- Email: [email protected]
Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway
G Model DESC 3073 No. of Pages 7
Journal of Dermatological Science xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Journal of Dermatological Science journal homepage: www.jdsjournal.com
Opinion article
Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway Robert Bissonnettea,* , Judilyn Fuentes-Duculanb , Shunya Mashikoc , Xuan Lib , Kathleen M. Bonifaciob , Inna Cuetob , Mayte Suárez-Fariñasd, Catherine Maaria , Chantal Bolduca , Simon Nigena , Marika Sarfatic , James G. Kruegerb a
Innovaderm Research, 1851 Sherbrooke St. East, Suite 502, Montreal, Quebec, H2K 4L5, Canada Laboratory of Investigative Dermatology, The Rockefeller University, 1230 York Avenue, New York, NY, 10065 USA c Immunoregulation Laboratory, Centre de Recherche du Centre Hospitalier de l’Université de Montréal (CRCHUM), 900 Saint-Denis Street, Montreal, Quebec, H2X 0A9, Canada d Dept. of Population Health Science and Policy, Dept. of Genetics and Genomics Science and Dept. of Dermatology, Icahn School of Medicine at Mount Sinai, 1425 Madison Ave, L2-70C, Box 1077, New York, NY, 10029, USA b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 May 2016 Received in revised form 8 September 2016 Accepted 28 September 2016
Background: Palmoplantar pustular psoriasis (PPPP) is a variant of psoriasis, which has significant negative impact on quality of life. The cellular and molecular inflammatory pathways involved in PPPP have not been well studied. Objective: Study the expression of cytokines and chemokines involved in the IL-17/IL-23 axis in palmoplantar pustular psoriasis and other difficult to treat psoriasis areas (palms, scalp, elbows and lower legs). Methods: Skin biopsies were performed on a total of 80 patients with PPPP, non-pustular palmoplantar psoriasis (NPPPP), or psoriasis located on elbows, knees and scalp as well as 10 healthy subjects. RT-PCR, immunohistochemistry and flow cytometry on cells extracted from skin biopsies were used to compare PPPP to other forms of psoriasis. Results: There was a significant (p < 0.05) increase in the expression of IL-1b, IL-6, LL-37, IL-19, IL-17A, CXCL1 and CXCL2 in PPPP as compared to NPPPP. However, there was no significant difference in expression of IL-23 in PPPP as compared to NPPPP and other forms of psoriasis. The proportion of IL-22+ but not IL-17A+ mast cells was higher in PPPP as compared to NPPPP (p < 0.05). Conclusion: These results suggest that the IL-17A pathway may play a more important role in PPPP than in NPPPP. ã 2016 Published by Elsevier Ireland Ltd on behalf of Japanese Society for Investigative Dermatology.
Keywords: Psoriasis Palmoplantar psoriasis Palmoplantar pustular psoriasis IL-17 IL-23 Skin biopsies
1. Introduction Psoriasis vulgaris is the most common clinical presentation of psoriasis, an immune-mediated multi-systemic disease. Our understanding of the pathophysiology of psoriasis vulgaris improved significantly over the past 15 years following clinical studies performed using monoclonal antibodies to treat psoriasis. These studies have shown that several cytokines, including TNF-alpha, IL-23 and IL-17, have an important role in the
Abbreviations: PPPP, palmoplantar pustular psoriasis; NPPPP, non-pustular palmoplantar psoriasis. * Corresponding author. E-mail addresses: [email protected], [email protected], [email protected] (R. Bissonnette).
pathophysiology of psoriasis as evidenced by the rapid and important improvement in skin and joint disease following treatment with antagonists of IL-23 or IL-17 [1–7]. IL-23 is produced by a variety of cells including antigen presenting cells, neutrophils and macrophages [8]. IL-23 is involved in expansion and maintenance of Type 17 T-cells which are the major source of IL-17 in the skin of patients with psoriasis [7,9,10]. In addition to being produced by T cells, IL-17 is produced by other cell types including neutrophils and mast cells [9,10]. IL-17 contributes to the psoriasis phenotype by increasing the production of numerous cytokines including IL-6, IL-8, IL-36 and TNF-alpha, of chemokines including CXCL1, CXCL3, CXCL5, CXCL8 and CCL20 and of antimicrobial peptides including b-defensin and S100A7, S100A8 and S100A9 [11,12]. Palmoplantar pustular psoriasis (PPPP) is a variant of psoriasis that can limit the ability to walk, work and perform routine daily
http://dx.doi.org/10.1016/j.jdermsci.2016.09.019 0923-1811/ ã 2016 Published by Elsevier Ireland Ltd on behalf of Japanese Society for Investigative Dermatology.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
2
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Table 1 Sequences of primers and probes used for RT-PCR. Gene 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29
Assay ID
KRT16 IL-23p19 (IL23A) IL-23p40 (IL12B) IL17A CXCL1 CXCL2 CXCL3 CXCL8 CCL20 Beta defens in (DEFB4A) LCN2 LL37 (CAMP) S100A7 S100A7 S100A8 S100A9 IL19 TNF IL1B IL-6 IL36A IL36B IL36G IL36RN IL22 GPRIN1 ADAM23 RIMS3 hARP (Custom TaqMan Assays)
Cat.#
Inventory
Hs00955082_g1 4331182 Hs00900828_g1 4331182 Hs01011518_m1 4331182 Hs00174383_m1 4331182 Hs00236937_m1 4331182 Hs00601975_m1 4331182 Hs00171061_m1 4331182 Hs00174103_m1 4331182 Hs01011368_m1 4331182 Hs00175474_m1 4331182 Hs01008571_m1 4331182 Hs00189038_m1 4331182 Hs00161488_m1 4331182 Hs01923188_u1 4331182 Hs00374264_g1 4331182 Hs00610058_m1 4331182 Hs00604657_m1 4331182 Hs01113624_g1 4331182 Hs01555410_m1 4331182 Hs00985639_m1 4331182 Hs00205367_m1 4331182 Hs00758166_m1 4331182 Hs00219742_m1 4331182 Hs01104220_g1 4331182 Hs01574154_m1 4331182 Hs00287446_m1 4331182 Hs00187022_m1 4331182 Hs01119237_m1 4331182 Forwa rd- Pri mer: CGCTGCTGAACATGCTCAA Revers e- Pri mer: TGTCGAACACCTGCTGGATG Probe Sequence: 6FAM-TCCCCCTTCTCCTTTGGGCTGG-TAMRA
activities [13]. PPPP is a chronic skin disease characterized by crops of sterile pustules on palms and soles [14]. In North-America and Western Europe the prevalence of PPPP has been estimated to be between 0.01 and 0.05% [15]. However the prevalence in Asia is higher. For example, in Japan the prevalence of PPPP has been reported to be 0.12% as compared to 0.34% for plaque psoriasis [16]. The inflammatory pathways involved in palmoplantar pustular psoriasis have not been studied as well as those of psoriasis vulgaris but increased levels of various cytokines, including IL-17 [17–19] and IL-22 [17] have been reported in patients with palmoplantar pustulosis. We recently reported an increase in expression of IL-17A in the skin of patients with palmoplantar pustular psoriasis without an increase in expression of IL-23 [20]. This is different from psoriasis vulgaris where elevations of both IL17A and IL-23 expression is usually observed [21]. The current study was initiated in order to compare expression of chemokines and cytokines at the cellular and tissue levels between PPPP, non-pustular palmoplantar psoriasis (NPPPP) and
Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life
Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies
psoriasis located on the trunk/proximal limbs and at other regions of the body that are known to be more resistant to therapy. 2. Material and methods 2.1. Patients A total of 80 adult subjects with different types of psoriasis and 10 adult subjects without psoriasis were enrolled (refer to results Section). The study was approved by an ethics committee and written informed consent was obtained from each subject before any study procedure was performed. Five groups of patients with psoriasis of at least 6 months duration were recruited: (1) palmoplantar pustular psoriasis (PPPP; n = 10) (2) non pustular palmoplantar psoriasis (NPPPP; n = 10) (3) scalp psoriasis (n = 20) (4) elbow psoriasis (n = 20) and (5) lower leg psoriasis (n = 20). Patients with scalp, elbow and lower leg psoriasis had to have psoriasis vulgaris on the trunk or proximal limbs on an area that
Table 2 Demographics. Healthy Subjects (n = 10)
Elbows (n = 20)
Lower Leg (n = 20)
NPPPP (n = 10)
PPPP (n = 10)
Age (y) m (SD) Female n (%) Male n (%)
31.8 (15.89) 5 (50%) 5 (50%)
48.4 (14.21) 4 (20 %) 16 (80 %)
50.05 (14.45) 2 (10 %) 18 (90 %)
53 (12.89) 7 (70 %) 3 (30 %)
62.6 (9.44) 9 (90 %) 1 (10 %)
45.1 (14.82) 11 (55 %) 9 (45 %)
Race n (%) White Black Asian
10 (100%) 0 (0%) 0 (0%)
20 (100%) 0 (0%) 0 (0%)
20 (100%) 0 (0%) 0 (0%)
10 (100%) 0 (0%) 0 (0%)
10 (100%) 0 (0%) 0 (0%)
19 (95%) 0 (0%) 1 (5%)
Ethnicity n (%) Hispanic Non-Hispanic
3 (30%) 7 (70%)
0 (0%) 20 (100%)
2 (10%) 18 (90%)
0 (0%) 100 (80%)
0 (0%) 10 (100%)
1 (5%) 19 (95%)
SCALP (n = 20)
m = Mean, n = sample size, SD = standard deviation, y = year.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
3
Fig. 1. A: Representative images of immunohistochemistry with neutrophil elastase (NE) (b, d) for PPPP (a, b) and NPPPP (c, d). B: Number of cells per field positive for CD3, NE or CD11c for patients with non-pustular palmoplantar psoriasis (NPPPP) and palmoplantar pustular psoriasis (PPPP). * indicates a significant (p < 0.05) difference between NPPPP and PPPP.
