- Email: [email protected]
PCR-based assay for Mya arenaria detection from marine environmental samples and tracking its invasion in coastal ecosystems
Accepted Manuscript Title: PCR-based assay for Mya arenaria detection from marine environmental samples and tracking its invasion in coastal ecosystems Authors: Alba Ardura, Anastasija Zaiko PII: DOI: Reference:
S1617-1381(17)30153-X https://doi.org/10.1016/j.jnc.2018.02.007 JNC 25623
To appear in: Received date: Revised date: Accepted date:
21-3-2017 13-2-2018 13-2-2018
Please cite this article as: Ardura A, Zaiko A, PCR-based assay for Mya arenaria detection from marine environmental samples and tracking its invasion in coastal ecosystems, Journal for Nature Conservation (2010), https://doi.org/10.1016/j.jnc.2018.02.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
PCR-based assay for Mya arenaria detection from marine environmental samples and tracking its invasion in coastal ecosystems
Short title:Mya arenaria-specific primers for its early detection
IP T
Alba Ardura1a and Anastasija Zaiko2,3
M
Abstract
PT
ED
The introduction of invasive species into a new environment is one of the most important factors implicated in loss of native biodiversity. Their early detection is indispensable to efficient control and management response, because after their incursion and establishment the eradication is nearly impossible. The Mediterranean Sea is one of the world´s hotspots of biological invasions and existing monitoring programs are often insufficient for effective surveillance of the established invasive populations or early detection of new incursions. The aim of the current study was to design a specific molecular marker for detecting and monitoring the soft shell clam Mya arenaria, listed among 100 Mediterranean Worst Invasive Species, from environmental samples. The 16S marker was designed in silico and validated in vitro on serial dilutions of M. arenaria DNA and other closely related mollusk species; its performance was also tested on complex environmental samples collected from locations in the Baltic Sea with known established M. arenaria population. The new marker allows amplifying small fragments of 279 bp and detecting as low as 0.00103ng/µl of M. arenaria DNA with no cross-amplification detected. We suggest the use of this and other species-specific markers for targeted surveillance of invasive species and prompt detection of the prospective incursions. Such monitoring approach has the potential to be adopted by citizen science programs due to its easy implementation, minimal technical skills requirements and reasonable amount of associated expenditures.
CC E A
N
A
a: Corresponding author: [email protected]
U
SC R
1- PSL Research University: EPHE-UPVD-CNRS, USR 3278 CRIOBE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan Cedex, France. 2- Coastal and Freshwater Group, Cawthron Institute, 98 Halifax Street East, 7010 Nelson, New Zealand. 3- Marine Research Institute, Klaipeda University, H. Manto 84, LT-92294, Klaipeda, Lithuania.
Keywords: Invasive species, early detection, Mya arenaria, species-specific primers, 16S rDNA.
1. Introduction
U
SC R
IP T
Marine organisms translocated from their native ecosystems via different humanmediated pathways and established out of their habitual ecological context can become nuisance and ultimately cause adverse effects to the environment and human well-being (Crooks 2002; Katsanevakis et al. 2014a). Such organisms, referred to as alien or NonIndigenous Species (NIS), are those with known negative effect on ecosystem functioning, spreading in adjacent regions and/or expected to invade due to existing introduction pathways and matching environmental conditions (Ardura et al. 2015; Lehtiniemi et al. 2015). They are acknowledged as a major issue to coastal ecosystems worldwide and are high on the environmental management agenda (Molnar et al. 2008; Olenin et al. 2011).
PT
ED
M
A
N
The problem of NIS introduction and spread is addressed in a number of regional and international policy initiatives and legislative acts (e.g. ICES 2004; IMO 2004; Lodge et al. 2006; European Commission 2008; MPI 2014). Still, despite all these efforts species continue spreading and new incursions are reported from different marine ecosystems on a weekly basis (Cohen and Carlton 1998; Hewitt et al. 2004; Streftaris et al. 2005; MuñozColmenero et al., 2017). After incursion occurs, any response measures may be effective if undertaken rapidly. Early detection of the species can facilitate its containment, mitigate its further spread and in rare cases – allow complete eradication (Williams and Schroeder 2004; Piola et al. 2009; Hopkins et al. 2011; Forrest and Hopkins 2013). However, this implies that routine surveillance programs should be in place with appropriate methods implemented to detect and recognize existing and prospective NIS from complex environmental samples (Lehtiniemi et al. 2015).
