubilized by adding 200 μL of 1 mol/L NaOH to each well, and aliquots of the cell lysate were transferred to scintillation vials for radioactivity counting; the remainder was used for a protein assay with the bicinchonic acid protein assay kit (Pierce, Rockford, IL, USA), and the radioactivity was normalized by protein concentration. 2.3. Electron microscopy On the tenth day of differentiation, the mature adipocytes were collected after trypsin digestion, washed in fresh PBS (pH 7.4), and fixed in a buffer containing 2.5% (vol./vol.) glutaraldehyde and 4% (vol./vol.) paraformaldehyde. The cells were then washed in 0.1 M cacodylate buffer, postfixed with 1% (wt./vol.) osmium tetroxide and 1.5% (wt./vol.) potassium ferrocyanide for 1 h, washed in water, stained with 1% (vol./vol.) aqueous uranyl acetate for 30 min, and dehydrated through a graded series of ethanol to 100%. The samples were then infiltrated and embedded in TAAB Epon (Marivac Canada Inc., St. Laurent, Canada). Ultrathin sections (60 nm) were cut on a Reichert Ultracut-S microtome, placed onto copper grids stained with uranyl acetate and lead citrate, and examined on a transmission electron microscope (JEOL JEM-1010, Tokyo, Japan) at an accelerating voltage of 80 kV. 2.4. Real-time quantitative polymerase chain reaction (qPCR) for mitochondrial DNA (mtDNA) Relative amounts of mtDNA were determined by real-time qPCR as previously described [14]. Briefly, DNA was isolated from adipocytes with a DNA extraction kit (Baitaike, Beijing, China) and quantified by spectrophotometry at 260 nm. Two primer sets were used for PCR analysis. A 110-nucleotide mtDNA fragment within the CYTB gene was used for the quantification of mtDNA. The PCR product has previously been cloned into the plasmid pMD-T 18 and verified by DNA sequencing. Plasmid standards of known copy number were used to generate a log-linear standard curve, from which the CYTB copy numbers of the studied samples could be determined by realtime qPCR performed on an Applied Biosystems 7300 Sequence Detection System (Foster City, CA, USA). A 291-bp region of the
nuclear gene for 28S ribosomal RNA was used to normalize the results. A standard curve of plasmids containing the 28S fragment was used to determine the copy numbers of the studied samples. The ratio of mtDNA to nuclear DNA reflects the concentration of mitochondria per cell. The sequences of the primers and Taqman probes (Invitrogen, Shanghai, China) are shown in Table 1. 2.5. ATP production The transfected 3T3-L1 preadipocytes were induced to differentiate as described above. On the tenth day of differentiation, the ATP content of the adipocytes was measured using a luciferase-based luminescence assay kit (Biyuntian, Nantong, China). Briefly, adipocytes were homogenized in an ice-cold ATP-releasing buffer. Treated adipocytes were mixed with the detection reagent for 5 min. Using an ATP standard, ATP concentrations were then determined with a single-tube luminometer (Turner Biosystems, CA, USA) and normalized to protein concentrations. 2.6. Confocal laser microscopy MitoTracker, a red mitochondria-specific cationic fluorescent dye (Molecular Probes, Invitrogen, Carlsbad, CA, USA), was used to evaluate the mitochondrial membrane potential (ΔΨm). The H2DCFDA probe (Sigma, St. Louis, MO, USA) was used to estimate the intracellular ROS levels [15]. On the tenth day of differentiation, the transfected 3T3-L1 adipocytes were incubated with 150 nM of MitoTracker and 5 μM of H2-DCFDA for 30 min at 37 °C and then washed three times with warm PBS. Cells were imaged using a confocal laser scanning microscope (Zeiss, Gottingen, Germany). 2.7. Flow cytometry On the tenth day of differentiation, the transfected 3T3-L1 adipocytes were incubated with 150 nM of MitoTracker and 5 μM of H2-DCFDA at 37 °C. After 30 min, cultured cells were trypsinized and centrifuged at 1000 rpm at 4 °C for 5 min, then resuspended in Krebs– Ringer solution buffered with 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) and 0.5% bovine serum albumin. Cells were analyzed with a FACScan flow cytometer using the CellQuest software (BD Biosciences, San Jose, CA, USA). 2.8. Statistical analysis Each experiment was performed at least three times. All values are presented as the mean ± SD. Statistical analyses were performed using a Student's t-test, and P b 0.05 was statistically significant. 3. Results 3.1. Effects of LYRM1 on basal and insulin-stimulated glucose uptake in 3T3-L1 adipocytes To determine whether LYRM1 affects insulin sensitivity, we assessed glucose uptake in differentiated 3T3-L1 adipocytes. In LYRM1-overexpressing cells, basal glucose uptake was similar to that observed in the controls. However, in LYRM1-overexpressing
Table 1 Sequences for primer/probe sets used in qPCR. Gene
Forward primer (5′–3′)
Probe
Reverse primer (5′-3′)
Cyt B
TTTTATCTGCATCTGAGTTT AATCCTGT GGCGGCCAAGCGTTCATAG
AGCAATCGTTCACCTC CTCTTCCTCCAC TGGTAGCTTCGCCCCAT TGGCTCCT
CCACTTCATCTTACCATTTATTATCGC
28S
AGGCGTTCAGTCATAATCCCACAG
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
397
cells, insulin-stimulated glucose uptake was approximately 40% lower than that in the controls (Fig. 1). 3.2. Effects of LYRM1 on mtDNA copy number and mitochondrial morphology in 3T3-L1 adipocytes The mtDNA copy number per mitochondrion is generally considered to be constant in most mammalian cell types [16]. The mtDNA copy number is regarded as the cellular mitochondrial number and could be a possible surrogate marker of mitochondrial function. Using real-time qPCR, we assessed the effects of LYRM1 on mtDNA copy number. The results showed that the mtDNA copy number in LYRM1overexpressing 3T3-L1 adipocytes was not significantly lower than that in vector-transfected (VT) adipocytes (Fig. 2). To extend the findings of mitochondrial number, we investigated the morphology of the mitochondria using electron microscopy. As shown in Fig. 3, the mitochondria in LYRM1-overexpressing cells showed abnormal morphology, with a smaller size and twisted, condensed cristae, compared to those in VT adipocytes. Notably, signs of mitochondrial damage ranged from swelling and reduced density to virtually hollow mitochondria with broken double membranes. 3.3. LYRM1 overexpression increased ROS levels in 3T3-L1 adipocytes A causative link has been proposed between elevated mitochondrial ROS generation and mitochondrial dysfunction and insulin resistance [17]. To elucidate whether ROS are involved in the dysfunction of mitochondria in LYRM1-overexpressing adipocytes, we measured the ROS levels in LYRM1-overexpressing adipocytes and VT adipocytes. As shown in Figs. 4a and b, ROS levels in the LYRM1overexpressing adipocytes were much higher than in the VT adipocytes. LYRM1 dramatically increased the ROS levels. 3.4. LYRM1 overexpression decreased ATP production and ΔΨm in 3T3L1 adipocytes In adipocytes, mitochondria produce N95% of the cellular ATP required for triglyceride synthesis and adipocyte synthesis and secretion, besides other general cellular processes [16]. Impaired mitochondria may lead to a lack of ATP. As expected for cells with abnormal mitochondria, we found that the total cellular ATP production was dramatically decreased in LYRM1-overexpressing adipocytes (Fig. 5).
