- Email: [email protected]
Oxidized Low-Density Lipoprotein Increases Bone Sialoprotein Expression in Vascular Smooth Muscle Cells Via Runt-Related Transcription Factor 2
BASIC INVESTIGATION
Oxidized Low-Density Lipoprotein Increases Bone Sialoprotein Expression in Vascular Smooth Muscle Cells Via Runt-Related Transcription Factor 2 Effat Farrokhi, Keihan G. Samani, PhD and Morteza H. Chaleshtori, PhD
Abstract: Background: Vascular calcification is a pivotal stage in atherosclerosis. During vascular calcification, vascular smooth muscle cells (VSMCs) synthesize many osteogenic factors such as bone sialoprotein (BSP). Oxidative stress plays a critical role in progression of atherosclerosis and also increases extracellular matrix proteins expression. BSP overexpression has been observed during vascular calcification by oxidative stress. However, the regulatory mechanism of oxidized low-density lipoprotein (oxLDL)-mediated vascular calcification has not yet been fully defined. In this study, we aimed to investigate whether runt-related transcription factor 2 (Runx2) affects the oxLDLinduced BSP expression or not. Methods: In this experimental study, we cultured VSMCs in F12K media and then treated them with oxLDL. The expression of Runx2 and BSP genes was determined by real-time polymerase chain reaction method. Protein level of each gene was investigated by Western blotting technique. To determine whether Runx2 regulates BSP gene expression at VSMCs induced by oxLDL, we suppressed Runx2 mRNA using siRNA. Transfected cells then were treated with oxLDL and expression of Runx2 and BSP genes was determined again. Results: oxLDL increased Runx2 and BSP expression (4.8 6 0.47-fold and 4.91 6 0.56-fold, respectively) after 48 hours. Western blotting method confirmed the increased levels of Runx2 and BSP proteins after 48 hours. Runx2 overexpression alone induced BSP expression, whereas knockdown of Runx2 with small interfering siRNA blocked oxLDL-induced BSP expression. Conclusions: Our results showed that oxLDL-induced BSP expression was dependent on Runx2 expression, suggesting that Runx2 is required for oxLDL-induced BSP expression. Key Indexing Terms: Vascular calcification; Oxidized low-density lipoprotein; Bone sialoprotein; Runx2. [Am J Med Sci 2015;349 (3):240–243.]
V
ascular calcification is one of the problems in cardiovascular diseases as it reduces vascular wall elasticity and leads to heart attacks. Vascular smooth muscle cells (VSMCs) play a significant role in vascular calcification by migration, proliferation and secretion of matrix components.1 During vascular calcification, VSMC differentiates to osteoblast-like phenotype and synthesize many osteogenic factors, including osteocalcin, alkaline phosphatase (ALP), bone morphogenetic proteins and bone sialoprotein (BSP).2 BSP, a bone-associated protein is involved in the initiation of atheroFrom the Cellular and Molecular Research Center (EF, MHC), Shahrekord University of Medical Sciences, Shahrekord, Iran; and Clinical Biochemistry Research Center (KGS), Shahrekord University of Medical Sciences, Shahrekord, Iran. Submitted May 15, 2014; accepted in revised form September 26, 2014. Supported by Shahrekord University of Medical Sciences, Shahrekord, Iran. The authors have no other conflicts of interest to disclose. Correspondence: Keihan Ghatreh Samani, PhD, Clinical Biochemistry Research Center, Shahrekord University of Medical Sciences, Rahmatiah, Shahrekord, Iran, Postal Code;8813833435 (E-mail: [email protected]).
240
sclerosis. It has been suggested that BSP exhibits hydroxyapatite nucleation activity3,4 and may play important roles in the initiation and calcification of atherosclerosis. Microarray analysis reveals overexpression of BSP in human carotid plaques.5 Many factors that play a role in induction of VSMCs to osteoblast differentiation have already been identified. It has been shown that oxidized low-density lipoprotein (oxLDL) has a critical role in the pathogenesis and development of atherosclerosis6,7 and induces osteogenic factors expression in atheroma formation.8,9 Runt-related transcription factor 2 (Runx2) is a key transcription factor for osteoblast differentiation and regulates the expressions of many osteogenic factors.10,11 In vitro studies have demonstrated that Runx2 plays an essential role in oxidative stress-induced VSMC calcification and Runx2 alone is sufficient to induce VSMC calcification.12 However, the potential link between BSP expression and oxidative stress-induced vascular calcification has not been examined. We hypothesize that oxLDL upregulates BSP expression in human VSMCs through Runx2.