was suitable for skin biopsies. Patients with NPPPP had erythematous and squamous plaques of psoriasis on palms and/or soles without presence or history of pustules. Patients with PPPP had erythematous and squamous plaques on palms and/or soles with the presence of active pustules on palms and/or soles. The main exclusion criteria were the use of topical treatments for psoriasis in the past 2 weeks, the use of oral treatments for psoriasis or oral corticosteroids in the past 4 weeks, the use of biologics in the past 90 days or the presence of any immune deficiency. Patients with scalp psoriasis, elbow psoriasis and lower leg psoriasis all had at least two 4 mm punch biopsies performed: one from a plaque located on the scalp, elbow or lower leg and one from a plaque located on the trunk or proximal limbs. Patients with
NPPPP and PPPP had a 4 mm biopsy of palmoplantar psoriasis but the biopsy on the trunk or proximal limb was only performed if active psoriasis vulgaris was present on those areas (2 patients with NPPPP had biopsies on the trunk/proximal limbs and no patients with PPPP had biopsies on those areas). Each biopsy was split in half and one half was placed in Optimum Cutting Medium (Sakura Finetek, Torrance, CA) and frozen at 70 C for immunohistochemistry while the other half was frozen in liquid nitrogen for reverse transcriptase polymerase chain reaction (RT-PCR). In addition, all patients with NPPPP and PPPP and 10 patients with psoriasis present on the trunk or upper limbs had an additional 4 mm skin biopsy to isolate inflammatory cells present in lesional skin. Skin biopsies were cut in 3 pieces, immediately placed in
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
4
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
culture medium and processed within 90 min for cell extraction using a previously described procedure [9]. 2.2. Flow cytometry Briefly, the biopsies were enzymatically digested with 0.2 mg/ ml of Liberase (Roche, Mannheim, Germany) for 60 min at 37 C in Dulbecco’s Modified Eagle Medium (DMEM) (Life Technologies Inc. Burlington, Ontario, Canada) followed by mechanical dissociation using a gentleMACS Dissociator (Miltenyi Biotech, Bergisch Gladbach, Germany). This procedure was repeated twice. Viable cells were counted by Trypan blue dye exclusion and single cell suspensions were immediately stained with LIVE/DEAD1 Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation (Molecular Probes1, Life Technologies Inc., ON, Canada). Skin cell suspensions were incubated for 15 min at 4 C with the human IgG or antihuman CD32 blocker from STEMCELL TechnologiesTM and stained for surface antigens for 30 min at 4 C using the following mAbs: APC-H7 anti-CD45 (2D1) (Becton Dickinson); FITC anti-FceRIa (AER-37) (eBioscience); PE-Cy7 anti-CD3 (UCHT1), APC anti-c-Kit (104D2), Pacific blueTM anti-Lineage Cocktail (CD3, CD14, CD16, CD19, CD20, CD56), (UCHT1, HCD14, 3G8, HIB19, 2H7, HCD56); Alexa Fluor1647 IgG1k (MOPC-21), PE-Cy7 IgG1k (MOPC-21) and FITC IgG2bk (MPC-11) were used as isotype-matched control mAbs (BioLegend). Cells were then fixed, permeabilized using the BD Cytofix/CytopermTM Fixation/Permeabilization Solution Kit (Becton Dickinson) and stained for intracytoplasmic cytokine expression using PerCP anti-IL-17 (41802) and PE anti-IL-22 (142928). PerCP IgG1 (11711) and PE IgG1 (11711) were used as isotypematched control mABs (R&D SystemsTM). FACS analysis was performed on CD45+ gated hematopoietic viable cells after doublets exclusion using FSC and SSC gating strategies. Cells were analyzed by using LSR II (Becton Dickinson) with FCS express flow cytometry analysis software.
the differences between those groups are adjusted by the differences in biopsies from soles and palms. This formulation intrinsically models the within patient correlation structure as in the case of a paired t-test. Immunohistochemistry data was compared for various body regions using the Wilcoxon test. Flow cytometry groups were compared by Mann-Whitney unpaired test (Panel A, C and D) or Wilcoxon paired test (panel B). 3. Results A total of 80 patients with psoriasis and 10 healthy volunteers were recruited and skin biopsies were performed as planned. Demographics is provided in Table 2. 3.1. Immunohistochemistry NPPPP and PPPP both display important hyperkeratosis with parakeratosis, acanthosis with elongation of rete ridges and mostly mononuclear cell inflammatory infiltration in the upper dermis (Fig. 1A). An important difference between NPPPP and PPPP is the presence of clusters of neutrophils (in red arrows) in the epidermis of patients with PPPP (Fig. 1A). The number of CD3+ cells in the dermis was higher for NPPPP as compared to PPPP (p = 0.04; Fig. 1B). The number of cells positive for neutrophil elastase in the dermis was numerically higher for PPPP as compared to NPPPP but
2.3. Immunohistochemistry Frozen tissue sections from lesional skin biopsies of NPPPP and PPPP patients were blocked with 10% normal horse serum and stained with CD3 (BD Biosciences), CD11c (BD Pharmingen), and Neutrophil Elastase (Dako) overnight. Biotin-labeled horse antimouse (Vector Laboratories) was used to detect the mouse monoclonal antibodies. The staining signal was amplified with avidin-biotin complex (Vector Laboratories) and developed using chromogen 3-amino-9-ethylcarbazole (Sigma-Aldrich). 2.4. Reverse transcriptase-polymerase chain reaction (RT-PCR) RNA was extracted from lesional skin of NPPPP and PPPP patient biopsies using the miRNeasy Mini KIT (Cat#: 217004 Qiagen, Valencia, CA, U.S.A.). RT-PCR was performed using TaqMan Fast Virus 1- Step Master Mix, Primers and Probes (Life Technologies, Grand Island, NY, U.S.A.) as previously published [22]. Sequences of primers and probes used in this study are found in Table 1. The results were normalized to HARP housekeeping gene. 2.5. Statistical analysis RT-PCR values were normalized to housekeeping gene hARP and log2-transformed for analysis. Measurements under the limit of detections were imputed as 20% of the minimum value observed for that gene. qRT-PCR expression data was modeled using a mixed effect model with body part/diagnosis as a fixed effect and a random intercept for each patient. For the comparisons between NPPPP, PPPP and normal skin, the diagnosis was considered a factor and the biopsy site (palm or sole) was considered as covariate, so
Fig. 2. p19, p40 and IL-17A mRNA levels from different body regions of normal skin from healthy subjects and psoriatic skin from subjects with psoriasis. * indicates a significant (p < 0.05) difference between psoriasis and healthy subjects. NPPPP = non-pustular palmoplantar psoriasis. PPPP = palmoplantar pustular psoriasis.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
the difference was not statistically significant (p = 0.242; Fig. 1B). PPPP lesions also had focal neutrophil accumulations (pustules) within the epidermis that were not observed in NPPPP biopsies, but individual cell counts could not be performed on these regions. NPPPP, PPPP, and psoriasis from trunk, leg, and elbow lesions were characterized by consistently elevated T-cell counts in the epidermis and dermis and also high numbers of proliferative (Ki67+) epidermal keratinocytes. No marked differences in total Tcell numbers were detected between different body regions, but there was a tendency for NPPPP lesions to have higher T-cell infiltrates in the epidermis (mean epidermal T-cell counts 182 in NPPPP compared to 103 in PPPP, p = 0.036).