A
CC E
In recent years, the advance of molecular methods and their application in marine environmental surveillance has been extensively discussed (Wood et al. 2013; Aylagas et al. 2014; Kelly et al. 2014). In particular, these methods are promising for NIS detection, as they are able to overcome the problem of non-evident morphology of dispersive stages (Bott et al. 2010; Pochon et al. 2013; Zaiko et al. 2015a) or lack of specific taxonomic expertise (Hopkins and Freckleton 2002; Costello et al. 2013). When applied to environmental samples - such as sediment, water, zooplankton bulk samples - DNA or RNA-based detection and identification methodologies can register presence of a species from scarce or even partly decayed biological material and the detection of early life history stages such as larvae as well (Armstrong and Ball 2005; Dowle et al. 2015; Pochon et al. 2015; Zaiko et al. 2015b; Briski et al. 2016). This provides the responsible authorities with timely warning of the potential pest arrival or range shift of the already established target NIS. Among molecular methods, those requiring minimal research and development effort, outlays and specific technical or scientific expertise are expected to be more easily
ED
Established NIS known to have a negative effect on ecosystem functioning and spreading in adjacent region. NIS that are expected to invade due to existing introduction pathways and matching environmental conditions.
M
A
N
U
SC R
IP T
adopted within routine monitoring programs (Aylagas et al. 2014; Ardura et al. 2016). For traditional taxonomic tools and monitoring programs sampling is still necessary and requires significant effort in terms of human resources as well as needing a number of specialists systematically sampling all ecosystems, because of the necessity for all physical specimens to be barcoded. This burden is even greater in aquatic habitats which are very difficult to access, sometimes they can be only be accessed from the sea and/or by diving. Metabarcoding appears as an alternative method which reduces the sampling effort (Zaiko et al. 2015a; Ficetola et al. 2008; Yamamoto et al. 2017); it is a rapid method combining DNA based identification and high-throughput DNA sequencing. In this case, genetic data sets obtained are many times quicker to produce, and less reliant on taxonomic expertise; however, a deep bioinformatics data analysis knowledge is necessary (Ficetola et al. 2008; Jerde et al. 2011; Zaiko et al. 2015b). Finally, the use of species-specific markers is a very valuable approach when the target species is known (for example, species coming from adjacent aquatic regions) because it is reproducible, fast, and cost-effective (Leung et al. 2002). This methodology allows the detection of the presence of one target species’ DNA from water samples using PCR; visualized directly in an agarose gel (Ardura et al. 2015a; Ardura et al. 2016; Devloo-Delva et al. 2016; Clusa et al. 2016; Clusa et al. 2017). In this case, only basic technical skills in PCR and gel electrophoresis are needed. Therefore, emphasis is being put on designing speciesspecific detection assays for the target NIS and take into consideration two important points of view:
A
CC E
PT
In the Mediterranean region, the world’s hotspot of biological invasions (Katsanevakis et al. 2014b; Marchini et al. 2015), the distributional data for many important NIS is lacking or absent due to deficiency of the existing monitoring programs. For example, the current status of the population of the soft shell clam Mya arenaria remains largely undetermined despite the fact that the species is listed among 100 Mediterranean Worst Invasives (Crocetta and Turolla 2011). In the Mediterranean region, M. arenaria proliferates locally, and where abundant, outcompetes native bivalves and affects benthic habitats (Zenetos et al. 2005; Streftaris and Zenetos 2006). There is also evidence of its further spread within the region (Çinar et al. 2011; Crocetta and Turolla 2011), thus it can be attributed to invasive NIS and assigned high priority in the targeted monitoring programs (Lehtiniemi et al. 2015). Here we present the newly developed PCR-based assay for M. arenaria detection to seawater samples. We have designed and validated species-specific marker enabling easy and cost-effective reporting of species presence and allowing advanced alerts of its further spread within the Mediterranean region and adjacent regions. This method avoids the traditional manual sampling methods, allows for rapid detection with molecular techniques through environmental DNA (eDNA) and it can be easily adopted by the
existing monitoring and citizen science programs (Dopico et al. 2014; Borrell et al. 2016). It is highly reproducible, fast, cheap and technically easy method, without the need of expensive equipment and extensive technical skill.