MATERIALS AND METHODS The human aorta vascular smooth muscle cells (HA/ VSMCs) and F12K media were purchased from Pasteur Institute of Iran. OxLDL was purchased from Biomedical Technologies (Stoughton, MA). SYBR Green PCR Master Mix, cDNA synthesis kit and DNase were obtained from Thermo Fisher Scientific (Waltham, MA). Trizol was obtained from Invitrogen (Invitrogen, Carlsbad, California). SiRNAs, opti-MEM and lipofectanine were purchased from Invitrogen (Ambion, Austin, TX, USA). FITC (fluorescein isothiocyanate)-conjugated siRNA was obtained from Santa Cruz Biotechnology. Anti-Runx2, anti-BSP, anti-beta actin and secondary antibody were obtained from Abcam (Cambridge, United Kingdom). 3,39,5,59-tetramethylbenzidine (BM blue) was purchased from Roche (Mannheim, Germany). Cell Culture, RNA Isolation and cDNA Synthesis In this experimental study, HA/VSMC were maintained in F12K media. F12K media contained 0.05 mg/mL ascorbic acid, 0.01 mg/mL insulin, 0.01 mg/mL transferrin, 10 ng/mL sodium selenite, 0.03 mg/mL endothelial cell growth supplement, FBS to a final concentration of 10%, HEPES to a final concentration of 10 mM, TES to a final concentration of 10 mM, 100 U/mL penicillin, 100 mg/mL streptomycin and 0.01% amphotericin B. Cells were incubated in a humidified atmosphere containing 5% CO2 at 37°C. Daily control of cell growth and cell division in culture condition were done. Cells used for the experiments were 3 to 7 passages. To induce VSMC calcification, the cells were incubated in the presence of 10 Mm b-glycerophosphate for 12 days. Cells were seeded in a 12-well plate at a density of 10,000 cells per well. When the cells achieved approximately
The American Journal of the Medical Sciences
Volume 349, Number 3, March 2015
oxLDL Increases BSP Expression by Runx2
80% confluence, they were co-cultured with oxLDL (100 mg/mL). Control cells were cultured in media containing b-glycerophosphate without oxLDL. After 24 and 48 hours, total RNA was extracted from the cells using Trizol according to the manufacturer instructions. RNA was quantified using a Nanodrop 2000C spectrophotometer (Thermo Scientific) and treated with DNase. Then cDNA was synthesized from 0.5 mg total RNA using random primer and the Rever Aid First Standard cDNA Synthesis kit. Real-Time Polymerase Chain Reaction Quantitative real-time polymerase chain reaction (PCR) was performed using Corbett system and SYBR green method. Primers used for real-time PCR are listed in Table 1. PCRs were performed in triplicate using 5 mL SYBR green PCR Master Mix, 0.2 mL primer sets, 1 mL cDNA and 3.6 mL nuclease-free H2O to yield a 10 mL reaction. The amplification was carried out as follows: initial enzyme activation at 94°C for 10 minutes, then 40 cycles of 95°C for 15 seconds, 59°C for 20 seconds and 72°C for 30 seconds. Quantitation of data was performed using the comparative CT (DDCT) method using GAPDH gene expression as an endogenous reference. Western Blot Cells were washed twice with cold phosphate buffer saline and lysed in ice-cold 63 radio immune precipitation assay buffer. The homogenate was incubated in lysis buffer for 30 minutes and then centrifuged at 12,000 rpm for 10 minutes. The supernatant was used as total cell lysate. Protein concentration was measured spectrophotometrically by nanodrop and equal amounts of protein from each sample were subjected to blotting. Protein lysate was mixed with laemmli buffer, boiled for 5 minutes and separated by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The separated proteins were then transferred to a polyvinylidenedifluoride membrane in tris-glycine buffer for 2 hours at 120 V. The membrane was blocked by 5% nonfat dry milk in Tris-buffered saline, and 0.1% tween-20 overnight at 4°C temperature. Then, the membrane was incubated in Tris-buffered saline, and 0.1% tween-20 containing the primary rabbit polyclonal anti-BSP (1 mg/mL) and primary rabbit polyclonal antiRunx2 at 1:2,000 for 2 hours at room temperature. After washing, the membrane was incubated with goat anti-rabbit IgG horseradish peroxidase conjugate diluted 1:10,000 for 90 minutes at room temperature. Finally, the color was developed with the addition of 3,39,5,59-tetramethylbenzidine membrane peroxidase substrate. The color reaction was stopped by washing the membranes with distilled water. Cell lysates were detected on a separate membrane with actin as a loading control. Runx2 RNA Interference To knockdown Runx2, we used 2 siRNAs (IDs: s2455 and s2456). Runx2 siRNAs, s2455 and s2456, are located in the region of the Runx2 transcript that codes for amino acids 910 to 928 and
1,663 to 1,683 respectively. The oligonucleotide sequences were as follows: s2455: 59-CUUGAUGACUCUAAACC UATT-39 and 59-UAGGUUUAGAGUCAUCAAGCT-39, s2456: 59-CCAAAUUUGCCUAACCAGATT-39and 59-UC UGGUUAGGCAAAUUUGGAT-39. The cells were seeded in a 24-well plate at the density of 20,000 cells per well in growth medium without antibiotics. After 24 hours, the cells were transfected with RNAi duplex— Lipofectamine RNAiMAX complexes made in Opti-MEM according to the manufacturer’s instructions. A 10 nM of each siRNA was used for all transfections. siRNA transfection efficiency was observed by uptake of FITC-labeled siRNA sequence, and scramble oligoribonucleotide duplex that was not homologous to any mammalian genes was used as a control. After 24 hours, the transfection media were removed, and the cells were incubated for an additional 24 hours in normal growth media and then stimulated with oxLDL (100 mg/mL). The cells were harvested for mRNA and protein extraction after 48 hours. Because of a significant increase in BSP expression observed after 48 hours, Runx2 knock-down was only done at 48 hours. Statistical Analysis All experiments were done in triplicate. Statistical analysis was done using nonparametric Kruskal-Wallis test, and pairwise comparisons among groups were performed by Mann-Whitney’s U test. All statistical analyses were performed with Graph Pad Prism5 software. All data were presented as mean 6 standard error of mean, and P , 0.05 was considered as the level of significance.