Fig. 1. Effect of LYRM1 on glucose uptake. 3T3-L1 preadipocytes transfected with LYRM1 or the empty vector (pcDNA3.1Myc/His B) were induced to differentiate, and the 2deoxy-D-[3H]glucose uptake was measured as described in the Materials and methods section. The cellular glucose uptake was measured and normalized to protein concentrations (n = 6). *P b 0.001 in comparison with insulin-stimulated control (cells transfected with the empty vector).
Fig. 2. Effects of LYRM1 on the mitochondrial DNA (mtDNA) copy number in 3T3-L1 adipocytes. The 3T3-L1 preadipocytes transfected with an empty vector (pcDNA3.1Myc/His B) or the LYRM1 vector were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, cellular mtDNA content was assessed by real-time quantitative PCR analysis with primers designed to target the CYTB and 28S rRNA genes (n = 3). P N 0.05 in comparison with the empty vector.
ΔΨm is another important indicator of mitochondrial function. To provide further evidence of the mitochondrial dysfunction in LYRM1-overexpressing adipocytes, we determined the ΔΨm by staining with MitoTracker Red, a mitochondria-selective probe and measuring it by flow cytometry. As shown in Figs. 6a and b, the LYRM1-overexpressing adipocytes were weakly stained with MitoTracker compared with the VT adipocytes. The ΔΨm was greatly decreased in the LYRM1-overexpressing adipocytes compared with the VT adipocytes. 4. Discussion Obesity is a multifactorial disease resulting from the interactions between susceptibility genes and environmental factors that remain mostly unknown. In an earlier study [4], we identified LYRM1 as a new candidate gene involved in modulating the size of the preadipocyte pool and influencing adipose tissue homeostasis. Our earlier study demonstrated that LYRM1 was expressed at higher levels in obese individuals than in normal-weight controls, and the expression of LYRM1 was higher in the adipose tissue of obese individuals. In
Fig. 3. Effects of LYRM1 on the mitochondrial morphology in 3T3-L1 adipocytes. The 3T3-L1 preadipocytes transfected with an empty vector (pcDNA3.1Myc/His B) or the LYRM1 vector were induced to differentiate as described in the Materials and methods section. The ultrastructure of the mitochondria in the adipocytes was visualized using transmission electron microscopy. The scale bar in the bottom right corner is 1 μm.
398
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
Fig. 4. LYRM1 increases cellular levels of reactive oxygen species (ROS) in adipocytes. The transfected 3T3-L1 preadipocytes were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, the ROS levels in the adipocytes were determined using a FACScan flow cytometer (a; n = 6) and the H2DCFDA probe with a confocal laser scanning microscope (b). *P b 0.001 in comparison with the empty vector.
adipocytes, insulin acts on many steps of glucose metabolism. However, one of its most important effects is the ability to increase the rate of cellular glucose transport [18]. In this study, we found that LYRM1 overexpression could significantly decrease insulin-stimulated glucose transport in mature adipocytes and had no effect on basal glucose uptake. The results, as expected, proved that LYRM1 affected insulin-stimulated glucose uptake and induced insulin resistance in adipocytes.
Fig. 5. Effects of LYRM1 on cellular ATP production. The transfected 3T3-L1 preadipocytes were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, the cellular ATP production was measured and normalized to protein concentrations (n = 6). *P b 0.01 in comparison with the empty vector.
Fig. 6. Effects of LYRM1 on mitochondrial membrane potential (ΔΨm). The transfected 3T3-L1 preadipocytes were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, the mature adipocytes were stained with MitoTracker Red, analyzed with a FACScan flow cytometer (a; n = 6), and then imaged using a confocal laser scanning microscope (b). *P b 0.01 in comparison with the empty vector.