2. Material and methods 2.1. Mollusk samples, DNA extraction and sequencing
IP T
Five M. arenaria adult specimens were collected from the southeast Baltic Sea (Figure 1). They were identified de visu by experts and served for reference sequencing and further experimental work. Total DNA was extracted employing a method based on silica gel columns (QIAmp DNA Mini kit, Qiagen) following the manufacturer´s instructions. DNA was quantified with Qubit® fluorimeter platform (by Life Technologies).
SC R
In order to verify the specificity of the designed marker, five other bivalve mollusk species with planktonic larval phase and coexisting with M. arenaria, were sampled: (i) from the Baltic Sea: natives Cerastoderma glaucum and Mytilus trossulus;
U
(ii) from the Gulf of Lyon, Mediterranean Sea: natives Mytilus galloprovincialis and invasive Xenostrobus securis and Arcuatula senhousia.
A
N
Five voucher adults from each species were sampled and DNA of these species was extracted in the same way as described above. DNA was quantified with Qubit® fluorimeter platform (by Life Technologies).
ED
M
The 16S rRNA gene was amplified for each of the mollusk samples analyzed. The 16S rRNA was amplified using the primers 16Sar and 16Sbr described by Palumbi (1996) in a total volume of 20 µl, with Promega (Madison, WI), Buffer 1x, 1.5 mM MgCl2, 0.25 mM dNTPs, 20pmol of each primer, approximately 20ng of template DNA and 1U of DNA Taq polymerase (Promega). The following PCR conditions were applied: initial denaturing at 95ºC for 5 min; 40 cycles of denaturing at 94ºC for 1 min; annealing at 55ºC for 1 min; extension at 72ºC for 2 minutes; and, a final extension at 72ºC for 7 minutes.
PT
PCR products were visualized under UV light on a 2% agarose gel stained with SimplySafe™ from EURx and using Promega 100 bp DNA Ladder Molecular Weight Marker for the band size determination.
A
CC E
Sequencing of amplification products was performed by the Macrogen Europe, Amsterdam, Netherlands, using standard Sanger sequencing method (Sanger et al., 1977). The obtained sequences were edited with BioEdit software (Hall 1999) and aligned against reference databases employing the program BLASTn within the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih. gov/) in order to confirm species identity. 2.2. Development of the Mya arenaria-specific primers.
To design the new primers, 16S rRNA sequences were aligned using the ClustalW tool (Thompson et al. 1994) included in the BioEdit Sequence Alignment Editor software (Hall 1999). This region has been used to develop species-specific primers in other species and has yielded promising results, because in most cases the data available on
databases is high and the intra-specific variation is lower in this gene (Ardura et al. 2015; 2016). Regions of about 20 nucleotides long were searched within the alignment being invariant within species but different among the species considered. The specificity of the new marker was first validated in silico. The primers’ sequences were aligned against the GenBank database employing BLAST tool in order to search for highly similar sequences (MEGABLAST) with parameters adjusted for short input sequences.
U
2.3. Marker validation on environmental samples
SC R
IP T
Further, the sensitivity and specificity of the designed marker was experimentally assayed in vitro. For sensitivity test, successive dilutions of M. arenaria adult tissue DNA in distilled water (1, 1:5, 1:10, 1:100, 1: 1,000, 1: 10,000) were used as a template for PCRs. For specificity assay, DNA samples of the five mollusk species that co-occur with M. arenaria in coastal waters were used as templates. The PCR conditions were applied as described above for 16S rRNA amplified with Palumbi primers (Palumbi 1996) at 55ºC as annealing temperature.
M
A
N
In order to validate the designed marker on complex and natural environmental samples, water samples from the southeast Baltic Sea, with established M. arenaria population (Zaiko et al. 2007) were analyzed. Environmental samples were collected in triplicates from three locations within the Lithuanian coastal zone (Figure 1). Taking into account, that in north European waters M. arenaria spawns during the early summer months, at temperatures of 10-15° C (Möller and Rosenberg 1983; Günther 1992), the sampling dates were selected as presumably favorable for the larvae occurrence (June 10, water temperature 14° C).
PT
ED
The samples were collected by plankton net (55 µm mesh size), 10 m vertical tow from the upper water layer, filtered on-board through the 0.2 µm NucleporeTM membrane filters, and preserved with ethanol (96%, molecular grade) for the future bulk DNA extraction. Between sample tows, the plankton net was washed with a 2% bleach solution and rinsed with sea water.