RESULTS Effect of oxLDL on BSP and Runx2 Expression After treatment of VSMCs with 100 mg/mL oxLDL, the mRNA and protein levels of Runx2 and BSP were detected by quantitative real time-PCR and Western blotting assay. The result showed that oxLDL increased Runx2 expression (2.29 6 0.39-fold and 4.8 6 0.47-fold) and BSP expression (1.46 6 0.45-fold and 4.91 6 0.56-fold) after 24 and 48 hours, respectively (Figures 1A and 1B). The significant increment of BSP gene expression was observed only after 48 hours of treatment. Differences between groups were determined as significant at P , 0.05. Western blot analysis confirmed the changes observed at mRNA level (Figure 1C). In Western blot analysis, beta-actin (42 kDa) was used as internal control. siRNA Transfection To determine whether Runx2 regulates BSP gene expression at VSMCs induced by oxLDL, we suppressed Runx2 mRNA using siRNA. VSMCs were transfected with Runx2 siRNA (siRunx2) or nontargeting control siRNA and then treated with oxLDL. Transfection efficacy was determined using
TABLE 1. Primer sequences and product length Genes Primer sequences (59–39) Runx2 BSP GAPDH
Forward: CGATCTGAGATTTGTGGGCC Reverse: GGGAGGATTTGTGAAGACGG Forward: TGCCTTGAGCCTGCTTCCT Reverse: CTGAGCAAAATTAAAGCAGTCTTCA Forward: ACACCCACTCCTCCACCTTTG Reverse: TCCACCACCCTGTTGCTGTAG
Copyright © 2015 by the Southern Society for Clinical Investigation.
Product length (bp) 76 79 112
241
Farrokhi et al
FIGURE 1. oxLDL upregulated Runx2 and BSP expression in VSMCs. The cells were treated by oxLDL for 24 and 48 hours. Expressions of Runx2 (A) and BSP (B) against control were determined by real-time polymerase chain reaction after treatment. Data have been expressed as mean 6 standard error of mean of 3 experiments. *P , 0.05 compared with control. (C) Expression of Runx2 and BSP were determined by Western blot analysis against control (beta-actin).
FITC labeled siRNAs and fluorescence microscopy. The transfection efficiency was .70% as judged by fluorescence. Real-time PCR and Western blot results showed that siRunx2 clearly suppressed both basal and oxLDL-induced Runx2 expression (Figures 2A and 2C). Furthermore, oxLDLinduced BSP expression was also blocked by Runx2 knockdown (Figures 2B and 2C).
242
FIGURE 2. The knockdown of Runx2 by siRNA decreased Runx2 and BSP expression. After transfection of cells with Runx2 siRNA (siRunx2) or control siRNA (scramble), the cells were treated with or without oxLDL (100 mg/mL) for 48 hours, and real-time PCR (A and B) or Western blot analysis (C) was performed. Data have been expressed as mean 6 standard error of mean of 3 experiments. *P , 0.05 compared with control.
These results showed that oxLDL-induced BSP expression was dependent on Runx2 expression, suggesting that Runx2 is required for oxLDL-induced BSP expression. Volume 349, Number 3, March 2015
oxLDL Increases BSP Expression by Runx2
DISCUSSION In this study, we demonstrated that oxLDL, at concentration of 100 mg/mL, increased BSP expression in VSMCs through Runx2 in a time-dependent manner. Runx2 has originally been identified as an essential transcription factor in osteoblast differentiation, bone matrix gene expression and consequently bone mineralization.10,13 Moreover, the studies suggested the role of Runx2 in the vascular calcification.12 In this study, oxLDL induced the expression of Runx2 and BSP mRNA in a time-dependent manner (Figure 1). These results suggest a possible role for Runx2 in BSP gene expression. A recent study has shown that Runx2 overexpression upregulates rat BSP promoter activity.14 In transfection assay, we silenced Runx2 gene by siRNA and confirmed involvement of Runx2 in oxLDL-induced BSP expression in VSMCs (Figure 2). Our study indicated that oxLDL induced expression of the BSP gene through Runx2. ALP and osteocalcin are 2 other osteogenic markers that have correlation with Runx2. A recent study has shown that Runx2 deficiency reduced oxidative stress-induced expression of these osteogenic markers.15 oxLDL plays an essential role in the pathogenesis and development of atherosclerosis and vascular calcification.16 It enhances mineralization of VSMCs.17 oxLDL promotes the calcification of atherosclerotic plaques by proliferation and migration of VSMCs and inducing bone matrix gene expression.18 Several studies have shown that oxLDL induces osteogenic factors such as ALP and bone morphogenetic protein-2.8,9 We have shown that oxLDL induces BSP expression in VSMCs. BSP is involved in atherosclerosis and vascular pathology, and it is shown to be expressed during all stages of atherosclerosis in human abdominal aorta.19 BSP has the potential to nucleate hydroxyapatite, and it can act as a nucleator of crystal formation.20 Also previous studies revealed overexpression of BSP in human carotid plaques.5 Since BSP plays an important role in formation and progression of vascular calcification, understanding of its mechanism may help prevent the development of atherosclerosis and may even be beneficial in reducing vascular calcification. So, recent studies have focused on inducing plaque regression in addition to the conventional therapeutic goal of reducing plaque progression.21,22 It also points out that antioxidant strategies might have beneficial effects on reduction of vascular calcification.