Previous studies have provided strong evidence that mitochondrial dysfunction contributes to insulin resistance [12] and plays an important role in both lipogenesis and lipolysis of adipocytes [19]. Furthermore, it has been reported that the development of mitochondrial dysfunction in adipocytes is an early step in the pathogenesis of obesity-associated insulin resistance [20]. To clarify the relationship between mitochondrial dysfunction and LYRM1-induced insulin resistance in adipocytes, we investigated mtDNA copy number and found no significant difference between the LYRM1-overexpressing adipocytes and the VT adipocytes. To determine whether the mitochondria play a role in the insulin resistance of adipocytes, we assessed the ultrastructure of the mitochondria in LYRM1-overexpressing adipocytes and VT adipocytes by electron microscopy. Mitochondrial morphology is closely related to mitochondrial function and metabolic activity [21]. Notably, LYRM1-overexpressing adipocytes displayed condensed mitochondria with twisted and condensed cristae, swelling, and hollow mitochondria with broken double membranes. Because the mitochondrial cristae are the main sites for mitochondrial metabolism and function, the abnormal morphology of these mitochondria suggests significant cytological changes. These would lead to mitochondrial dysfunction and insulin resistance, despite the lack of a substantial decrease in the mtDNA copy number. Mitochondria are intracellular organelles that generate ATP through the process of oxidative phosphorylation. Because mitochondrial dysfunction and the expression of mitochondrial oxidative phosphorylation genes are related to insulin resistance [22],
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
mutations in mitochondrial genes caused by aging or cellular stress conditions may be one of the mechanisms underlying insulin resistance [12]. ATP production in the mitochondria is coupled to an electron transport system in which the pumping of protons from the matrix into the intermembrane space generates an electrochemical gradient of protons consisting of a ΔΨm and a pH gradient. The mitochondrial ΔΨm is fundamental for the conversion of ADP to ATP via ATP synthase [23]. In this study, we found that the lower cellular ATP production in LYRM1-overexpressing adipocytes was accompanied by a dramatic decrease in mitochondrial ΔΨm. It is likely that the impaired mitochondria in the LYRM1-overexpressing adipocytes resulted in reduced intracellular ATP synthesis and mitochondrial ΔΨm. We still need to know the quantities of ADP and AMP to evaluate the entire energy state of the cell. Mitochondria are the major source of ROS because of the continuous generation of superoxide, a byproduct of the electron transport chain. High concentrations of ROS due to the imbalance between ROS production and removal can directly damage the mitochondrial proteins, DNA, and lipids in membrane components, resulting in mitochondrial dysfunction [24]. ROS, as well as accumulation of lipid metabolites, impair insulin signaling and cause insulin resistance [25]. This damage primarily manifests as decreased mitochondrial ATP synthesis, dysregulation of intracellular lipid homeostasis, and induction of the mitochondrial permeability transition pores [26]. In our study, the level of ROS in the LYRM1overexpressing adipocytes was significantly higher than that in the VT adipocytes. The phenomenon may result from the mitochondrial dysfunction, as seen in the abnormal morphology of the mitochondrial cristae and membranes. Many defects at multiple sites in the insulin signaling pathway have been suggested as mechanisms underlying insulin resistance; one of them is the increased serine phosphorylation of insulin receptor substrate (IRS) proteins [27,28]. Some reports suggest that mitochondrial dysfunction and consequent increases in ROS, in turn, activate various serine kinases that phosphorylate IRS proteins, leading to insulin resistance [29]. Furthermore, ROS stimulates proinflammatory signaling by activation of IκB kinase, which phosphorylates IRS-1 at serine residues. The detailed mechanism for serine kinase activation mediated by ROS is not clearly understood. In summary, our results demonstrated that LYRM1 induced mitochondrial dysfunction in adipocytes. This dysfunction was characterized by lower ATP synthesis and mitochondrial membrane potential, increased ROS level, abnormal mitochondrial morphology, and inhibition of insulin-stimulated glucose transport in mature adipocytes. These findings may provide new insights into the mechanisms of mitochondrial dysfunction in obesity. Furthermore, this gene may be a potential target in the treatment of obesity and obesity-related insulin resistance. Further studies are needed to elucidate the functions and mechanisms in vivo to verify whether abnormalities in LYRM1 expression contribute to mitochondrial dysfunction and insulin resistance. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (grant numbers 30801256 and 81000348), Program of Medical Leading Talent in Jiangsu Province (grant number LJ200624), the Natural Science Foundation of Jiangsu Province (grant number BK2008078), and the Nanjing Municipal Foundation for Medical Science Development (ZKX09012).
399