CC E
Bulk DNA (eDNA in any case) was extracted from the filters using the PowerWater DNA Isolation kit (MoBio Laboratories Inc., Carlsbad, CA) following manufacturer's recommendations. Extracted DNA was quantified with Qubit® fluorimeter platform (by Life Technologies). Nine eDNA samples were used as PCR templates for testing the designed assay.
A
The COI gene fragment, used as a positive control in eDNA samples, was amplified using the primers designed by Geller et al. (2013) in a total volume of 20μL and with a PCR mix containing components and proportions as those described above. The PCR conditions were: initial denaturing at 95°C for 5 min; 35 cycles of denaturing at 95°C for 1 min; annealing at 48°C for 1 min; extension at 72°C for 1 min; and, final extension at 72°C for 5 min.
3. Results
3.1. Species-specific primers The 16S rRNA gene sequences (470 bp) obtained from amplifications with Palumbi (1996) primers were submitted to GenBank and are available with the accession numbers, KP052749, KP052743, KP052750, KY272990, KY272988, KY272989, corresponding to Mya arenaria, Cerastoderma glaucum, Mytilus trossulus, Mytilus galloprovincialis, Arcuatula senhousia and Xenostrobus securis.
IP T
The design of species-specific primers was based on a region within the 16S rRNA gene conserved in M. arenaria but variable in the other bivalve species considered (Supplementary data 1).
MA-16Sar: 5´- TTGGGGGACGGAATGAATGG -3´ MA-16Sbr: 5´- CGATTAGTCCTCTAAAAGAAGA -3´
SC R
The sequences of the newly designed primers are:
N
U
The pair of new species-specific primers flanks a region of 279 base pairs.
A
3.2. Marker validation: specificity and sensitivity tests
ED
M
The in silico validation evidenced that forward primer only matched (100% of query coverage and 100% of identity) with M. arenaria and the reverse one matched (100% of query coverage and 100% of identity) with M. arenaria and another reference sequence assigned to Barnea davidi, a Pholadidae species present in East China Sea (Monari 2009). This species does not co-occur with M. arenaria within the current distribution range of the latter; therefore, we assume that there is no risk of confounding species detection due to cross-amplification of the new marker. The forward primer is specific exclusively for M. arenaria suggesting that non-specific amplification is complicated to impossible.
CC E
PT
In vitro assays confirmed the specificity of the primers. Mya-specific primers yielded positive PCR amplifications with one single apparent band of expected length (approx. 280 bp) only when M. arenaria was present in a sample, and never from DNA of other considered mollusks (Figure 2).
A
The sensitivity assay performed on serially diluted DNA of M. arenaria adult tissue (stock concentration - 10.3 ng/µl), resulted in successful PCR amplifications with clearly visible bands of the expected amplicon size at 1: 10,000 (Figure 3). Hence DNA detection limit could be set at a concentration of 0.00103 ng/µl. 3.3. Validation of molecular markers in environmental samples
DNA extractions from the nine environmental samples had different DNA concentration as indicated by Qubit® quantification results (Table 1). However, PCR amplifications with the universal COI primers (Geller et al. 2013) used as positive control, were successful and yielded bands of expected size in all samples analyzed (Table 1, Figure 4). PCR amplification products obtained with the newly designed specific primers for M. arenaria on eDNA samples were visualized in agarose gel in most of the analyzed
samples (Table 1, Figure 5), indicating presence of the species DNA at all three sampled locations. The performed sequencing of these PCR products verified that they were indeed M. arenaria sequences, belonging to two different haplotypes (Supplementary data 2).
Discussion and Conclusion
N
U
SC R
IP T
Species-specific molecular markers for marine NIS detection from environmental samples have a wide applicability in biosecurity programs (Jerde et al. 2011; Thomsen et al. 2012). The PCR-based approach provides a reasonably cheap cost per sample. Even being cheap, it is a robust tool for alerting users to the presence of a target organism even when propagules are very small and/or scarce in the environment (Ardura et al. 2015; Dougherty et al. 2016). Extreme sensitivity of this method allowing signal detection from non-living material (such as free-floating DNA) is considered as a drawback in biodiversity studies, but can be valuable for the early detection purposes (Darling and Mahon 2011; Jerde et al. 2011; Barnes and Turner 2016). Particularly for benthic species with restricted dispersive stage, presence of biological material containing DNA from detritus or shed cells can provide information on plausible species arrival, presence or spread (Ardura et al. 2015; Ardura et al. 2016; Clusa et al. 2016; Devloo-Delva et al. 2016).