CONCLUSIONS
In summary, our findings showed that oxLDL increased expression of Runx2 and BSP in VSMCs, but after suppression of Runx2 expression by siRNA, oxLDL could not affect the BSP expression. These results suggest that BSP expression is controlled by Runx2 transcription factor, and it seems that Runx2 is a potential regulator in oxLDL-induced vascular calcification. But further study is necessary to determine molecular mechanism of this finding. ACKNOWLEDGMENTS The authors gratefully thank Research and Technology Deputy of Shahrekord University of Medical Science, Shahrekord, Iran. REFERENCES 1. Trion A, van der Laarse A. Vascular smooth muscle cells and calcification in atherosclerosis. Am Heart J 2004;147:808–14. 2. Steitz SA, Speer MY, Curinga G, et al. Smooth muscle cell phenotypic transition associated with calcification upregulation of cbfa1
Copyright © 2015 by the Southern Society for Clinical Investigation.
and downregulation of smooth muscle lineage markers. Circ Res 2001;89:1147–54. 3. Yang Y, Cui Q, Sahai N. How does bone sialoprotein promote the nucleation of hydroxyapatite? A molecular dynamics study using model peptides of different conformations. Langmuir 2010;26:9848–59. 4. Harris N, Rattray K, Tye C, et al. Functional analysis of bone sialoprotein: identification of the hydroxyapatite-nucleating and cell-binding domains by recombinant peptide expression and site-directed mutagenesis. Bone 2000;27:795–802. 5. Ayari H, Bricca G. Microarray analysis reveals overexpression of IBSP in human carotid plaques. Adv Med Sci 2012;57:334–40. 6. Argmann CA, Sawyez CG, Li S, et al. Human smooth muscle cell subpopulations differentially accumulate cholesteryl ester when exposed to native and oxidized lipoproteins. Arterioscler Thromb Vasc Biol 2004;24:1290–6. 7. Nyyssönen K, Kurl S, Karppi J, et al. LDL oxidative modification and carotid atherosclerosis: results of a multicenter study. Atherosclerosis 2012;225:231–6. 8. Su X, Ao L, Shi Y, et al. Oxidized low density lipoprotein induces bone morphogenetic protein-2 in coronary artery endothelial cells via toll-like receptors 2 and 4. J Biol Chem 2011;286:12213–20. 9. Taylor J, Butcher M, Zeadin M, et al. Oxidized low‐density lipoprotein promotes osteoblast differentiation in primary cultures of vascular smooth muscle cells by up‐regulating Osterix expression in an Msx2‐ dependent manner. J Cell Biochem 2011;112:581–8. 10. Ducy P, Zhang R, Geoffroy V, et al. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–54. 11. Schroeder TM, Jensen ED, Westendorf JJ. Runx2: a master organizer of gene transcription in developing and maturing osteoblasts. Birth Defects Res C Embryo Today 2005;75:213–25. 12. Byon CH, Javed A, Dai Q, et al. Oxidative stress induces vascular calcification through modulation of the osteogenic transcription factor Runx2 by AKT signaling. J Biol Chem 2008;283:15319–27. 13. Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 1997;89:755–64. 14. Takai H, Mezawa M, Choe J, et al. Osteogenic transcription factors and proto-oncogene regulate bone sialoprotein gene transcription. J Oral Sci 2013;55(3):209–15. 15. Sun Y, Byon CH, Yuan K, et al. Smooth muscle cell–specific Runx2 deficiency inhibits vascular calcification. Circ Res 2012; 111:543–52. 16. Galle J, Hansen-Hagge T, Wanner C, et al. Impact of oxidized low density lipoprotein on vascular cells. Atherosclerosis 2006;185: 219–26. 17. Goettsch C, Rauner M, Hamann C, et al. Nuclear factor of activated T cells mediates oxidised LDL-induced calcification of vascular smooth muscle cells. Diabetologia 2011;54:2690–701. 18. Madamanchi NR, Vendrov A, Runge MS. Oxidative stress and vascular disease. Arterioscler Thromb Vasc Biol 2005;25:29–38. 19. Dhore CR, Cleutjens JP, Lutgens E, et al. Differential expression of bone matrix regulatory proteins in human atherosclerotic plaques. Arterioscler Thromb Vasc Biol 2001;21:1998–2003. 20. Vincent K, Durrant MC. A structural and functional model for human bone sialoprotein. J Mol Graph Model 2013;39:108–17. 21. Francis AA, Pierce GN. An integrated approach for the mechanisms responsible for atherosclerotic plaque regression. Exp Clin Cardiol 2011;16:77. 22. de Oca AM, Guerrero F, Martinez-Moreno JM, et al. Magnesium inhibits Wnt/b-catenin activity and reverses the osteogenic transformation of vascular smooth muscle cells. PLoS One 2014;9:e89525.