5
was significantly higher as compared to the percentage of IL-22producing T cells in trunk/proximal limbs and NPPPP plaques and tended towards an increase in PPPP (Fig. 4C). However, when mast cells (lin CD3 ckit+FceR+ cells) were examined, we found that the proportion of IL-22+ mast cells but not IL-17+ mast cells was higher in biopsies from PPPP as compared to NPPPP (p < 0.05; Fig. 4D and E). In agreement with our recent studies [9], the frequency of IL17A+ T cells was higher than IL-17+ mast cells for trunk/proximal limbs, NPPPP and PPPP; the situation was the opposite for IL-22 where the proportion of IL-22+ mast cells was higher than the proportion of IL-22+ T cells for trunk/proximal limbs, NPPPP and PPPP (not shown).
3.2. Reverse transcriptase-polymerase chain reaction (RT-PCR) 4. Discussion The levels of p19, p40 and IL-17A were higher in psoriatic skin as compared to normal skin from trunk/proximal limbs, elbow, lower Leg and scalp (Fig. 2; p< 0.001). The levels of IL-17A were lower in NPPPP as compared to PPPP (Fig. 2c; p < 0.05). Expression of CXCL1, CXCL2, CXCL3, CXCL8, CCL20, DEFB4A, LCN2, TNF-alpha, S100A9, S100A7, S100A8, IL-19, and IL-1 were also higher in PPPP and NPPPP as compared to normal skin (Fig. 3). IL-6 (p = 0.013), LL37 (p = 0.024), CXCL8 (p = 0.037), CXCL1 (p = 0.009), CXCL2 (p = 0.041), IL-1b (p = 0.013), IL–36 B (p = 0.0019), and IL-19 (p = 0.0003) expression was higher in PPPP as compared to NPPPP (Fig. 3). 3.3. Flow cytometry The proportion of T cells was similar for biopsies from trunk/ proximal limbs and non-pustular palmoplantar psoriasis (NPPPP) but lower in PPPP as compared to trunk/proximal limbs (p = 0.0152) and NPPPP (p = 0.0341) (Fig. 4B). As depicted in Fig. 4C, there was no difference in the proportion of IL-17A+CD3+ cells as well as IL-22+CD3+ cells between trunk/proximal limbs, NPPPP and PPPP. Notably, the percentage of IL-17-producing T cells
The striking increase in IL-1b coupled with the increase in IL-6, the lower number of CD3+ cells as seen with immunohistochemistry and the lower proportion of CD3+ T cells and higher proportion of IL-22+ mast cells suggest that innate immunity may play a more important role in PPPP than in NPPPP. One aspect of the IL-17 response immune axis is that high levels of CXCL1, 2, 3 & 8 can be produced by keratinocytes in response to IL-17. CXCLchemokines largely regulate neutrophil chemotaxis and higher levels of these CXCL chemokines in PPPP, may be a reason for neutrophilic accumulations (pustules) within the epidermis. In turn, the IL-17 response of keratinocytes in PPPP might reflect higher NFkB activation by TNF or IL-1b, also reflected in higher IL-6 production, as transcription of IL-17 regulated genes is regulated by NFkB and CEBP/b,d; in synergy. In the imiquimod murine model of psoriasis IL-1b produced by neutrophils has been shown to promote IL-19 production by keratinocytes [23]. Interestingly, cases of good response to anakinra, an IL-1b antagonist, have been reported for patients with PPPP and acrodermatitis continua of Hallopeau [24,25]. The more than 125 fold increase in IL-19 in PPPP as compared to NPPPP also suggest that this IL-17A inducible
Fig. 3. Heat map of mRNA levels of different cytokines and chemokines for patients with non-pustular palmoplantar psoriasis (NPPPP), palmoplantar pustular psoriasis (PPPP) and healthy subjects (HS). * and ** indicate a significant (p < 0.01 and p < 0.001 respectively) differences. Yellow-red scale represents gene expression levels: red for low and yellow high gene expression.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
6
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Fig. 4. A: Gating strategy on Aqua LIVE/DEAD negative cells in relation to cell size (FSC) to show viable CD45+ hematopoietic cells (top panels); percentage IL-17 and IL-22producing cells after gating on mast cells (c-Kit+ FceRI+) and T cells (cKit-CD3+) (bottom panels). Shown is one representative experiment performed on a NPPPP patient. B: Proportion of CD3+ T cells for NPPPP, PPPP or psoriasis vulgaris from trunk/proximal limbs. C: Correlation between IL-17+CD3+ and IL-22+CD3+ cells. D and E: proportion of IL17+ mast cells (C) and IL-22+ mast cells (D). *p < 0.05 **p < 0.01.
cytokine may also play an important role, and even be a potential therapeutic target, in patients with PPPP [26]. In the current study mRNA levels of IL-23 (both the p19 and the p40 subunits) were higher in psoriatic skin as compared to skin of healthy subjects from all body areas studied. However levels of p19 and p40 from lesional skin of patients with palmoplantar pustular and non-pustular psoriasis were in the same order of magnitude as for patients with psoriasis elsewhere on the body (trunk/proximal limbs, scalp, lower legs elbows). This observation is different from our previous report of a low IL-23 signal in lesional skin of patients with palmoplantar pustular psoriasis [20]. Possible reasons for this difference include the small number of patients in the previous report and the significant inter-patient variability in p19 and p40 mRNA levels (not shown). Biopsies in the current study were obtained from patients with PPPP who had erythemato-squamous lesions on palms and soles. A similar study performed in patients who have crops of sterile pustules on palms and soles without erythematous plaques is needed before extending our conclusions to this morphological variant. Flow cytometry on cells extracted from skin biopsies was used to study the source of IL-17A for patients with PPPP and psoriasis located on trunk/proximal limbs. IL-23-independent IL-17A production by non T cells could have explained the previously observed high IL-17A and low IL-23 mRNA levels in PPPP. For example, it was shown in murine models that IL-23 was
dispensable for IL-17 induction and that IL-1b and high-mobility group box 1 strongly promoted IL-17 expression by gdT cells [27]. However no difference was observed between the proportion of IL17A+CD3+ or IL-17A+CD3 mast cells, which is in line with our current observation of similar IL-23 mRNA levels in PPPP/NPPPP as compared to trunk/proximal limbs. It was also observed that the number of T cells was lower and the proportion of IL-22+ mast cells was higher in PPPP as compared with NPPPP. This suggests that mast cells may play a significant role in the observed increase in chemokines such as S100A7, S100A8, S100A9 and b-defensin-2 in the skin of patients with PPPP as the production of these chemokines can be induced by IL-22 [28]. In conclusion an increase in IL-17A, IL-6, LL37, CXCL1, CXCL2, CXCL8, IL-19, IL-1b and in IL-22+ mast cells coupled with a decrease in CD3+ cells was observed in PPPP as compared to NPPPP. Levels of IL-23 in PPPP were similar to patients with NPPPP and psoriasis in other regions of the body. This suggests that the IL-17A pathway may play an important role in PPPP pathogenesis. Conflicts of interest Authors declare the following conflicts of interest: - Dr. Robert Bissonnette has received grants and research support, served as a consultant or received Honoria from Abbvie, Amgen,
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
-
-
-
-
Apopharma, Boehringer Ingelheim, Celgene, Dermira, Eli Lilly, Galderma, GSK-Stiefel, Merck, Incyte, Janssen, Kineta, Leo Pharma, Novartis, Pfizer, Tribute and Xenoport. Dr Catherine Maari has received research support or Honoria from Abbvie, Amgen, Apopharma, Boehringer Ingelheim, Celgene, Dermira, Eli Lilly, Galderma, Merck, Incyte, Janssen, Kineta, Leo Pharma, Novartis, Valeant, Pfizer and Tribute. Dr Chantal Bolduc has served as a consultant or received Honoria from Abbvie, Amgen, Celgene, Eli Lilly, Galderma, GSK-Stiefel, Janssen, Leo Pharma, Merck, Novartis, Tribute, Pfizer, Incyte and Xenoport. Dr Simon Nigen has served as a consultant or received Honoria from Abbvie, Amgen, Celgene, Eli Lilly, Galderma, Janssen, Leo Pharma, Merck, Novartis and Tribute. Dr. Shunya Mashiko and Dr. Marika Sarfati have received grant from Innovaderm. Dr James G Krueger has received grants and research support, served as a consultant and received Honoria from Novartis. Dr. Judilyn Fuentes-Duculan, Dr Kathleen M Bonifacio, Inna Cueto, Xuan Li, Dr. Mayte Suárez-Fariñas – No disclosures.