PT
ED
M
A
Among benthic invertebrate species, bivalve mollusks are often very successful invaders (Molnar et al. 2008). Due to their biological traits (e.g. extended broadcast spawning, planktonic larvae, non-selective feeding) they can rapidly proliferate in an incursion area and exhibit successful secondary spread within and beyond the invaded region (Carlton et al. 1990; Ricciardi 1998; Corsi et al. 2007; Alonso and Castro-Diez 2008; Molnar et al. 2008; Strayer 2010; Benson 2013). Moreover, during the expansion phase, bivalves can noticeably affect local ecosystem through habitat modification (reef-building, biodeposition, production of shell deposits), filter-feeding, creating pools of standing biomass, redirecting energy and material flow within the food web (Naylor et al. 2000; Gutierrez et al. 2003; Crocetta and Turolla 2011; Lercari and Bergamino 2011).
A
CC E
However, in many cases the invasion of these species is detected not early enough after incursion, so the population is already widespread and impossible to eradicate or manage. The early detection of non-indigenous and particularly potentially invasive species is a prerequisite for the efficient and timely response – further spread prevention, eradication (if possible) and mitigation of threats to ecosystems and economy (Olenin et al. 2011; Pochon et al. 2015). New coming species are not established yet and they can be difficult to detect using traditional monitoring methodologies due to their low density and different development stages. The species-specific markers applied to eDNA samples allows for detection of the species before it is encountered in traditional surveillance, which is reliant on morphological identification (Ardura et al. 2016). Mya arenaria has become such a typical biodiversity component in the Baltic Sea during the last few centuries that the last stage of the Baltic development has been called the Mya Sea (Hessland 1946). In the Baltic Sea, salinity gradually decreases in a northward direction and this gradient served as a natural experiment to determine the lower salinity tolerance of M. arenaria (Beres and Pierce 1981). Unlike the Baltic with salinity of 10º/ºº, in the Mediterranean Sea (38º/ºº), the soft shell clam proliferates locally and is currently
spreading within the region (Streftaris and Zenetos 2006; Crocetta and Turolla 2011); it affects the native bivalve communities and benthic habitats by altering the granulometric structure of soft bottom deposits in shallow waters (Leppäkoski 1991). Its shells form a secondary hard substrate that attracts mobile benthic fauna thus redistributing the local communities (Zenetos et al. 2005; Streftaris and Zenetos 2006). The first reliable Mediterranean record of living specimens seems to be along the French shores in the ’90s (Stora et al. 1995), and the species remains invasive mainly in the Gulf of Lion (Stora et al. 1995; Pelorce 1995; Porcheddu et al. 1999; Zenetos et al. 2004). The presence of the population in Greek waters is suspected, as only a single dead specimen was found in 1984 in Saronikos Gulf (Zenetos et al. 2005; Zenetos et al. 2009).
U
SC R
IP T
Due to lack of information about its distribution the new marker seems very timely, since it could be applied for defining the abundance and distribution range of this species. However, eDNA methodology has some limitations (e.g. Bohmann et al. 2014). For example, false negatives can happen if the PCR protocol (and/or the primers designed) fails to anneal on different haplotypes in case of intraspecific polymorphism. In our study we did not find positive PCR amplification from some replica from each sampling point (1.1, 1.3 and 2.3) (Figure 5). These results show the importance of having some replicas from the same sampling point. Another possible solution, after marker validation, is the use of quantitative PCR (qPCR) which has been shown to be highly sensitive, particularly when determining the presence of rare or low-density species (Laramie et al. 2015), although this technique is more expensive and extra technique skills are necessary.