243
Oxidized Low-Density Lipoprotein Increases Bone Sialoprotein Expression in Vascular Smooth Muscle Cells Via Runt-Related Transcription Factor 2 Effat Farrokhi, Keihan G. Samani, PhD and Morteza H. Chaleshtori, PhD
Abstract: Background: Vascular calcification is a pivotal stage in atherosclerosis. During vascular calcification, vascular smooth muscle cells (VSMCs) synthesize many osteogenic factors such as bone sialoprotein (BSP). Oxidative stress plays a critical role in progression of atherosclerosis and also increases extracellular matrix proteins expression. BSP overexpression has been observed during vascular calcification by oxidative stress. However, the regulatory mechanism of oxidized low-density lipoprotein (oxLDL)-mediated vascular calcification has not yet been fully defined. In this study, we aimed to investigate whether runt-related transcription factor 2 (Runx2) affects the oxLDLinduced BSP expression or not. Methods: In this experimental study, we cultured VSMCs in F12K media and then treated them with oxLDL. The expression of Runx2 and BSP genes was determined by real-time polymerase chain reaction method. Protein level of each gene was investigated by Western blotting technique. To determine whether Runx2 regulates BSP gene expression at VSMCs induced by oxLDL, we suppressed Runx2 mRNA using siRNA. Transfected cells then were treated with oxLDL and expression of Runx2 and BSP genes was determined again. Results: oxLDL increased Runx2 and BSP expression (4.8 6 0.47-fold and 4.91 6 0.56-fold, respectively) after 48 hours. Western blotting method confirmed the increased levels of Runx2 and BSP proteins after 48 hours. Runx2 overexpression alone induced BSP expression, whereas knockdown of Runx2 with small interfering siRNA blocked oxLDL-induced BSP expression. Conclusions: Our results showed that oxLDL-induced BSP expression was dependent on Runx2 expression, suggesting that Runx2 is required for oxLDL-induced BSP expression. Key Indexing Terms: Vascular calcification; Oxidized low-density lipoprotein; Bone sialoprotein; Runx2. [Am J Med Sci 2015;349 (3):240–243.]
V
ascular calcification is one of the problems in cardiovascular diseases as it reduces vascular wall elasticity and leads to heart attacks. Vascular smooth muscle cells (VSMCs) play a significant role in vascular calcification by migration, proliferation and secretion of matrix components.1 During vascular calcification, VSMC differentiates to osteoblast-like phenotype and synthesize many osteogenic factors, including osteocalcin, alkaline phosphatase (ALP), bone morphogenetic proteins and bone sialoprotein (BSP).2 BSP, a bone-associated protein is involved in the initiation of atheroFrom the Cellular and Molecular Research Center (EF, MHC), Shahrekord University of Medical Sciences, Shahrekord, Iran; and Clinical Biochemistry Research Center (KGS), Shahrekord University of Medical Sciences, Shahrekord, Iran. Submitted May 15, 2014; accepted in revised form September 26, 2014. Supported by Shahrekord University of Medical Sciences, Shahrekord, Iran. The authors have no other conflicts of interest to disclose. Correspondence: Keihan Ghatreh Samani, PhD, Clinical Biochemistry Research Center, Shahrekord University of Medical Sciences, Rahmatiah, Shahrekord, Iran, Postal Code;8813833435 (E-mail: [email protected]).
240
sclerosis. It has been suggested that BSP exhibits hydroxyapatite nucleation activity3,4 and may play important roles in the initiation and calcification of atherosclerosis. Microarray analysis reveals overexpression of BSP in human carotid plaques.5 Many factors that play a role in induction of VSMCs to osteoblast differentiation have already been identified. It has been shown that oxidized low-density lipoprotein (oxLDL) has a critical role in the pathogenesis and development of atherosclerosis6,7 and induces osteogenic factors expression in atheroma formation.8,9 Runt-related transcription factor 2 (Runx2) is a key transcription factor for osteoblast differentiation and regulates the expressions of many osteogenic factors.10,11 In vitro studies have demonstrated that Runx2 plays an essential role in oxidative stress-induced VSMC calcification and Runx2 alone is sufficient to induce VSMC calcification.12 However, the potential link between BSP expression and oxidative stress-induced vascular calcification has not been examined. We hypothesize that oxLDL upregulates BSP expression in human VSMCs through Runx2.