Funding This study was funded by Investigator Grant from Novartis Pharmaceuticals. References [1] J. Baliwag, D.H. Barnes, A. Johnston, Cytokines in psoriasis, Cytokine 73 (2) (2015) 342–350. [2] A. Chiricozzi, R. Saraceno, M.S. Chimenti, E. Guttman-Yassky, J.G. Krueger, Role of IL-23 in the pathogenesis of psoriasis: a novel potential therapeutic target? Expert Opin. Ther. Targets 18 (5) (2014) 513–525. [3] G. Girolomoni, U. Mrowietz, C. Paul, Psoriasis: rationale for targeting interleukin-17, Br. J. Dermatol. 167 (4) (2012) 717–724. [4] W. Tausend, C. Downing, S. Tyring, Systematic review of interleukin-12, interleukin-17, and interleukin-23 pathway inhibitors for the treatment of moderate-to-severe chronic plaque psoriasis: ustekinumab, briakinumab, tildrakizumab, guselkumab, secukinumab, ixekizumab, and brodalumab, J. Cutan. Med. Surg. 18 (3) (2014) 156–169. [5] P. Rich, B. Sigurgeirsson, D. Thaci, J.P. Ortonne, C. Paul, R.E. Schopf, A. Morita, K. Roseau, E. Harfst, A. Guettner, M. Machacek, C. Papavassilis, Secukinumab induction and maintenance therapy in moderate-to-severe plaque psoriasis: a randomized, double-blind, placebo-controlled, phase II regimen-finding study, Br. J. Dermatol. 168 (2) (2013) 402–411. [6] K.A. Papp, C. Leonardi, A. Menter, J.P. Ortonne, J.G. Krueger, G. Kricorian, G. Aras, J. Li, C.B. Russell, E.H. Thompson, S. Baumgartner, Brodalumab, an antiinterleukin-17-receptor antibody for psoriasis, N. Engl. J. Med. 366 (13) (2012) 1181–1189. [7] E. Volpe, N. Servant, R. Zollinger, S.I. Bogiatzi, P. Hupe, E. Barillot, V. Soumelis, A critical function for transforming growth factor-beta interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses, Nat. Immunol. 9 (6) (2008) 650–657. [8] S.L. Gaffen, R. Jain, A.V. Garg, D.J. Cua, The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing, Nat. Rev. Immunol. 14 (9) (2014) 585–600. [9] S. Mashiko, S. Bouguermouh, M. Rubio, N. Baba, R. Bissonnette, M. Sarfati, Human mast cells are major IL-22 producers in patients with psoriasis and atopic dermatitis, J. Allergy Clin. Immunol. 136 (2) (2015) 351–359. [10] A.M. Lin, C.J. Rubin, R. Khandpur, J.Y. Wang, M. Riblett, S. Yalavarthi, E.C. Villanueva, P. Shah, M.J. Kaplan, A.T. Bruce, Mast cells and neutrophils release IL-17 through extracellular trap formation in psoriasis, J. Immunol. 187 (1) (2011) 490–500.
7
[11] C.W. Lynde, Y. Poulin, R. Vender, M. Bourcier, S. Khalil, Interleukin 17A: toward a new understanding of psoriasis pathogenesis, J. Am. Acad. Dermatol. 71 (1) (2014) 141–150. [12] M. Frleta, S. Siebert, I.B. McInnes, The interleukin-17 pathway in psoriasis and psoriatic arthritis: disease pathogenesis and possibilities of treatment, Curr. Rheumatol. Rep. 16 (4) (2014) 414. [13] J. Chung, K. Callis Duffin, J. Takeshita, D.B. Shin, G.G. Krueger, A.D. Robertson, A. B. Troxel, A.S. Van Voorhees, E. Edson-Heredia, J.M. Gelfand, Palmoplantar psoriasis is associated with greater impairment of health-related quality of life compared with moderate to severe plaque psoriasis, J. Am. Acad. Dermatol. 71 (4) (2014) 623–632. [14] M. Sevrain, M.A. Richard, T. Barnetche, M. Rouzaud, A.P. Villani, C. Paul, M. Beylot-Barry, D. Jullien, S. Aractingi, F. Aubin, P. Joly, M. Le Maitre, A. Cantagrel, J.P. Ortonne, L. Misery, Treatment for palmoplantar pustular psoriasis: systematic literature review evidence-based recommendations and expert opinion, J. Eu. Acad. Dermatol. Venereol.: JEADV 28 (Suppl. 5) (2014) 13–16. [15] A.M. Brunasso, M. Puntoni, W. Aberer, C. Delfino, L. Fancelli, C. Massone, Clinical and epidemiological comparison of patients affected by palmoplantar plaque psoriasis and palmoplantar pustulosis: a case series study, Br. J. Dermatol. 168 (6) (2013) 1243–1251. [16] K. Kubota, Y. Kamijima, T. Sato, N. Ooba, D. Koide, H. Iizuka, H. Nakagawa, Epidemiology of psoriasis and palmoplantar pustulosis: a nationwide study using the Japanese national claims database, BMJ Open 5 (1) (2015) e006450. [17] M. Murakami, E. Hagforsen, V. Morhenn, A. Ishida-Yamamoto, H. Iizuka, Patients with palmoplantar pustulosis have increased IL-17 and IL-22 levels both in the lesion and serum, Exp. Dermatol. 20 (10) (2011) 845–847. [18] E. Hagforsen, H. Hedstrand, F. Nyberg, G. Michaelsson, Novel findings of Langerhans cells and interleukin-17 expression in relation to the acrosyringium and pustule in palmoplantar pustulosis, Br. J. Dermatol. 163 (3) (2010) 572–579. [19] M. Murakami, T. Kaneko, T. Nakatsuji, K. Kameda, H. Okazaki, X. Dai, Y. Hanakawa, M. Tohyama, A. Ishida-Yamamoto, K. Sayama, Vesicular LL-37 contributes to inflammation of the lesional skin of palmoplantar pustulosis, PLoS One 9 (10) (2014) e110677. [20] R. Bissonnette, S. Nigen, R.G. Langley, C.W. Lynde, J. Tan, J. Fuentes-Duculan, J.G. Krueger, Increased expression of IL-17A and limited involvement of IL-23 in patients with palmo-plantar (PP) pustular psoriasis or PP pustulosis; results from a randomised controlled trial, J. Eur. Acad. Dermatol. Venereol.: JEADV 28 (10) (2014) 1298–1305. [21] E. Lee, W.L. Trepicchio, J.L. Oestreicher, D. Pittman, F. Wang, F. Chamian, M. Dhodapkar, J.G. Krueger, Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris, J. Exp. Med. 199 (1) (2004) 125–130. [22] J. Fuentes-Duculan, M. Suarez-Farinas, L.C. Zaba, K.E. Nograles, K.C. Pierson, H. Mitsui, C.A. Pensabene, J. Kzhyshkowska, J.G. Krueger, M.A. Lowes, A subpopulation of CD163-positive macrophages is classically activated in psoriasis, J. Invest. Dermatol. 130 (10) (2010) 2412–2422. [23] H. Sumida, K. Yanagida, Y. Kita, J. Abe, K. Matsushima, M. Nakamura, S. Ishii, S. Sato, T. Shimizu, Interplay between CXCR2 and BLT1 facilitates neutrophil infiltration and resultant keratinocyte activation in a murine model of imiquimod-induced psoriasis, J. Immunol. 192 (9) (2014) 4361–4369. [24] M. Tauber, M. Viguier, E. Alimova, A. Petit, F. Liote, A. Smahi, H. Bachelez, Partial clinical response to anakinra in severe palmoplantar pustular psoriasis, Br. J. Dermatol. 171 (3) (2014) 646–649. [25] J. Saunier, S. Debarbieux, D. Jullien, L. Garnier, S. Dalle, L. Thomas, Acrodermatitis continua of Hallopeau treated successfully with ustekinumab and acitretin after failure of tumour necrosis factor blockade and anakinra, Dermatology 230 (2) (2015) 97–100. [26] E. Witte, G. Kokolakis, K. Witte, S. Philipp, W.D. Doecke, N. Babel, B.M. Wittig, K. Warszawska, A. Kurek, M. Erdmann-Keding, S. Kunz, K. Asadullah, M.E. Kadin, H.D. Volk, W. Sterry, K. Wolk, R. Sabat, IL-19 is a component of the pathogenetic IL-23/IL-17 cascade in psoriasis, J. Invest. Dermatol. 134 (11) (2014) 2757–2767. [27] E. Hasegawa, K.H. Sonoda, T. Shichita, R. Morita, T. Sekiya, A. Kimura, Y. Oshima, A. Takeda, T. Yoshimura, S. Yoshida, T. Ishibashi, A. Yoshimura, IL-23independent induction of IL-17 from gammadeltaT cells and innate lymphoid cells promotes experimental intraocular neovascularization, J. Immunol. 190 (4) (2013) 1778–1787. [28] R. Sabat, W. Ouyang, K. Wolk, Therapeutic opportunities of the IL-22-IL-22R1 system, Nat. Rev. Drug Discov. 13 (1) (2014) 21–38.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
Journal of Dermatological Science xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Journal of Dermatological Science journal homepage: www.jdsjournal.com
Opinion article
Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway Robert Bissonnettea,* , Judilyn Fuentes-Duculanb , Shunya Mashikoc , Xuan Lib , Kathleen M. Bonifaciob , Inna Cuetob , Mayte Suárez-Fariñasd, Catherine Maaria , Chantal Bolduca , Simon Nigena , Marika Sarfatic , James G. Kruegerb a
Innovaderm Research, 1851 Sherbrooke St. East, Suite 502, Montreal, Quebec, H2K 4L5, Canada Laboratory of Investigative Dermatology, The Rockefeller University, 1230 York Avenue, New York, NY, 10065 USA c Immunoregulation Laboratory, Centre de Recherche du Centre Hospitalier de l’Université de Montréal (CRCHUM), 900 Saint-Denis Street, Montreal, Quebec, H2X 0A9, Canada d Dept. of Population Health Science and Policy, Dept. of Genetics and Genomics Science and Dept. of Dermatology, Icahn School of Medicine at Mount Sinai, 1425 Madison Ave, L2-70C, Box 1077, New York, NY, 10029, USA b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 12 May 2016 Received in revised form 8 September 2016 Accepted 28 September 2016
Background: Palmoplantar pustular psoriasis (PPPP) is a variant of psoriasis, which has significant negative impact on quality of life. The cellular and molecular inflammatory pathways involved in PPPP have not been well studied. Objective: Study the expression of cytokines and chemokines involved in the IL-17/IL-23 axis in palmoplantar pustular psoriasis and other difficult to treat psoriasis areas (palms, scalp, elbows and lower legs). Methods: Skin biopsies were performed on a total of 80 patients with PPPP, non-pustular palmoplantar psoriasis (NPPPP), or psoriasis located on elbows, knees and scalp as well as 10 healthy subjects. RT-PCR, immunohistochemistry and flow cytometry on cells extracted from skin biopsies were used to compare PPPP to other forms of psoriasis. Results: There was a significant (p < 0.05) increase in the expression of IL-1b, IL-6, LL-37, IL-19, IL-17A, CXCL1 and CXCL2 in PPPP as compared to NPPPP. However, there was no significant difference in expression of IL-23 in PPPP as compared to NPPPP and other forms of psoriasis. The proportion of IL-22+ but not IL-17A+ mast cells was higher in PPPP as compared to NPPPP (p < 0.05). Conclusion: These results suggest that the IL-17A pathway may play a more important role in PPPP than in NPPPP. ã 2016 Published by Elsevier Ireland Ltd on behalf of Japanese Society for Investigative Dermatology.