References [1] R.W. Jeffery, N.E. Sherwood, Is the obesity epidemic exaggerated? No, BMJ 336 (2008) 244–246. [2] A.J. Walley, J.E. Asher, P. Froguel, The genetic contribution to non-syndromic human obesity, Nat. Rev. Genet. 10 (2009) 431–442. [3] J. Qiu, Y.H. Ni, H.X. Gong, Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization, Biochem. Biophys. Res. Commun. 352 (2007) 469–478. [4] J. Qiu, C.L. Gao, M. Zhang, LYRM1, a novel gene promotes proliferation and inhibits apoptosis of preadipocytes, Eur. J. Endocrinol. 160 (2009) 177–184. [5] B.B. Lowell, G.I. Shulman, Mitochondrial dysfunction and type 2 diabetes, Science 307 (2005) 384–387. [6] J.A. Maasen, Mitochondria, body fat and type 2 diabetes: what is the connection? Minerva Med. 99 (2008) 241–251. [7] H.J. Choo, J.H. Kim, O.B. Kwon, C.S. Lee, J.Y. Mun, S.S. Han, Y.S. Yoon, G. Yoon, K.M. Choi, Y.G. Ko, Mitochondria are impaired in the adipocytes of type 2 diabetic mice, Diabetologia 49 (2006) 784–791. [8] A. Hammarstedt, P.A. Jansson, C. Wesslau, X. Yang, U. Smith, Reduced expression of PGC-1 and insulin-signaling molecules in adipose tissue is associated with insulin resistance, Biochem. Biophys. Res. Commun. 301 (2003) 578–582. [9] I. Dahlman, M. Forsgren, A. Sjogren, Downregulation of electron transport chain genes in visceral adipose tissue in type 2 diabetes independent of obesity and possibly involving tumor necrosis factor-alpha, Diabetes 55 (2006) 1792–1799. [10] R.S. Rector, J.P. Thyfault, G.M. Uptergrove, Mitochondrial dysfunction precedes insulin resistance and hepatic steatosis and contributes to the natural history of non-alcoholic fatty liver disease in an obese rodent model, J. Hepatol. 52 (2010) 727–736. [11] P. Schrauwen, M.K. Hesselink, Oxidative capacity, lipotoxicity, and mitochondrial damage in type 2 diabetes, Diabetes 53 (2004) 1412–1417. [12] J.A. Kim, Y. Wei, J.R. Sowers, Role of mitochondrial dysfunction in insulin resistance, Circ. Res. 102 (2008) 401–414. [13] R.B. Ceddia, R. Somwar, A. Maida, X. Fanq, G. Bikopouls, G. Sweeney, Globular adiponectin increases GLUT4 translocation and glucose uptake but reduces glycogen synthesis in rat skeletal muscle cells, Diabetoloqia 48 (2005) 132–139. [14] M. Kaaman, L.M. Sparks, V. Harmelen, S.R. Smith, E. Sjölin, I. Dahlman, P. Arner, Strong association between mitochondrial DNA copy number and lipogenesis in human white adipose tissue, Diabetologia 50 (2007) 2526–2533. [15] D.P. Maxwell, Y. Wang, L. McIntosh, The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells, Proc. Natl Acad. Sci. USA 96 (1999) 8271–8276. [16] E.D. Robin, R. Wong, Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells, J. Cell. Physiol. 136 (1988) 507–513. [17] C. Bonnard, A. Durand, S. Peyrol, Mitochondrial dysfunction results from oxidative stress in the skeletal muscle of diet-induced insulin-resistant mice, J. Clin. Invest. 118 (2008) 789–800. [18] P.H. Ducluzeau, L.M. Fletcher, H. Vidal, M. Laville, J.M. Tavaré, Molecular mechanisms of insulin-stimulated glucose uptake in adipocytes, Diabetes Metab. 28 (2002) 85–92. [19] A. De Pauw, S. Tejerina, M. Raes, Mitochondrial (dys)function in adipocyte(de) differentiation and systemic metabolic alterations, Am. J. Pathol. 175 (2009) 927–939. [20] A. Guilherme, J.V. Virbasius, V. Puri, M.P. Czech, Adipocyte dysfunctions linking obesity to insulin resistance and type 2 diabetes, Nat. Rev. Mol. Cell Biol. 9 (2008) 367–377. [21] J.B. Brocard, G.L. Rintoul, I.J. Reynolds, New perspectives on mitochondrial morphology in cell function, Biol. Cell 95 (2003) 239–242. [22] K.F. Petersen, D. Befroy, S. Dufour, J. Dziura, C. Ariyan, D.L. Rothman, L. DiPietro, G.W. Cline, G.I. Shulman, Mitochondrial dysfunction in the elderly: possible role in insulin resistance, Science 300 (2003) 1140–1142. [23] G.C. Brown, Control of respiration and ATP synthesis in mammalian mitochondria and cells, Biochem. J. 284 (1992) 1–13. [24] K.B. Choksi, W.H. Boylston, J.P. Rabek, W.R. Widger, J. Papaconstantinou, Oxidatively damaged proteins of heart mitochondrial electron transportcomplexes, Biochim. Biophys. Acta 1688 (2004) 95–101. [25] L.E. Fridlyand, L.H. Philipson, Reactive species and early manifestation of insulin resistance in type 2 diabetes, Diabetes Obes. Metab. 8 (2006) 136–145. [26] V.P. Skulachev, Mitochondrial physiology and pathology; concepts of programmed death of organelles, cells and organisms, Mol. Aspects Med. 20 (1999) 139–184. [27] Y. Zick, Ser/Thr phosphorylation of IRS proteins: a molecular basis for insulin resistance, Sci. STKE 268 (2005) pe4. [28] A.R. Saltiel, C.R. Kahn, Insulin signalling and the regulation of glucose and lipid metabolism, Nature 414 (2001) 799–806. [29] K. Morino, K.F. Petersen, S. Dufour, D. Befroy, J. Frattini, N. Shatzkes, S. Neschen, M.F. White, S. Bilz, S. Sono, M. Pypaert, G.I. Shulman, Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents, J. Clin. Invest. 115 (2005) 3587–3593.
Contents lists available at ScienceDirect
Molecular Genetics and Metabolism j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / y m g m e
Overexpression of LYRM1 induces mitochondrial impairment in 3T3-L1 adipocytes Xin-Guo Cao a,1, Chun-Zhao Kou b,1, Ya-Ping Zhao b, Chun-Lin Gao b, Chun Zhu a, Chun-Mei Zhang a, Chen-Bo Ji b, Da-Ni Qin a, Min Zhang a,⁎, Xi-Rong Guo b,⁎ a b
Nanjing Maternal and Child Health Hospital of Nanjing Medical University, Nanjing 210004, China Institute of Pediatrics, Nanjing Medical University, Nanjing 210029, China
a r t i c l e
i n f o
Article history: Received 10 August 2010 Accepted 10 August 2010 Available online 19 August 2010 Keywords: LYRM1 3T3-L1 adipocyte Insulin resistance Mitochondrial dysfunction
a b s t r a c t Homo sapiens LYR motif containing 1 (LYRM1) is a recently discovered gene involved in adipose tissue homeostasis and obesity-associated insulin resistance. The exact mechanism by which LYRM1 induces insulin resistance has not yet been fully elucidated. In this study, we demonstrated that the overexpression of LYRM1 in 3T3-L1 adipocytes resulted in reduced insulin-stimulated glucose uptake, an abnormal mitochondrial morphology, and a decrease in intracellular ATP synthesis and mitochondrial membrane potential. In addition, LYRM1 overexpression led to excessive production of intracellular of reactive oxygen species. Collectively, our results indicated that the overexpression of LYRM1 caused mitochondrial dysfunction in adipocytes, which might be responsible for the development of LYRM1-induced insulin resistance. © 2010 Elsevier Inc. All rights reserved.