MATERIALS AND METHODS The human aorta vascular smooth muscle cells (HA/ VSMCs) and F12K media were purchased from Pasteur Institute of Iran. OxLDL was purchased from Biomedical Technologies (Stoughton, MA). SYBR Green PCR Master Mix, cDNA synthesis kit and DNase were obtained from Thermo Fisher Scientific (Waltham, MA). Trizol was obtained from Invitrogen (Invitrogen, Carlsbad, California). SiRNAs, opti-MEM and lipofectanine were purchased from Invitrogen (Ambion, Austin, TX, USA). FITC (fluorescein isothiocyanate)-conjugated siRNA was obtained from Santa Cruz Biotechnology. Anti-Runx2, anti-BSP, anti-beta actin and secondary antibody were obtained from Abcam (Cambridge, United Kingdom). 3,39,5,59-tetramethylbenzidine (BM blue) was purchased from Roche (Mannheim, Germany). Cell Culture, RNA Isolation and cDNA Synthesis In this experimental study, HA/VSMC were maintained in F12K media. F12K media contained 0.05 mg/mL ascorbic acid, 0.01 mg/mL insulin, 0.01 mg/mL transferrin, 10 ng/mL sodium selenite, 0.03 mg/mL endothelial cell growth supplement, FBS to a final concentration of 10%, HEPES to a final concentration of 10 mM, TES to a final concentration of 10 mM, 100 U/mL penicillin, 100 mg/mL streptomycin and 0.01% amphotericin B. Cells were incubated in a humidified atmosphere containing 5% CO2 at 37°C. Daily control of cell growth and cell division in culture condition were done. Cells used for the experiments were 3 to 7 passages. To induce VSMC calcification, the cells were incubated in the presence of 10 Mm b-glycerophosphate for 12 days. Cells were seeded in a 12-well plate at a density of 10,000 cells per well. When the cells achieved approximately
The American Journal of the Medical Sciences
Volume 349, Number 3, March 2015
oxLDL Increases BSP Expression by Runx2
80% confluence, they were co-cultured with oxLDL (100 mg/mL). Control cells were cultured in media containing b-glycerophosphate without oxLDL. After 24 and 48 hours, total RNA was extracted from the cells using Trizol according to the manufacturer instructions. RNA was quantified using a Nanodrop 2000C spectrophotometer (Thermo Scientific) and treated with DNase. Then cDNA was synthesized from 0.5 mg total RNA using random primer and the Rever Aid First Standard cDNA Synthesis kit. Real-Time Polymerase Chain Reaction Quantitative real-time polymerase chain reaction (PCR) was performed using Corbett system and SYBR green method. Primers used for real-time PCR are listed in Table 1. PCRs were performed in triplicate using 5 mL SYBR green PCR Master Mix, 0.2 mL primer sets, 1 mL cDNA and 3.6 mL nuclease-free H2O to yield a 10 mL reaction. The amplification was carried out as follows: initial enzyme activation at 94°C for 10 minutes, then 40 cycles of 95°C for 15 seconds, 59°C for 20 seconds and 72°C for 30 seconds. Quantitation of data was performed using the comparative CT (DDCT) method using GAPDH gene expression as an endogenous reference. Western Blot Cells were washed twice with cold phosphate buffer saline and lysed in ice-cold 63 radio immune precipitation assay buffer. The homogenate was incubated in lysis buffer for 30 minutes and then centrifuged at 12,000 rpm for 10 minutes. The supernatant was used as total cell lysate. Protein concentration was measured spectrophotometrically by nanodrop and equal amounts of protein from each sample were subjected to blotting. Protein lysate was mixed with laemmli buffer, boiled for 5 minutes and separated by 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The separated proteins were then transferred to a polyvinylidenedifluoride membrane in tris-glycine buffer for 2 hours at 120 V. The membrane was blocked by 5% nonfat dry milk in Tris-buffered saline, and 0.1% tween-20 overnight at 4°C temperature. Then, the membrane was incubated in Tris-buffered saline, and 0.1% tween-20 containing the primary rabbit polyclonal anti-BSP (1 mg/mL) and primary rabbit polyclonal antiRunx2 at 1:2,000 for 2 hours at room temperature. After washing, the membrane was incubated with goat anti-rabbit IgG horseradish peroxidase conjugate diluted 1:10,000 for 90 minutes at room temperature. Finally, the color was developed with the addition of 3,39,5,59-tetramethylbenzidine membrane peroxidase substrate. The color reaction was stopped by washing the membranes with distilled water. Cell lysates were detected on a separate membrane with actin as a loading control. Runx2 RNA Interference To knockdown Runx2, we used 2 siRNAs (IDs: s2455 and s2456). Runx2 siRNAs, s2455 and s2456, are located in the region of the Runx2 transcript that codes for amino acids 910 to 928 and
1,663 to 1,683 respectively. The oligonucleotide sequences were as follows: s2455: 59-CUUGAUGACUCUAAACC UATT-39 and 59-UAGGUUUAGAGUCAUCAAGCT-39, s2456: 59-CCAAAUUUGCCUAACCAGATT-39and 59-UC UGGUUAGGCAAAUUUGGAT-39. The cells were seeded in a 24-well plate at the density of 20,000 cells per well in growth medium without antibiotics. After 24 hours, the cells were transfected with RNAi duplex— Lipofectamine RNAiMAX complexes made in Opti-MEM according to the manufacturer’s instructions. A 10 nM of each siRNA was used for all transfections. siRNA transfection efficiency was observed by uptake of FITC-labeled siRNA sequence, and scramble oligoribonucleotide duplex that was not homologous to any mammalian genes was used as a control. After 24 hours, the transfection media were removed, and the cells were incubated for an additional 24 hours in normal growth media and then stimulated with oxLDL (100 mg/mL). The cells were harvested for mRNA and protein extraction after 48 hours. Because of a significant increase in BSP expression observed after 48 hours, Runx2 knock-down was only done at 48 hours. Statistical Analysis All experiments were done in triplicate. Statistical analysis was done using nonparametric Kruskal-Wallis test, and pairwise comparisons among groups were performed by Mann-Whitney’s U test. All statistical analyses were performed with Graph Pad Prism5 software. All data were presented as mean 6 standard error of mean, and P , 0.05 was considered as the level of significance.