Keywords: Psoriasis Palmoplantar psoriasis Palmoplantar pustular psoriasis IL-17 IL-23 Skin biopsies
1. Introduction Psoriasis vulgaris is the most common clinical presentation of psoriasis, an immune-mediated multi-systemic disease. Our understanding of the pathophysiology of psoriasis vulgaris improved significantly over the past 15 years following clinical studies performed using monoclonal antibodies to treat psoriasis. These studies have shown that several cytokines, including TNF-alpha, IL-23 and IL-17, have an important role in the
Abbreviations: PPPP, palmoplantar pustular psoriasis; NPPPP, non-pustular palmoplantar psoriasis. * Corresponding author. E-mail addresses: [email protected], [email protected], [email protected] (R. Bissonnette).
pathophysiology of psoriasis as evidenced by the rapid and important improvement in skin and joint disease following treatment with antagonists of IL-23 or IL-17 [1–7]. IL-23 is produced by a variety of cells including antigen presenting cells, neutrophils and macrophages [8]. IL-23 is involved in expansion and maintenance of Type 17 T-cells which are the major source of IL-17 in the skin of patients with psoriasis [7,9,10]. In addition to being produced by T cells, IL-17 is produced by other cell types including neutrophils and mast cells [9,10]. IL-17 contributes to the psoriasis phenotype by increasing the production of numerous cytokines including IL-6, IL-8, IL-36 and TNF-alpha, of chemokines including CXCL1, CXCL3, CXCL5, CXCL8 and CCL20 and of antimicrobial peptides including b-defensin and S100A7, S100A8 and S100A9 [11,12]. Palmoplantar pustular psoriasis (PPPP) is a variant of psoriasis that can limit the ability to walk, work and perform routine daily
http://dx.doi.org/10.1016/j.jdermsci.2016.09.019 0923-1811/ ã 2016 Published by Elsevier Ireland Ltd on behalf of Japanese Society for Investigative Dermatology.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
2
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Table 1 Sequences of primers and probes used for RT-PCR. Gene 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29
Assay ID
KRT16 IL-23p19 (IL23A) IL-23p40 (IL12B) IL17A CXCL1 CXCL2 CXCL3 CXCL8 CCL20 Beta defens in (DEFB4A) LCN2 LL37 (CAMP) S100A7 S100A7 S100A8 S100A9 IL19 TNF IL1B IL-6 IL36A IL36B IL36G IL36RN IL22 GPRIN1 ADAM23 RIMS3 hARP (Custom TaqMan Assays)
Cat.#
Inventory
Hs00955082_g1 4331182 Hs00900828_g1 4331182 Hs01011518_m1 4331182 Hs00174383_m1 4331182 Hs00236937_m1 4331182 Hs00601975_m1 4331182 Hs00171061_m1 4331182 Hs00174103_m1 4331182 Hs01011368_m1 4331182 Hs00175474_m1 4331182 Hs01008571_m1 4331182 Hs00189038_m1 4331182 Hs00161488_m1 4331182 Hs01923188_u1 4331182 Hs00374264_g1 4331182 Hs00610058_m1 4331182 Hs00604657_m1 4331182 Hs01113624_g1 4331182 Hs01555410_m1 4331182 Hs00985639_m1 4331182 Hs00205367_m1 4331182 Hs00758166_m1 4331182 Hs00219742_m1 4331182 Hs01104220_g1 4331182 Hs01574154_m1 4331182 Hs00287446_m1 4331182 Hs00187022_m1 4331182 Hs01119237_m1 4331182 Forwa rd- Pri mer: CGCTGCTGAACATGCTCAA Revers e- Pri mer: TGTCGAACACCTGCTGGATG Probe Sequence: 6FAM-TCCCCCTTCTCCTTTGGGCTGG-TAMRA
activities [13]. PPPP is a chronic skin disease characterized by crops of sterile pustules on palms and soles [14]. In North-America and Western Europe the prevalence of PPPP has been estimated to be between 0.01 and 0.05% [15]. However the prevalence in Asia is higher. For example, in Japan the prevalence of PPPP has been reported to be 0.12% as compared to 0.34% for plaque psoriasis [16]. The inflammatory pathways involved in palmoplantar pustular psoriasis have not been studied as well as those of psoriasis vulgaris but increased levels of various cytokines, including IL-17 [17–19] and IL-22 [17] have been reported in patients with palmoplantar pustulosis. We recently reported an increase in expression of IL-17A in the skin of patients with palmoplantar pustular psoriasis without an increase in expression of IL-23 [20]. This is different from psoriasis vulgaris where elevations of both IL17A and IL-23 expression is usually observed [21]. The current study was initiated in order to compare expression of chemokines and cytokines at the cellular and tissue levels between PPPP, non-pustular palmoplantar psoriasis (NPPPP) and
Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life Life
Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies Technologies
psoriasis located on the trunk/proximal limbs and at other regions of the body that are known to be more resistant to therapy. 2. Material and methods 2.1. Patients A total of 80 adult subjects with different types of psoriasis and 10 adult subjects without psoriasis were enrolled (refer to results Section). The study was approved by an ethics committee and written informed consent was obtained from each subject before any study procedure was performed. Five groups of patients with psoriasis of at least 6 months duration were recruited: (1) palmoplantar pustular psoriasis (PPPP; n = 10) (2) non pustular palmoplantar psoriasis (NPPPP; n = 10) (3) scalp psoriasis (n = 20) (4) elbow psoriasis (n = 20) and (5) lower leg psoriasis (n = 20). Patients with scalp, elbow and lower leg psoriasis had to have psoriasis vulgaris on the trunk or proximal limbs on an area that
Table 2 Demographics. Healthy Subjects (n = 10)
Elbows (n = 20)
Lower Leg (n = 20)
NPPPP (n = 10)
PPPP (n = 10)
Age (y) m (SD) Female n (%) Male n (%)
31.8 (15.89) 5 (50%) 5 (50%)
48.4 (14.21) 4 (20 %) 16 (80 %)
50.05 (14.45) 2 (10 %) 18 (90 %)
53 (12.89) 7 (70 %) 3 (30 %)
62.6 (9.44) 9 (90 %) 1 (10 %)
45.1 (14.82) 11 (55 %) 9 (45 %)
Race n (%) White Black Asian
10 (100%) 0 (0%) 0 (0%)
20 (100%) 0 (0%) 0 (0%)
20 (100%) 0 (0%) 0 (0%)
10 (100%) 0 (0%) 0 (0%)
10 (100%) 0 (0%) 0 (0%)
19 (95%) 0 (0%) 1 (5%)
Ethnicity n (%) Hispanic Non-Hispanic
3 (30%) 7 (70%)
0 (0%) 20 (100%)
2 (10%) 18 (90%)
0 (0%) 100 (80%)
0 (0%) 10 (100%)
1 (5%) 19 (95%)
SCALP (n = 20)
m = Mean, n = sample size, SD = standard deviation, y = year.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
3
Fig. 1. A: Representative images of immunohistochemistry with neutrophil elastase (NE) (b, d) for PPPP (a, b) and NPPPP (c, d). B: Number of cells per field positive for CD3, NE or CD11c for patients with non-pustular palmoplantar psoriasis (NPPPP) and palmoplantar pustular psoriasis (PPPP). * indicates a significant (p < 0.05) difference between NPPPP and PPPP.