1. Introduction Obesity has become an important global public health problem in the recent decades [1]. Common obesity (complex polygenic obesity) results from interactions between genetic, environmental, and psychosocial factors [2]. Identifying the genes involved in obesity would help elucidate the genetic basis of the disease. In our earlier studies, we isolated and characterized LYRM1, a novel human gene that was expressed at a high level in the omental adipose tissue of obese patients. The 122-amino-acid LYRM1 protein is encoded by a 4-exon gene mapped to chromosome 16. There is evidence showing that LYRM1 promotes preadipocyte proliferation and inhibits apoptosis of preadipocytes [3,4]. To date, there are no reports on LYRM1 and insulin-stimulated glucose uptake. A series of diverse experiments support the notion that mitochondrial defects play a critical role in obesity-associated insulin resistance [5,6]. One study demonstrated that obesity/diabetes is accompanied by impaired mitochondria in the adipose tissue of db/db mice [7]. Mitochondrial dysfunction in adipose tissue has been linked to obesity/diabetes in humans as well [8,9]. Hepatic mitochondrial dysfunction precedes the development of nonalcoholic fatty liver disease and insulin resistance in Otsuka Long-Evans Tokushima Fatty rats [10]. A study proposed that the molecular mechanism for insulin resistance caused by mitochondrial dysfunction involves the accumulation of lipid metabolites and an increase in the reactive oxygen species (ROS) attributable to the mitochondrial dysfunction-activated ⁎ Corresponding authors. E-mail addresses: [email protected] (M. Zhang), [email protected] (X.-R. Guo). 1 These authors contributed equally to this work. 1096-7192/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ymgme.2010.08.010
serine/threonine kinase. This leads to an increase in the serine phosphorylation of insulin receptor substrate-1 (IRS-1), which, in turn, blocks the tyrosine phosphorylation of IRS-1 and subsequently results in insulin resistance [11]. Genetic factors, oxidative stress, mitochondrial biogenesis, and aging may affect mitochondrial function, leading to insulin resistance and various pathological conditions [12]. The purpose of this study was to investigate the relationship between LYRM1, insulin-stimulated glucose uptake, and mitochondrial dysfunction in 3T3-L1 adipocytes. 2. Materials and methods 2.1. Cell culture and differentiation of 3T3-L1 preadipocytes 3T3-L1 preadipocytes were stably transfected with either an empty expression vector (pcDNA3.1Myc/His B) or a LYRM1 expression vector as described previously [4]. Three colonies expressing LYRM1 and three with the empty vector were selected for study. The transfected cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco Laboratories, Grand Island, NY, USA) supplemented with 10% calf serum (Gibco, Carlsbad, CA, USA) and 100 μg/mL neomycin (G418; Roche, Basel, Switzerland). Two days after complete confluence (day 0), the cells were cultured for 48 h in DMEM supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), 0.5 mmol/L 1-methyl-3-isobutylxanthine (Sigma, St. Louis, MO, USA), 1 μmol/L dexamethasone (Sigma, St. Louis, MO, USA), 10 μg/mL insulin (Sigma, St. Louis, MO, USA), and 100 μg/mL G418. From day 2 to day 4, the medium was supplemented with 10% fetal bovine serum and 10 μg/mL insulin. The cells were then transferred to DMEM containing 10% FBS and 100 μg/mL G418 for the remaining culture period. The cultures were replenished every
396
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
2 days. Ten days after the induction of differentiation, more than 90% of the cells exhibited typical adipocyte morphology. 2.2. Glucose uptake Uptake of 2-deoxy-D-[3H]glucose (Amersham Biosciences, Piscataway, NJ, USA) was assayed as described previously but with minor modifications [13]. The stably transfected cells were cultured in sixwell plates and induced into mature adipocytes. On day 10 of differentiation, the cells were serum-starved in DMEM containing 0.5% FBS for 3 h. The cells were then washed twice with phosphatebuffered saline (PBS) and incubated in KRP–HEPES buffer [30 mmol/L HEPES (pH 7.4), 10 mmol/L NaHCO3, 120 mmol/L NaCl, 4 mmol/L KH2PO4, 1 mmol/L MgSO4, and 1 mmol/L CaCl2] in the presence or absence of 100 nmol/L insulin for 30 min at 37 °C. Labeled 2-deoxy-D[3H]glucose was added to produce a final concentration of 2 μCi/mL. After 10 min at 37 °C, the reaction was terminated by washing 3 times with ice-cold PBS supplemented with 10 mmol/L D-glucose. The cells were solubilized by adding 200 μL of 1 mol/L NaOH to each well, and aliquots of the cell lysate were transferred to scintillation vials for radioactivity counting; the remainder was used for a protein assay with the bicinchonic acid protein assay kit (Pierce, Rockford, IL, USA), and the radioactivity was normalized by protein concentration. 2.3. Electron microscopy On the tenth day of differentiation, the mature adipocytes were collected after trypsin digestion, washed in fresh PBS (pH 7.4), and fixed in a buffer containing 2.5% (vol./vol.) glutaraldehyde and 4% (vol./vol.) paraformaldehyde. The cells were then washed in 0.1 M cacodylate buffer, postfixed with 1% (wt./vol.) osmium tetroxide and 1.5% (wt./vol.) potassium ferrocyanide for 1 h, washed in water, stained with 1% (vol./vol.) aqueous uranyl acetate for 30 min, and dehydrated through a graded series of ethanol to 100%. The samples were then infiltrated and embedded in TAAB Epon (Marivac Canada Inc., St. Laurent, Canada). Ultrathin sections (60 nm) were cut on a Reichert Ultracut-S microtome, placed onto copper grids stained with uranyl acetate and lead citrate, and examined on a transmission electron microscope (JEOL JEM-1010, Tokyo, Japan) at an accelerating voltage of 80 kV. 2.4. Real-time quantitative polymerase chain reaction (qPCR) for mitochondrial DNA (mtDNA) Relative amounts of mtDNA were determined by real-time qPCR as previously described [14]. Briefly, DNA was isolated from adipocytes with a DNA extraction kit (Baitaike, Beijing, China) and quantified by spectrophotometry at 260 nm. Two primer sets were used for PCR analysis. A 110-nucleotide mtDNA fragment within the CYTB gene was used for the quantification of mtDNA. The PCR product has previously been cloned into the plasmid pMD-T 18 and verified by DNA sequencing. Plasmid standards of known copy number were used to generate a log-linear standard curve, from which the CYTB copy numbers of the studied samples could be determined by realtime qPCR performed on an Applied Biosystems 7300 Sequence Detection System (Foster City, CA, USA). A 291-bp region of the