PT
ED
M
A
N
The suggested tool provides an additional advantage of easy uptake by amateur naturalists or citizen science programs. These types of program have already been developed with good results, such as the case of the Xenostrobus securis population control using citizen science and eDNA (Miralles et al. 2016). Public involvement in NIS detection and monitoring is acknowledged as an advantageous contribution to the implementation of bioinvasion management strategies, allowing overall upscaling of the monitoring effort (Kobori et al. 2016; Miralles et al. 2016). It is important to clarify that, although in this study we have used plankton nets due to the tools available during the cruise, the technique is useful for easy and in-field monitoring for amateur and citizen programs. Currently, they have to collect few litters of water as a very easy sampling effort and deliver this to the reference lab. However, the use of portable PCR machine or LAMP amplification technique could be developed for this type of studies (Notomi et al. 2000; Tomita et al. 2008) and used directly in the field by citizen science programs.
A
CC E
The marker created here is specific and sensitive enough, detecting DNA signal from the water samples. We believe that it can be a handy tool for getting more insight into the current distribution of the species and advise managers on its current invasive status and possible further spread. More studies are needed to use the specific marker for getting more details on the species distribution in the Mediterranean Sea or any other area. The first one must be an assessment of the efficiency of designed marker on eDNA sampling from Mediterranean Sea or any new analyzed area. In conclusion, although more analysis are necessary, we recommend the application of species-specific markers for screening environmental samples as complimentary routine monitoring tool with a following ground truth surveillance of the inferred distribution areas.
References
Alonso, A. & Castro-Diez, P. (2008). What explains the invading success of the aquatic mud snail Potamopyrgus antipodarum (Hydrobiidae, Mollusca)? Hydrobiologia, 614, 107–116.
IP T
Ardura, A., Zaiko, A., Martinez, J.L., Samuiloviene, A., Semenova, A., & GarciaVazquez, E. (2015). eDNA and specific primers for early detection of invasive species A case study on the bivalve Rangia cuneata, currently spreading in Europe. Marine Environmental Research, 112, 48-55.
SC R
Ardura, A., Zaiko, A., Borrell, Y.J., Samuiloviene, A., & Garcia-Vazquez, E. (2016). Novel tool for early detection of a global aquatic invasive, the zebra mussel Dreissena polymorpha. Aquatic Conservation: Marine and Freshwater Ecosystems, 27(1), 165-176.
Armstrong, K. & Ball, S. (2005). DNA barcodes for biosecurity: invasive species identification. Philosophical Transactions of the Royal Society B: Biological Sciences, 360 (1462), 1813-1823. http://dx.doi.org/10.1098/rstb.2005.1713
N
U
Aylagas, E., Borja, A., & Rodrigues-Ezpeleta, N. (2014). Environmental status assessment using DNA metabarcoding: towards a genetic based marine biotic index (gAMBI). PLoS One, 9, e90529.
A
Barnes, M.A., & Turner, C.R. (2016). Conservation Genetics, 17, 1, doi:10.1007/s10592015-0775-4.
M
Benson, A.J. (2013). Chronological history of Zebra and Quagga Mussels (Dreissenidae) in North America, 1988–2010. In: T. Nalepa, & D. Schlosser (Eds.), Quagga and zebra mussels: biology, impacts and control. (pp. 9–32). CRC Press, Boca Raton, FL.
ED
Beres, L.S., & Pierce, S.K. (1981). The effects of salinity stress on the electrophysiological properties of Mya arenaria neurons. Journal of Comparative Physiology, 144, 165-173.
PT
Bohmann, K., Evans, A., Gilbert, M.T.P., Carvalho, G.R., Creer, S., Knapp, M., Yu, D.W., de Bruyn, M., 2014. Environmental DNA for wildlife biology and biodiversity monitoring. Trends in Ecology and Evolution, 29, 358e367.
CC E
Borrell, Y.J., Muñoz-Colmenero, M., Dopico, E., Miralles, L. & Garcia-Vazquez, E. (2016). Food Control and a Citizen Science approach for improving teaching of Genetics in Universities. Biochemistry and Molecular Biology Education, 44(5), 450-462.
A
Bott, N.J., Ophel-Keller, K.M., Sierp, M.T., Herdina, Rowling, K.P., McKay, A.C., Loo, M.G.K., Tanner, J.E. & Deveney, M.R. (2010). Toward routine, DNA-based detection methods for marine pests. Biotechnology Advances, 28, 706-714. Briski, E., Ghabooli, S., Bailey, S.A., & MacIsaac, H.J. (2016). Are genetic databases sufficiently populated to detect non-indigenous species? Biological Invasions, 18(7), 1911-1922. Carlton, J.T., Thompson, J.K., Schemel, L.E. & Nichols, F.H. (1990). Remarkable invasion of San Francisco Bay (California, USA) by the Asian clam Potamocorbula amurensis. Introduction and dispersal. Marine Ecology Progress Series, 66, 81–94.