was suitable for skin biopsies. Patients with NPPPP had erythematous and squamous plaques of psoriasis on palms and/or soles without presence or history of pustules. Patients with PPPP had erythematous and squamous plaques on palms and/or soles with the presence of active pustules on palms and/or soles. The main exclusion criteria were the use of topical treatments for psoriasis in the past 2 weeks, the use of oral treatments for psoriasis or oral corticosteroids in the past 4 weeks, the use of biologics in the past 90 days or the presence of any immune deficiency. Patients with scalp psoriasis, elbow psoriasis and lower leg psoriasis all had at least two 4 mm punch biopsies performed: one from a plaque located on the scalp, elbow or lower leg and one from a plaque located on the trunk or proximal limbs. Patients with
NPPPP and PPPP had a 4 mm biopsy of palmoplantar psoriasis but the biopsy on the trunk or proximal limb was only performed if active psoriasis vulgaris was present on those areas (2 patients with NPPPP had biopsies on the trunk/proximal limbs and no patients with PPPP had biopsies on those areas). Each biopsy was split in half and one half was placed in Optimum Cutting Medium (Sakura Finetek, Torrance, CA) and frozen at 70 C for immunohistochemistry while the other half was frozen in liquid nitrogen for reverse transcriptase polymerase chain reaction (RT-PCR). In addition, all patients with NPPPP and PPPP and 10 patients with psoriasis present on the trunk or upper limbs had an additional 4 mm skin biopsy to isolate inflammatory cells present in lesional skin. Skin biopsies were cut in 3 pieces, immediately placed in
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
4
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
culture medium and processed within 90 min for cell extraction using a previously described procedure [9]. 2.2. Flow cytometry Briefly, the biopsies were enzymatically digested with 0.2 mg/ ml of Liberase (Roche, Mannheim, Germany) for 60 min at 37 C in Dulbecco’s Modified Eagle Medium (DMEM) (Life Technologies Inc. Burlington, Ontario, Canada) followed by mechanical dissociation using a gentleMACS Dissociator (Miltenyi Biotech, Bergisch Gladbach, Germany). This procedure was repeated twice. Viable cells were counted by Trypan blue dye exclusion and single cell suspensions were immediately stained with LIVE/DEAD1 Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation (Molecular Probes1, Life Technologies Inc., ON, Canada). Skin cell suspensions were incubated for 15 min at 4 C with the human IgG or antihuman CD32 blocker from STEMCELL TechnologiesTM and stained for surface antigens for 30 min at 4 C using the following mAbs: APC-H7 anti-CD45 (2D1) (Becton Dickinson); FITC anti-FceRIa (AER-37) (eBioscience); PE-Cy7 anti-CD3 (UCHT1), APC anti-c-Kit (104D2), Pacific blueTM anti-Lineage Cocktail (CD3, CD14, CD16, CD19, CD20, CD56), (UCHT1, HCD14, 3G8, HIB19, 2H7, HCD56); Alexa Fluor1647 IgG1k (MOPC-21), PE-Cy7 IgG1k (MOPC-21) and FITC IgG2bk (MPC-11) were used as isotype-matched control mAbs (BioLegend). Cells were then fixed, permeabilized using the BD Cytofix/CytopermTM Fixation/Permeabilization Solution Kit (Becton Dickinson) and stained for intracytoplasmic cytokine expression using PerCP anti-IL-17 (41802) and PE anti-IL-22 (142928). PerCP IgG1 (11711) and PE IgG1 (11711) were used as isotypematched control mABs (R&D SystemsTM). FACS analysis was performed on CD45+ gated hematopoietic viable cells after doublets exclusion using FSC and SSC gating strategies. Cells were analyzed by using LSR II (Becton Dickinson) with FCS express flow cytometry analysis software.
the differences between those groups are adjusted by the differences in biopsies from soles and palms. This formulation intrinsically models the within patient correlation structure as in the case of a paired t-test. Immunohistochemistry data was compared for various body regions using the Wilcoxon test. Flow cytometry groups were compared by Mann-Whitney unpaired test (Panel A, C and D) or Wilcoxon paired test (panel B). 3. Results A total of 80 patients with psoriasis and 10 healthy volunteers were recruited and skin biopsies were performed as planned. Demographics is provided in Table 2. 3.1. Immunohistochemistry NPPPP and PPPP both display important hyperkeratosis with parakeratosis, acanthosis with elongation of rete ridges and mostly mononuclear cell inflammatory infiltration in the upper dermis (Fig. 1A). An important difference between NPPPP and PPPP is the presence of clusters of neutrophils (in red arrows) in the epidermis of patients with PPPP (Fig. 1A). The number of CD3+ cells in the dermis was higher for NPPPP as compared to PPPP (p = 0.04; Fig. 1B). The number of cells positive for neutrophil elastase in the dermis was numerically higher for PPPP as compared to NPPPP but
2.3. Immunohistochemistry Frozen tissue sections from lesional skin biopsies of NPPPP and PPPP patients were blocked with 10% normal horse serum and stained with CD3 (BD Biosciences), CD11c (BD Pharmingen), and Neutrophil Elastase (Dako) overnight. Biotin-labeled horse antimouse (Vector Laboratories) was used to detect the mouse monoclonal antibodies. The staining signal was amplified with avidin-biotin complex (Vector Laboratories) and developed using chromogen 3-amino-9-ethylcarbazole (Sigma-Aldrich). 2.4. Reverse transcriptase-polymerase chain reaction (RT-PCR) RNA was extracted from lesional skin of NPPPP and PPPP patient biopsies using the miRNeasy Mini KIT (Cat#: 217004 Qiagen, Valencia, CA, U.S.A.). RT-PCR was performed using TaqMan Fast Virus 1- Step Master Mix, Primers and Probes (Life Technologies, Grand Island, NY, U.S.A.) as previously published [22]. Sequences of primers and probes used in this study are found in Table 1. The results were normalized to HARP housekeeping gene. 2.5. Statistical analysis RT-PCR values were normalized to housekeeping gene hARP and log2-transformed for analysis. Measurements under the limit of detections were imputed as 20% of the minimum value observed for that gene. qRT-PCR expression data was modeled using a mixed effect model with body part/diagnosis as a fixed effect and a random intercept for each patient. For the comparisons between NPPPP, PPPP and normal skin, the diagnosis was considered a factor and the biopsy site (palm or sole) was considered as covariate, so
Fig. 2. p19, p40 and IL-17A mRNA levels from different body regions of normal skin from healthy subjects and psoriatic skin from subjects with psoriasis. * indicates a significant (p < 0.05) difference between psoriasis and healthy subjects. NPPPP = non-pustular palmoplantar psoriasis. PPPP = palmoplantar pustular psoriasis.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
the difference was not statistically significant (p = 0.242; Fig. 1B). PPPP lesions also had focal neutrophil accumulations (pustules) within the epidermis that were not observed in NPPPP biopsies, but individual cell counts could not be performed on these regions. NPPPP, PPPP, and psoriasis from trunk, leg, and elbow lesions were characterized by consistently elevated T-cell counts in the epidermis and dermis and also high numbers of proliferative (Ki67+) epidermal keratinocytes. No marked differences in total Tcell numbers were detected between different body regions, but there was a tendency for NPPPP lesions to have higher T-cell infiltrates in the epidermis (mean epidermal T-cell counts 182 in NPPPP compared to 103 in PPPP, p = 0.036).
5
was significantly higher as compared to the percentage of IL-22producing T cells in trunk/proximal limbs and NPPPP plaques and tended towards an increase in PPPP (Fig. 4C). However, when mast cells (lin CD3 ckit+FceR+ cells) were examined, we found that the proportion of IL-22+ mast cells but not IL-17+ mast cells was higher in biopsies from PPPP as compared to NPPPP (p < 0.05; Fig. 4D and E). In agreement with our recent studies [9], the frequency of IL17A+ T cells was higher than IL-17+ mast cells for trunk/proximal limbs, NPPPP and PPPP; the situation was the opposite for IL-22 where the proportion of IL-22+ mast cells was higher than the proportion of IL-22+ T cells for trunk/proximal limbs, NPPPP and PPPP (not shown).