nuclear gene for 28S ribosomal RNA was used to normalize the results. A standard curve of plasmids containing the 28S fragment was used to determine the copy numbers of the studied samples. The ratio of mtDNA to nuclear DNA reflects the concentration of mitochondria per cell. The sequences of the primers and Taqman probes (Invitrogen, Shanghai, China) are shown in Table 1. 2.5. ATP production The transfected 3T3-L1 preadipocytes were induced to differentiate as described above. On the tenth day of differentiation, the ATP content of the adipocytes was measured using a luciferase-based luminescence assay kit (Biyuntian, Nantong, China). Briefly, adipocytes were homogenized in an ice-cold ATP-releasing buffer. Treated adipocytes were mixed with the detection reagent for 5 min. Using an ATP standard, ATP concentrations were then determined with a single-tube luminometer (Turner Biosystems, CA, USA) and normalized to protein concentrations. 2.6. Confocal laser microscopy MitoTracker, a red mitochondria-specific cationic fluorescent dye (Molecular Probes, Invitrogen, Carlsbad, CA, USA), was used to evaluate the mitochondrial membrane potential (ΔΨm). The H2DCFDA probe (Sigma, St. Louis, MO, USA) was used to estimate the intracellular ROS levels [15]. On the tenth day of differentiation, the transfected 3T3-L1 adipocytes were incubated with 150 nM of MitoTracker and 5 μM of H2-DCFDA for 30 min at 37 °C and then washed three times with warm PBS. Cells were imaged using a confocal laser scanning microscope (Zeiss, Gottingen, Germany). 2.7. Flow cytometry On the tenth day of differentiation, the transfected 3T3-L1 adipocytes were incubated with 150 nM of MitoTracker and 5 μM of H2-DCFDA at 37 °C. After 30 min, cultured cells were trypsinized and centrifuged at 1000 rpm at 4 °C for 5 min, then resuspended in Krebs– Ringer solution buffered with 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) and 0.5% bovine serum albumin. Cells were analyzed with a FACScan flow cytometer using the CellQuest software (BD Biosciences, San Jose, CA, USA). 2.8. Statistical analysis Each experiment was performed at least three times. All values are presented as the mean ± SD. Statistical analyses were performed using a Student's t-test, and P b 0.05 was statistically significant. 3. Results 3.1. Effects of LYRM1 on basal and insulin-stimulated glucose uptake in 3T3-L1 adipocytes To determine whether LYRM1 affects insulin sensitivity, we assessed glucose uptake in differentiated 3T3-L1 adipocytes. In LYRM1-overexpressing cells, basal glucose uptake was similar to that observed in the controls. However, in LYRM1-overexpressing
Table 1 Sequences for primer/probe sets used in qPCR. Gene
Forward primer (5′–3′)
Probe
Reverse primer (5′-3′)
Cyt B
TTTTATCTGCATCTGAGTTT AATCCTGT GGCGGCCAAGCGTTCATAG
AGCAATCGTTCACCTC CTCTTCCTCCAC TGGTAGCTTCGCCCCAT TGGCTCCT
CCACTTCATCTTACCATTTATTATCGC
28S
AGGCGTTCAGTCATAATCCCACAG
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
397
cells, insulin-stimulated glucose uptake was approximately 40% lower than that in the controls (Fig. 1). 3.2. Effects of LYRM1 on mtDNA copy number and mitochondrial morphology in 3T3-L1 adipocytes The mtDNA copy number per mitochondrion is generally considered to be constant in most mammalian cell types [16]. The mtDNA copy number is regarded as the cellular mitochondrial number and could be a possible surrogate marker of mitochondrial function. Using real-time qPCR, we assessed the effects of LYRM1 on mtDNA copy number. The results showed that the mtDNA copy number in LYRM1overexpressing 3T3-L1 adipocytes was not significantly lower than that in vector-transfected (VT) adipocytes (Fig. 2). To extend the findings of mitochondrial number, we investigated the morphology of the mitochondria using electron microscopy. As shown in Fig. 3, the mitochondria in LYRM1-overexpressing cells showed abnormal morphology, with a smaller size and twisted, condensed cristae, compared to those in VT adipocytes. Notably, signs of mitochondrial damage ranged from swelling and reduced density to virtually hollow mitochondria with broken double membranes. 3.3. LYRM1 overexpression increased ROS levels in 3T3-L1 adipocytes A causative link has been proposed between elevated mitochondrial ROS generation and mitochondrial dysfunction and insulin resistance [17]. To elucidate whether ROS are involved in the dysfunction of mitochondria in LYRM1-overexpressing adipocytes, we measured the ROS levels in LYRM1-overexpressing adipocytes and VT adipocytes. As shown in Figs. 4a and b, ROS levels in the LYRM1overexpressing adipocytes were much higher than in the VT adipocytes. LYRM1 dramatically increased the ROS levels. 3.4. LYRM1 overexpression decreased ATP production and ΔΨm in 3T3L1 adipocytes In adipocytes, mitochondria produce N95% of the cellular ATP required for triglyceride synthesis and adipocyte synthesis and secretion, besides other general cellular processes [16]. Impaired mitochondria may lead to a lack of ATP. As expected for cells with abnormal mitochondria, we found that the total cellular ATP production was dramatically decreased in LYRM1-overexpressing adipocytes (Fig. 5).
Fig. 1. Effect of LYRM1 on glucose uptake. 3T3-L1 preadipocytes transfected with LYRM1 or the empty vector (pcDNA3.1Myc/His B) were induced to differentiate, and the 2deoxy-D-[3H]glucose uptake was measured as described in the Materials and methods section. The cellular glucose uptake was measured and normalized to protein concentrations (n = 6). *P b 0.001 in comparison with insulin-stimulated control (cells transfected with the empty vector).
Fig. 2. Effects of LYRM1 on the mitochondrial DNA (mtDNA) copy number in 3T3-L1 adipocytes. The 3T3-L1 preadipocytes transfected with an empty vector (pcDNA3.1Myc/His B) or the LYRM1 vector were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, cellular mtDNA content was assessed by real-time quantitative PCR analysis with primers designed to target the CYTB and 28S rRNA genes (n = 3). P N 0.05 in comparison with the empty vector.
ΔΨm is another important indicator of mitochondrial function. To provide further evidence of the mitochondrial dysfunction in LYRM1-overexpressing adipocytes, we determined the ΔΨm by staining with MitoTracker Red, a mitochondria-selective probe and measuring it by flow cytometry. As shown in Figs. 6a and b, the LYRM1-overexpressing adipocytes were weakly stained with MitoTracker compared with the VT adipocytes. The ΔΨm was greatly decreased in the LYRM1-overexpressing adipocytes compared with the VT adipocytes. 4. Discussion Obesity is a multifactorial disease resulting from the interactions between susceptibility genes and environmental factors that remain mostly unknown. In an earlier study [4], we identified LYRM1 as a new candidate gene involved in modulating the size of the preadipocyte pool and influencing adipose tissue homeostasis. Our earlier study demonstrated that LYRM1 was expressed at higher levels in obese individuals than in normal-weight controls, and the expression of LYRM1 was higher in the adipose tissue of obese individuals. In
Fig. 3. Effects of LYRM1 on the mitochondrial morphology in 3T3-L1 adipocytes. The 3T3-L1 preadipocytes transfected with an empty vector (pcDNA3.1Myc/His B) or the LYRM1 vector were induced to differentiate as described in the Materials and methods section. The ultrastructure of the mitochondria in the adipocytes was visualized using transmission electron microscopy. The scale bar in the bottom right corner is 1 μm.