RESULTS Effect of oxLDL on BSP and Runx2 Expression After treatment of VSMCs with 100 mg/mL oxLDL, the mRNA and protein levels of Runx2 and BSP were detected by quantitative real time-PCR and Western blotting assay. The result showed that oxLDL increased Runx2 expression (2.29 6 0.39-fold and 4.8 6 0.47-fold) and BSP expression (1.46 6 0.45-fold and 4.91 6 0.56-fold) after 24 and 48 hours, respectively (Figures 1A and 1B). The significant increment of BSP gene expression was observed only after 48 hours of treatment. Differences between groups were determined as significant at P , 0.05. Western blot analysis confirmed the changes observed at mRNA level (Figure 1C). In Western blot analysis, beta-actin (42 kDa) was used as internal control. siRNA Transfection To determine whether Runx2 regulates BSP gene expression at VSMCs induced by oxLDL, we suppressed Runx2 mRNA using siRNA. VSMCs were transfected with Runx2 siRNA (siRunx2) or nontargeting control siRNA and then treated with oxLDL. Transfection efficacy was determined using
TABLE 1. Primer sequences and product length Genes Primer sequences (59–39) Runx2 BSP GAPDH
Forward: CGATCTGAGATTTGTGGGCC Reverse: GGGAGGATTTGTGAAGACGG Forward: TGCCTTGAGCCTGCTTCCT Reverse: CTGAGCAAAATTAAAGCAGTCTTCA Forward: ACACCCACTCCTCCACCTTTG Reverse: TCCACCACCCTGTTGCTGTAG
Copyright © 2015 by the Southern Society for Clinical Investigation.
Product length (bp) 76 79 112
241
Farrokhi et al
FIGURE 1. oxLDL upregulated Runx2 and BSP expression in VSMCs. The cells were treated by oxLDL for 24 and 48 hours. Expressions of Runx2 (A) and BSP (B) against control were determined by real-time polymerase chain reaction after treatment. Data have been expressed as mean 6 standard error of mean of 3 experiments. *P , 0.05 compared with control. (C) Expression of Runx2 and BSP were determined by Western blot analysis against control (beta-actin).
FITC labeled siRNAs and fluorescence microscopy. The transfection efficiency was .70% as judged by fluorescence. Real-time PCR and Western blot results showed that siRunx2 clearly suppressed both basal and oxLDL-induced Runx2 expression (Figures 2A and 2C). Furthermore, oxLDLinduced BSP expression was also blocked by Runx2 knockdown (Figures 2B and 2C).
242
FIGURE 2. The knockdown of Runx2 by siRNA decreased Runx2 and BSP expression. After transfection of cells with Runx2 siRNA (siRunx2) or control siRNA (scramble), the cells were treated with or without oxLDL (100 mg/mL) for 48 hours, and real-time PCR (A and B) or Western blot analysis (C) was performed. Data have been expressed as mean 6 standard error of mean of 3 experiments. *P , 0.05 compared with control.
These results showed that oxLDL-induced BSP expression was dependent on Runx2 expression, suggesting that Runx2 is required for oxLDL-induced BSP expression. Volume 349, Number 3, March 2015
oxLDL Increases BSP Expression by Runx2
DISCUSSION In this study, we demonstrated that oxLDL, at concentration of 100 mg/mL, increased BSP expression in VSMCs through Runx2 in a time-dependent manner. Runx2 has originally been identified as an essential transcription factor in osteoblast differentiation, bone matrix gene expression and consequently bone mineralization.10,13 Moreover, the studies suggested the role of Runx2 in the vascular calcification.12 In this study, oxLDL induced the expression of Runx2 and BSP mRNA in a time-dependent manner (Figure 1). These results suggest a possible role for Runx2 in BSP gene expression. A recent study has shown that Runx2 overexpression upregulates rat BSP promoter activity.14 In transfection assay, we silenced Runx2 gene by siRNA and confirmed involvement of Runx2 in oxLDL-induced BSP expression in VSMCs (Figure 2). Our study indicated that oxLDL induced expression of the BSP gene through Runx2. ALP and osteocalcin are 2 other osteogenic markers that have correlation with Runx2. A recent study has shown that Runx2 deficiency reduced oxidative stress-induced expression of these osteogenic markers.15 oxLDL plays an essential role in the pathogenesis and development of atherosclerosis and vascular calcification.16 It enhances mineralization of VSMCs.17 oxLDL promotes the calcification of atherosclerotic plaques by proliferation and migration of VSMCs and inducing bone matrix gene expression.18 Several studies have shown that oxLDL induces osteogenic factors such as ALP and bone morphogenetic protein-2.8,9 We have shown that oxLDL induces BSP expression in VSMCs. BSP is involved in atherosclerosis and vascular pathology, and it is shown to be expressed during all stages of atherosclerosis in human abdominal aorta.19 BSP has the potential to nucleate hydroxyapatite, and it can act as a nucleator of crystal formation.20 Also previous studies revealed overexpression of BSP in human carotid plaques.5 Since BSP plays an important role in formation and progression of vascular calcification, understanding of its mechanism may help prevent the development of atherosclerosis and may even be beneficial in reducing vascular calcification. So, recent studies have focused on inducing plaque regression in addition to the conventional therapeutic goal of reducing plaque progression.21,22 It also points out that antioxidant strategies might have beneficial effects on reduction of vascular calcification.