3.2. Reverse transcriptase-polymerase chain reaction (RT-PCR) 4. Discussion The levels of p19, p40 and IL-17A were higher in psoriatic skin as compared to normal skin from trunk/proximal limbs, elbow, lower Leg and scalp (Fig. 2; p< 0.001). The levels of IL-17A were lower in NPPPP as compared to PPPP (Fig. 2c; p < 0.05). Expression of CXCL1, CXCL2, CXCL3, CXCL8, CCL20, DEFB4A, LCN2, TNF-alpha, S100A9, S100A7, S100A8, IL-19, and IL-1 were also higher in PPPP and NPPPP as compared to normal skin (Fig. 3). IL-6 (p = 0.013), LL37 (p = 0.024), CXCL8 (p = 0.037), CXCL1 (p = 0.009), CXCL2 (p = 0.041), IL-1b (p = 0.013), IL–36 B (p = 0.0019), and IL-19 (p = 0.0003) expression was higher in PPPP as compared to NPPPP (Fig. 3). 3.3. Flow cytometry The proportion of T cells was similar for biopsies from trunk/ proximal limbs and non-pustular palmoplantar psoriasis (NPPPP) but lower in PPPP as compared to trunk/proximal limbs (p = 0.0152) and NPPPP (p = 0.0341) (Fig. 4B). As depicted in Fig. 4C, there was no difference in the proportion of IL-17A+CD3+ cells as well as IL-22+CD3+ cells between trunk/proximal limbs, NPPPP and PPPP. Notably, the percentage of IL-17-producing T cells
The striking increase in IL-1b coupled with the increase in IL-6, the lower number of CD3+ cells as seen with immunohistochemistry and the lower proportion of CD3+ T cells and higher proportion of IL-22+ mast cells suggest that innate immunity may play a more important role in PPPP than in NPPPP. One aspect of the IL-17 response immune axis is that high levels of CXCL1, 2, 3 & 8 can be produced by keratinocytes in response to IL-17. CXCLchemokines largely regulate neutrophil chemotaxis and higher levels of these CXCL chemokines in PPPP, may be a reason for neutrophilic accumulations (pustules) within the epidermis. In turn, the IL-17 response of keratinocytes in PPPP might reflect higher NFkB activation by TNF or IL-1b, also reflected in higher IL-6 production, as transcription of IL-17 regulated genes is regulated by NFkB and CEBP/b,d; in synergy. In the imiquimod murine model of psoriasis IL-1b produced by neutrophils has been shown to promote IL-19 production by keratinocytes [23]. Interestingly, cases of good response to anakinra, an IL-1b antagonist, have been reported for patients with PPPP and acrodermatitis continua of Hallopeau [24,25]. The more than 125 fold increase in IL-19 in PPPP as compared to NPPPP also suggest that this IL-17A inducible
Fig. 3. Heat map of mRNA levels of different cytokines and chemokines for patients with non-pustular palmoplantar psoriasis (NPPPP), palmoplantar pustular psoriasis (PPPP) and healthy subjects (HS). * and ** indicate a significant (p < 0.01 and p < 0.001 respectively) differences. Yellow-red scale represents gene expression levels: red for low and yellow high gene expression.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
6
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
Fig. 4. A: Gating strategy on Aqua LIVE/DEAD negative cells in relation to cell size (FSC) to show viable CD45+ hematopoietic cells (top panels); percentage IL-17 and IL-22producing cells after gating on mast cells (c-Kit+ FceRI+) and T cells (cKit-CD3+) (bottom panels). Shown is one representative experiment performed on a NPPPP patient. B: Proportion of CD3+ T cells for NPPPP, PPPP or psoriasis vulgaris from trunk/proximal limbs. C: Correlation between IL-17+CD3+ and IL-22+CD3+ cells. D and E: proportion of IL17+ mast cells (C) and IL-22+ mast cells (D). *p < 0.05 **p < 0.01.
cytokine may also play an important role, and even be a potential therapeutic target, in patients with PPPP [26]. In the current study mRNA levels of IL-23 (both the p19 and the p40 subunits) were higher in psoriatic skin as compared to skin of healthy subjects from all body areas studied. However levels of p19 and p40 from lesional skin of patients with palmoplantar pustular and non-pustular psoriasis were in the same order of magnitude as for patients with psoriasis elsewhere on the body (trunk/proximal limbs, scalp, lower legs elbows). This observation is different from our previous report of a low IL-23 signal in lesional skin of patients with palmoplantar pustular psoriasis [20]. Possible reasons for this difference include the small number of patients in the previous report and the significant inter-patient variability in p19 and p40 mRNA levels (not shown). Biopsies in the current study were obtained from patients with PPPP who had erythemato-squamous lesions on palms and soles. A similar study performed in patients who have crops of sterile pustules on palms and soles without erythematous plaques is needed before extending our conclusions to this morphological variant. Flow cytometry on cells extracted from skin biopsies was used to study the source of IL-17A for patients with PPPP and psoriasis located on trunk/proximal limbs. IL-23-independent IL-17A production by non T cells could have explained the previously observed high IL-17A and low IL-23 mRNA levels in PPPP. For example, it was shown in murine models that IL-23 was
dispensable for IL-17 induction and that IL-1b and high-mobility group box 1 strongly promoted IL-17 expression by gdT cells [27]. However no difference was observed between the proportion of IL17A+CD3+ or IL-17A+CD3 mast cells, which is in line with our current observation of similar IL-23 mRNA levels in PPPP/NPPPP as compared to trunk/proximal limbs. It was also observed that the number of T cells was lower and the proportion of IL-22+ mast cells was higher in PPPP as compared with NPPPP. This suggests that mast cells may play a significant role in the observed increase in chemokines such as S100A7, S100A8, S100A9 and b-defensin-2 in the skin of patients with PPPP as the production of these chemokines can be induced by IL-22 [28]. In conclusion an increase in IL-17A, IL-6, LL37, CXCL1, CXCL2, CXCL8, IL-19, IL-1b and in IL-22+ mast cells coupled with a decrease in CD3+ cells was observed in PPPP as compared to NPPPP. Levels of IL-23 in PPPP were similar to patients with NPPPP and psoriasis in other regions of the body. This suggests that the IL-17A pathway may play an important role in PPPP pathogenesis. Conflicts of interest Authors declare the following conflicts of interest: - Dr. Robert Bissonnette has received grants and research support, served as a consultant or received Honoria from Abbvie, Amgen,
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019
G Model DESC 3073 No. of Pages 7
R. Bissonnette et al. / Journal of Dermatological Science xxx (2016) xxx–xxx
-
-
-
-
Apopharma, Boehringer Ingelheim, Celgene, Dermira, Eli Lilly, Galderma, GSK-Stiefel, Merck, Incyte, Janssen, Kineta, Leo Pharma, Novartis, Pfizer, Tribute and Xenoport. Dr Catherine Maari has received research support or Honoria from Abbvie, Amgen, Apopharma, Boehringer Ingelheim, Celgene, Dermira, Eli Lilly, Galderma, Merck, Incyte, Janssen, Kineta, Leo Pharma, Novartis, Valeant, Pfizer and Tribute. Dr Chantal Bolduc has served as a consultant or received Honoria from Abbvie, Amgen, Celgene, Eli Lilly, Galderma, GSK-Stiefel, Janssen, Leo Pharma, Merck, Novartis, Tribute, Pfizer, Incyte and Xenoport. Dr Simon Nigen has served as a consultant or received Honoria from Abbvie, Amgen, Celgene, Eli Lilly, Galderma, Janssen, Leo Pharma, Merck, Novartis and Tribute. Dr. Shunya Mashiko and Dr. Marika Sarfati have received grant from Innovaderm. Dr James G Krueger has received grants and research support, served as a consultant and received Honoria from Novartis. Dr. Judilyn Fuentes-Duculan, Dr Kathleen M Bonifacio, Inna Cueto, Xuan Li, Dr. Mayte Suárez-Fariñas – No disclosures.