398
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
Fig. 4. LYRM1 increases cellular levels of reactive oxygen species (ROS) in adipocytes. The transfected 3T3-L1 preadipocytes were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, the ROS levels in the adipocytes were determined using a FACScan flow cytometer (a; n = 6) and the H2DCFDA probe with a confocal laser scanning microscope (b). *P b 0.001 in comparison with the empty vector.
adipocytes, insulin acts on many steps of glucose metabolism. However, one of its most important effects is the ability to increase the rate of cellular glucose transport [18]. In this study, we found that LYRM1 overexpression could significantly decrease insulin-stimulated glucose transport in mature adipocytes and had no effect on basal glucose uptake. The results, as expected, proved that LYRM1 affected insulin-stimulated glucose uptake and induced insulin resistance in adipocytes.
Fig. 5. Effects of LYRM1 on cellular ATP production. The transfected 3T3-L1 preadipocytes were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, the cellular ATP production was measured and normalized to protein concentrations (n = 6). *P b 0.01 in comparison with the empty vector.
Fig. 6. Effects of LYRM1 on mitochondrial membrane potential (ΔΨm). The transfected 3T3-L1 preadipocytes were induced to differentiate as described in the Materials and methods section. On the tenth day of differentiation, the mature adipocytes were stained with MitoTracker Red, analyzed with a FACScan flow cytometer (a; n = 6), and then imaged using a confocal laser scanning microscope (b). *P b 0.01 in comparison with the empty vector.
Previous studies have provided strong evidence that mitochondrial dysfunction contributes to insulin resistance [12] and plays an important role in both lipogenesis and lipolysis of adipocytes [19]. Furthermore, it has been reported that the development of mitochondrial dysfunction in adipocytes is an early step in the pathogenesis of obesity-associated insulin resistance [20]. To clarify the relationship between mitochondrial dysfunction and LYRM1-induced insulin resistance in adipocytes, we investigated mtDNA copy number and found no significant difference between the LYRM1-overexpressing adipocytes and the VT adipocytes. To determine whether the mitochondria play a role in the insulin resistance of adipocytes, we assessed the ultrastructure of the mitochondria in LYRM1-overexpressing adipocytes and VT adipocytes by electron microscopy. Mitochondrial morphology is closely related to mitochondrial function and metabolic activity [21]. Notably, LYRM1-overexpressing adipocytes displayed condensed mitochondria with twisted and condensed cristae, swelling, and hollow mitochondria with broken double membranes. Because the mitochondrial cristae are the main sites for mitochondrial metabolism and function, the abnormal morphology of these mitochondria suggests significant cytological changes. These would lead to mitochondrial dysfunction and insulin resistance, despite the lack of a substantial decrease in the mtDNA copy number. Mitochondria are intracellular organelles that generate ATP through the process of oxidative phosphorylation. Because mitochondrial dysfunction and the expression of mitochondrial oxidative phosphorylation genes are related to insulin resistance [22],
X.-G. Cao et al. / Molecular Genetics and Metabolism 101 (2010) 395–399
mutations in mitochondrial genes caused by aging or cellular stress conditions may be one of the mechanisms underlying insulin resistance [12]. ATP production in the mitochondria is coupled to an electron transport system in which the pumping of protons from the matrix into the intermembrane space generates an electrochemical gradient of protons consisting of a ΔΨm and a pH gradient. The mitochondrial ΔΨm is fundamental for the conversion of ADP to ATP via ATP synthase [23]. In this study, we found that the lower cellular ATP production in LYRM1-overexpressing adipocytes was accompanied by a dramatic decrease in mitochondrial ΔΨm. It is likely that the impaired mitochondria in the LYRM1-overexpressing adipocytes resulted in reduced intracellular ATP synthesis and mitochondrial ΔΨm. We still need to know the quantities of ADP and AMP to evaluate the entire energy state of the cell. Mitochondria are the major source of ROS because of the continuous generation of superoxide, a byproduct of the electron transport chain. High concentrations of ROS due to the imbalance between ROS production and removal can directly damage the mitochondrial proteins, DNA, and lipids in membrane components, resulting in mitochondrial dysfunction [24]. ROS, as well as accumulation of lipid metabolites, impair insulin signaling and cause insulin resistance [25]. This damage primarily manifests as decreased mitochondrial ATP synthesis, dysregulation of intracellular lipid homeostasis, and induction of the mitochondrial permeability transition pores [26]. In our study, the level of ROS in the LYRM1overexpressing adipocytes was significantly higher than that in the VT adipocytes. The phenomenon may result from the mitochondrial dysfunction, as seen in the abnormal morphology of the mitochondrial cristae and membranes. Many defects at multiple sites in the insulin signaling pathway have been suggested as mechanisms underlying insulin resistance; one of them is the increased serine phosphorylation of insulin receptor substrate (IRS) proteins [27,28]. Some reports suggest that mitochondrial dysfunction and consequent increases in ROS, in turn, activate various serine kinases that phosphorylate IRS proteins, leading to insulin resistance [29]. Furthermore, ROS stimulates proinflammatory signaling by activation of IκB kinase, which phosphorylates IRS-1 at serine residues. The detailed mechanism for serine kinase activation mediated by ROS is not clearly understood. In summary, our results demonstrated that LYRM1 induced mitochondrial dysfunction in adipocytes. This dysfunction was characterized by lower ATP synthesis and mitochondrial membrane potential, increased ROS level, abnormal mitochondrial morphology, and inhibition of insulin-stimulated glucose transport in mature adipocytes. These findings may provide new insights into the mechanisms of mitochondrial dysfunction in obesity. Furthermore, this gene may be a potential target in the treatment of obesity and obesity-related insulin resistance. Further studies are needed to elucidate the functions and mechanisms in vivo to verify whether abnormalities in LYRM1 expression contribute to mitochondrial dysfunction and insulin resistance. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (grant numbers 30801256 and 81000348), Program of Medical Leading Talent in Jiangsu Province (grant number LJ200624), the Natural Science Foundation of Jiangsu Province (grant number BK2008078), and the Nanjing Municipal Foundation for Medical Science Development (ZKX09012).