CONCLUSIONS
In summary, our findings showed that oxLDL increased expression of Runx2 and BSP in VSMCs, but after suppression of Runx2 expression by siRNA, oxLDL could not affect the BSP expression. These results suggest that BSP expression is controlled by Runx2 transcription factor, and it seems that Runx2 is a potential regulator in oxLDL-induced vascular calcification. But further study is necessary to determine molecular mechanism of this finding. ACKNOWLEDGMENTS The authors gratefully thank Research and Technology Deputy of Shahrekord University of Medical Science, Shahrekord, Iran. REFERENCES 1. Trion A, van der Laarse A. Vascular smooth muscle cells and calcification in atherosclerosis. Am Heart J 2004;147:808–14. 2. Steitz SA, Speer MY, Curinga G, et al. Smooth muscle cell phenotypic transition associated with calcification upregulation of cbfa1
Copyright © 2015 by the Southern Society for Clinical Investigation.
and downregulation of smooth muscle lineage markers. Circ Res 2001;89:1147–54. 3. Yang Y, Cui Q, Sahai N. How does bone sialoprotein promote the nucleation of hydroxyapatite? A molecular dynamics study using model peptides of different conformations. Langmuir 2010;26:9848–59. 4. Harris N, Rattray K, Tye C, et al. Functional analysis of bone sialoprotein: identification of the hydroxyapatite-nucleating and cell-binding domains by recombinant peptide expression and site-directed mutagenesis. Bone 2000;27:795–802. 5. Ayari H, Bricca G. Microarray analysis reveals overexpression of IBSP in human carotid plaques. Adv Med Sci 2012;57:334–40. 6. Argmann CA, Sawyez CG, Li S, et al. Human smooth muscle cell subpopulations differentially accumulate cholesteryl ester when exposed to native and oxidized lipoproteins. Arterioscler Thromb Vasc Biol 2004;24:1290–6. 7. Nyyssönen K, Kurl S, Karppi J, et al. LDL oxidative modification and carotid atherosclerosis: results of a multicenter study. Atherosclerosis 2012;225:231–6. 8. Su X, Ao L, Shi Y, et al. Oxidized low density lipoprotein induces bone morphogenetic protein-2 in coronary artery endothelial cells via toll-like receptors 2 and 4. J Biol Chem 2011;286:12213–20. 9. Taylor J, Butcher M, Zeadin M, et al. Oxidized low‐density lipoprotein promotes osteoblast differentiation in primary cultures of vascular smooth muscle cells by up‐regulating Osterix expression in an Msx2‐ dependent manner. J Cell Biochem 2011;112:581–8. 10. Ducy P, Zhang R, Geoffroy V, et al. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–54. 11. Schroeder TM, Jensen ED, Westendorf JJ. Runx2: a master organizer of gene transcription in developing and maturing osteoblasts. Birth Defects Res C Embryo Today 2005;75:213–25. 12. Byon CH, Javed A, Dai Q, et al. Oxidative stress induces vascular calcification through modulation of the osteogenic transcription factor Runx2 by AKT signaling. J Biol Chem 2008;283:15319–27. 13. Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 1997;89:755–64. 14. Takai H, Mezawa M, Choe J, et al. Osteogenic transcription factors and proto-oncogene regulate bone sialoprotein gene transcription. J Oral Sci 2013;55(3):209–15. 15. Sun Y, Byon CH, Yuan K, et al. Smooth muscle cell–specific Runx2 deficiency inhibits vascular calcification. Circ Res 2012; 111:543–52. 16. Galle J, Hansen-Hagge T, Wanner C, et al. Impact of oxidized low density lipoprotein on vascular cells. Atherosclerosis 2006;185: 219–26. 17. Goettsch C, Rauner M, Hamann C, et al. Nuclear factor of activated T cells mediates oxidised LDL-induced calcification of vascular smooth muscle cells. Diabetologia 2011;54:2690–701. 18. Madamanchi NR, Vendrov A, Runge MS. Oxidative stress and vascular disease. Arterioscler Thromb Vasc Biol 2005;25:29–38. 19. Dhore CR, Cleutjens JP, Lutgens E, et al. Differential expression of bone matrix regulatory proteins in human atherosclerotic plaques. Arterioscler Thromb Vasc Biol 2001;21:1998–2003. 20. Vincent K, Durrant MC. A structural and functional model for human bone sialoprotein. J Mol Graph Model 2013;39:108–17. 21. Francis AA, Pierce GN. An integrated approach for the mechanisms responsible for atherosclerotic plaque regression. Exp Clin Cardiol 2011;16:77. 22. de Oca AM, Guerrero F, Martinez-Moreno JM, et al. Magnesium inhibits Wnt/b-catenin activity and reverses the osteogenic transformation of vascular smooth muscle cells. PLoS One 2014;9:e89525.
243