Funding This study was funded by Investigator Grant from Novartis Pharmaceuticals. References [1] J. Baliwag, D.H. Barnes, A. Johnston, Cytokines in psoriasis, Cytokine 73 (2) (2015) 342–350. [2] A. Chiricozzi, R. Saraceno, M.S. Chimenti, E. Guttman-Yassky, J.G. Krueger, Role of IL-23 in the pathogenesis of psoriasis: a novel potential therapeutic target? Expert Opin. Ther. Targets 18 (5) (2014) 513–525. [3] G. Girolomoni, U. Mrowietz, C. Paul, Psoriasis: rationale for targeting interleukin-17, Br. J. Dermatol. 167 (4) (2012) 717–724. [4] W. Tausend, C. Downing, S. Tyring, Systematic review of interleukin-12, interleukin-17, and interleukin-23 pathway inhibitors for the treatment of moderate-to-severe chronic plaque psoriasis: ustekinumab, briakinumab, tildrakizumab, guselkumab, secukinumab, ixekizumab, and brodalumab, J. Cutan. Med. Surg. 18 (3) (2014) 156–169. [5] P. Rich, B. Sigurgeirsson, D. Thaci, J.P. Ortonne, C. Paul, R.E. Schopf, A. Morita, K. Roseau, E. Harfst, A. Guettner, M. Machacek, C. Papavassilis, Secukinumab induction and maintenance therapy in moderate-to-severe plaque psoriasis: a randomized, double-blind, placebo-controlled, phase II regimen-finding study, Br. J. Dermatol. 168 (2) (2013) 402–411. [6] K.A. Papp, C. Leonardi, A. Menter, J.P. Ortonne, J.G. Krueger, G. Kricorian, G. Aras, J. Li, C.B. Russell, E.H. Thompson, S. Baumgartner, Brodalumab, an antiinterleukin-17-receptor antibody for psoriasis, N. Engl. J. Med. 366 (13) (2012) 1181–1189. [7] E. Volpe, N. Servant, R. Zollinger, S.I. Bogiatzi, P. Hupe, E. Barillot, V. Soumelis, A critical function for transforming growth factor-beta interleukin 23 and proinflammatory cytokines in driving and modulating human T(H)-17 responses, Nat. Immunol. 9 (6) (2008) 650–657. [8] S.L. Gaffen, R. Jain, A.V. Garg, D.J. Cua, The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing, Nat. Rev. Immunol. 14 (9) (2014) 585–600. [9] S. Mashiko, S. Bouguermouh, M. Rubio, N. Baba, R. Bissonnette, M. Sarfati, Human mast cells are major IL-22 producers in patients with psoriasis and atopic dermatitis, J. Allergy Clin. Immunol. 136 (2) (2015) 351–359. [10] A.M. Lin, C.J. Rubin, R. Khandpur, J.Y. Wang, M. Riblett, S. Yalavarthi, E.C. Villanueva, P. Shah, M.J. Kaplan, A.T. Bruce, Mast cells and neutrophils release IL-17 through extracellular trap formation in psoriasis, J. Immunol. 187 (1) (2011) 490–500.
7
[11] C.W. Lynde, Y. Poulin, R. Vender, M. Bourcier, S. Khalil, Interleukin 17A: toward a new understanding of psoriasis pathogenesis, J. Am. Acad. Dermatol. 71 (1) (2014) 141–150. [12] M. Frleta, S. Siebert, I.B. McInnes, The interleukin-17 pathway in psoriasis and psoriatic arthritis: disease pathogenesis and possibilities of treatment, Curr. Rheumatol. Rep. 16 (4) (2014) 414. [13] J. Chung, K. Callis Duffin, J. Takeshita, D.B. Shin, G.G. Krueger, A.D. Robertson, A. B. Troxel, A.S. Van Voorhees, E. Edson-Heredia, J.M. Gelfand, Palmoplantar psoriasis is associated with greater impairment of health-related quality of life compared with moderate to severe plaque psoriasis, J. Am. Acad. Dermatol. 71 (4) (2014) 623–632. [14] M. Sevrain, M.A. Richard, T. Barnetche, M. Rouzaud, A.P. Villani, C. Paul, M. Beylot-Barry, D. Jullien, S. Aractingi, F. Aubin, P. Joly, M. Le Maitre, A. Cantagrel, J.P. Ortonne, L. Misery, Treatment for palmoplantar pustular psoriasis: systematic literature review evidence-based recommendations and expert opinion, J. Eu. Acad. Dermatol. Venereol.: JEADV 28 (Suppl. 5) (2014) 13–16. [15] A.M. Brunasso, M. Puntoni, W. Aberer, C. Delfino, L. Fancelli, C. Massone, Clinical and epidemiological comparison of patients affected by palmoplantar plaque psoriasis and palmoplantar pustulosis: a case series study, Br. J. Dermatol. 168 (6) (2013) 1243–1251. [16] K. Kubota, Y. Kamijima, T. Sato, N. Ooba, D. Koide, H. Iizuka, H. Nakagawa, Epidemiology of psoriasis and palmoplantar pustulosis: a nationwide study using the Japanese national claims database, BMJ Open 5 (1) (2015) e006450. [17] M. Murakami, E. Hagforsen, V. Morhenn, A. Ishida-Yamamoto, H. Iizuka, Patients with palmoplantar pustulosis have increased IL-17 and IL-22 levels both in the lesion and serum, Exp. Dermatol. 20 (10) (2011) 845–847. [18] E. Hagforsen, H. Hedstrand, F. Nyberg, G. Michaelsson, Novel findings of Langerhans cells and interleukin-17 expression in relation to the acrosyringium and pustule in palmoplantar pustulosis, Br. J. Dermatol. 163 (3) (2010) 572–579. [19] M. Murakami, T. Kaneko, T. Nakatsuji, K. Kameda, H. Okazaki, X. Dai, Y. Hanakawa, M. Tohyama, A. Ishida-Yamamoto, K. Sayama, Vesicular LL-37 contributes to inflammation of the lesional skin of palmoplantar pustulosis, PLoS One 9 (10) (2014) e110677. [20] R. Bissonnette, S. Nigen, R.G. Langley, C.W. Lynde, J. Tan, J. Fuentes-Duculan, J.G. Krueger, Increased expression of IL-17A and limited involvement of IL-23 in patients with palmo-plantar (PP) pustular psoriasis or PP pustulosis; results from a randomised controlled trial, J. Eur. Acad. Dermatol. Venereol.: JEADV 28 (10) (2014) 1298–1305. [21] E. Lee, W.L. Trepicchio, J.L. Oestreicher, D. Pittman, F. Wang, F. Chamian, M. Dhodapkar, J.G. Krueger, Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris, J. Exp. Med. 199 (1) (2004) 125–130. [22] J. Fuentes-Duculan, M. Suarez-Farinas, L.C. Zaba, K.E. Nograles, K.C. Pierson, H. Mitsui, C.A. Pensabene, J. Kzhyshkowska, J.G. Krueger, M.A. Lowes, A subpopulation of CD163-positive macrophages is classically activated in psoriasis, J. Invest. Dermatol. 130 (10) (2010) 2412–2422. [23] H. Sumida, K. Yanagida, Y. Kita, J. Abe, K. Matsushima, M. Nakamura, S. Ishii, S. Sato, T. Shimizu, Interplay between CXCR2 and BLT1 facilitates neutrophil infiltration and resultant keratinocyte activation in a murine model of imiquimod-induced psoriasis, J. Immunol. 192 (9) (2014) 4361–4369. [24] M. Tauber, M. Viguier, E. Alimova, A. Petit, F. Liote, A. Smahi, H. Bachelez, Partial clinical response to anakinra in severe palmoplantar pustular psoriasis, Br. J. Dermatol. 171 (3) (2014) 646–649. [25] J. Saunier, S. Debarbieux, D. Jullien, L. Garnier, S. Dalle, L. Thomas, Acrodermatitis continua of Hallopeau treated successfully with ustekinumab and acitretin after failure of tumour necrosis factor blockade and anakinra, Dermatology 230 (2) (2015) 97–100. [26] E. Witte, G. Kokolakis, K. Witte, S. Philipp, W.D. Doecke, N. Babel, B.M. Wittig, K. Warszawska, A. Kurek, M. Erdmann-Keding, S. Kunz, K. Asadullah, M.E. Kadin, H.D. Volk, W. Sterry, K. Wolk, R. Sabat, IL-19 is a component of the pathogenetic IL-23/IL-17 cascade in psoriasis, J. Invest. Dermatol. 134 (11) (2014) 2757–2767. [27] E. Hasegawa, K.H. Sonoda, T. Shichita, R. Morita, T. Sekiya, A. Kimura, Y. Oshima, A. Takeda, T. Yoshimura, S. Yoshida, T. Ishibashi, A. Yoshimura, IL-23independent induction of IL-17 from gammadeltaT cells and innate lymphoid cells promotes experimental intraocular neovascularization, J. Immunol. 190 (4) (2013) 1778–1787. [28] R. Sabat, W. Ouyang, K. Wolk, Therapeutic opportunities of the IL-22-IL-22R1 system, Nat. Rev. Drug Discov. 13 (1) (2014) 21–38.
Please cite this article in press as: R. Bissonnette, et al., Palmoplantar pustular psoriasis (PPPP) is characterized by activation of the IL-17A pathway, J Dermatol Sci (2016), http://dx.doi.org/10.1016/j.jdermsci.2016.09.019