399
References [1] R.W. Jeffery, N.E. Sherwood, Is the obesity epidemic exaggerated? No, BMJ 336 (2008) 244–246. [2] A.J. Walley, J.E. Asher, P. Froguel, The genetic contribution to non-syndromic human obesity, Nat. Rev. Genet. 10 (2009) 431–442. [3] J. Qiu, Y.H. Ni, H.X. Gong, Identification of differentially expressed genes in omental adipose tissues of obese patients by suppression subtractive hybridization, Biochem. Biophys. Res. Commun. 352 (2007) 469–478. [4] J. Qiu, C.L. Gao, M. Zhang, LYRM1, a novel gene promotes proliferation and inhibits apoptosis of preadipocytes, Eur. J. Endocrinol. 160 (2009) 177–184. [5] B.B. Lowell, G.I. Shulman, Mitochondrial dysfunction and type 2 diabetes, Science 307 (2005) 384–387. [6] J.A. Maasen, Mitochondria, body fat and type 2 diabetes: what is the connection? Minerva Med. 99 (2008) 241–251. [7] H.J. Choo, J.H. Kim, O.B. Kwon, C.S. Lee, J.Y. Mun, S.S. Han, Y.S. Yoon, G. Yoon, K.M. Choi, Y.G. Ko, Mitochondria are impaired in the adipocytes of type 2 diabetic mice, Diabetologia 49 (2006) 784–791. [8] A. Hammarstedt, P.A. Jansson, C. Wesslau, X. Yang, U. Smith, Reduced expression of PGC-1 and insulin-signaling molecules in adipose tissue is associated with insulin resistance, Biochem. Biophys. Res. Commun. 301 (2003) 578–582. [9] I. Dahlman, M. Forsgren, A. Sjogren, Downregulation of electron transport chain genes in visceral adipose tissue in type 2 diabetes independent of obesity and possibly involving tumor necrosis factor-alpha, Diabetes 55 (2006) 1792–1799. [10] R.S. Rector, J.P. Thyfault, G.M. Uptergrove, Mitochondrial dysfunction precedes insulin resistance and hepatic steatosis and contributes to the natural history of non-alcoholic fatty liver disease in an obese rodent model, J. Hepatol. 52 (2010) 727–736. [11] P. Schrauwen, M.K. Hesselink, Oxidative capacity, lipotoxicity, and mitochondrial damage in type 2 diabetes, Diabetes 53 (2004) 1412–1417. [12] J.A. Kim, Y. Wei, J.R. Sowers, Role of mitochondrial dysfunction in insulin resistance, Circ. Res. 102 (2008) 401–414. [13] R.B. Ceddia, R. Somwar, A. Maida, X. Fanq, G. Bikopouls, G. Sweeney, Globular adiponectin increases GLUT4 translocation and glucose uptake but reduces glycogen synthesis in rat skeletal muscle cells, Diabetoloqia 48 (2005) 132–139. [14] M. Kaaman, L.M. Sparks, V. Harmelen, S.R. Smith, E. Sjölin, I. Dahlman, P. Arner, Strong association between mitochondrial DNA copy number and lipogenesis in human white adipose tissue, Diabetologia 50 (2007) 2526–2533. [15] D.P. Maxwell, Y. Wang, L. McIntosh, The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells, Proc. Natl Acad. Sci. USA 96 (1999) 8271–8276. [16] E.D. Robin, R. Wong, Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells, J. Cell. Physiol. 136 (1988) 507–513. [17] C. Bonnard, A. Durand, S. Peyrol, Mitochondrial dysfunction results from oxidative stress in the skeletal muscle of diet-induced insulin-resistant mice, J. Clin. Invest. 118 (2008) 789–800. [18] P.H. Ducluzeau, L.M. Fletcher, H. Vidal, M. Laville, J.M. Tavaré, Molecular mechanisms of insulin-stimulated glucose uptake in adipocytes, Diabetes Metab. 28 (2002) 85–92. [19] A. De Pauw, S. Tejerina, M. Raes, Mitochondrial (dys)function in adipocyte(de) differentiation and systemic metabolic alterations, Am. J. Pathol. 175 (2009) 927–939. [20] A. Guilherme, J.V. Virbasius, V. Puri, M.P. Czech, Adipocyte dysfunctions linking obesity to insulin resistance and type 2 diabetes, Nat. Rev. Mol. Cell Biol. 9 (2008) 367–377. [21] J.B. Brocard, G.L. Rintoul, I.J. Reynolds, New perspectives on mitochondrial morphology in cell function, Biol. Cell 95 (2003) 239–242. [22] K.F. Petersen, D. Befroy, S. Dufour, J. Dziura, C. Ariyan, D.L. Rothman, L. DiPietro, G.W. Cline, G.I. Shulman, Mitochondrial dysfunction in the elderly: possible role in insulin resistance, Science 300 (2003) 1140–1142. [23] G.C. Brown, Control of respiration and ATP synthesis in mammalian mitochondria and cells, Biochem. J. 284 (1992) 1–13. [24] K.B. Choksi, W.H. Boylston, J.P. Rabek, W.R. Widger, J. Papaconstantinou, Oxidatively damaged proteins of heart mitochondrial electron transportcomplexes, Biochim. Biophys. Acta 1688 (2004) 95–101. [25] L.E. Fridlyand, L.H. Philipson, Reactive species and early manifestation of insulin resistance in type 2 diabetes, Diabetes Obes. Metab. 8 (2006) 136–145. [26] V.P. Skulachev, Mitochondrial physiology and pathology; concepts of programmed death of organelles, cells and organisms, Mol. Aspects Med. 20 (1999) 139–184. [27] Y. Zick, Ser/Thr phosphorylation of IRS proteins: a molecular basis for insulin resistance, Sci. STKE 268 (2005) pe4. [28] A.R. Saltiel, C.R. Kahn, Insulin signalling and the regulation of glucose and lipid metabolism, Nature 414 (2001) 799–806. [29] K. Morino, K.F. Petersen, S. Dufour, D. Befroy, J. Frattini, N. Shatzkes, S. Neschen, M.F. White, S. Bilz, S. Sono, M. Pypaert, G.I. Shulman, Reduced mitochondrial density and increased IRS-1 serine phosphorylation in muscle of insulin-resistant offspring of type 2 diabetic parents, J. Clin. Invest. 115 (2005) 3587–3593.