Çinar, M.E., Bilecenoglu, M., Öztürk, B., Katagan, T., Yokes, M.B., Aysel, V., Dagli, E., Açik, S., Özcan, T., & Erdogan, H. (2011). An update review of alien species on the coasts of Turkey. Mediterranean Science, 12(2), 257-315. Clusa, L., Ardura, A., Gower, F., Miralles, L., Tsatsianidou, V., Zaiko, A., & GarciaVazquez, E. (2016). An Easy Phylogenetically Informative Method to Trace the Globally Invasive Potamopyrgus Mud Snail from River’s eDNA. PLoSO One, doi: 10.1371/journal.pone.0162899.
IP T
Clusa, L., Ardura, A., Fernandez, S., Roca, A., & Garcia-Vazquez, E. (2017). An extremely sensitive nested PCR-RFLP mitochondrial marker for detection and identification of salmonids in eDNA from water samples. PeerJ, DOI 10.7717/peerj.3045. Cohen, A.N., & Carlton, J.T. (1998). Accelerating invasión rate in a highly invaded estuary. Science, 279(5350), 555-558.
SC R
Corsi, I., Pastore, A. M., Lodde, A., Palmerini, E., Castagnolo, L., & Focardi, S. (2007). Potential role of cholinesterases in the invasive capacity of the freshwater bivalve, Anodonta woodiana (Bivalvia: Unionacea): A comparative study with the indigenous species of the genus, Anodonta sp. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 145(3), 413-419.
N
U
Costello M.J., May, R.M., & Stork, N.E. (2013). Can we name Earth’s species before they go extinct? Science, 339(6118), 413-416.
M
A
Crocetta, F., & Turolla, E. (2011). Mya arenaria Linné, 1758 (Mollusca: Bivalvia) in the Mediteranean Sea: its distribution revisited. Journal of Biology Research-Thessaloniki, 16, 188-193. Crooks, J. A. (2002). Characterizing ecosystem-level consequences of biological invasions: the role of ecosystem engineers. Oikos, 97, 153-166.
ED
Darling, J.A., & Mahon, A.R. (2011). From molecules to management: Adopting DNAbased methods for monitoring biological invasions in aquatic environments. Environmental Research, 111, 978–988.
CC E
PT
Devloo-Delva, F., Miralles, L., Ardura, A., Borrell, Y. J., Pejovic, I., Tsartsianidou, V., & Garcia-Vazquez, E. (2016). Detection and characterisation of the biopollutant Xenostrobus securis (Lamarck, 1819) Asturian population from DNA Barcoding and eBarcoding. Marine pollution bulletin, 105(1), 23-29. Dopico, E., Linde A.R., & Garcia-Vazquez, E. (2014). Learning gains in lab practices: Teach science doing science. Journal of Biological Education 48, 46-52.
A
Dougherty, M.M., Lrson, E.R., Renshaw, M.A., Gantz, C.A., Egan,S.P., Erickson, D.M., & Lodge, D.M. (2016). Environmental DNA (eDNA) detects the invasive rustycrayfish Orconectes rusticus at low abundances. Journal of Applied Ecology, doi: 10.1111/13652664.12621. Dowle, E., Pochon, X., Keeley, N., & Wood, S.A. (2015). Assessing the effects of salmon farming seabed enrichment using bacterial community diversity and high-throughput sequencing. FEMS Microbiology Ecology, 91, fiv089. European Commission. (2008). Directive 2008/56/EC of the European Parliament and of the Council of 17 June 2008 establishing a framework for community action in the field
of marine environmental policy (Marine Strategy Framework Directive). Official Journal of the European Union, L164, 19–40. Ficetola, G.F., Miaud, C., Pompanon, F., & Taberlet, P. (2008). Species detection using environmental DNA from wáter samples. Biology Letters, 4, 423e425. Forrest B.M., & Hopkins G.A. (2013) Population control to mitigate the spread of marine pests: insights from management of the Asian kelp Undaria pinnatifida and colonial ascidian Didemnum vexillum. Management of Biological Invasions, 4(4), 317-326.
IP T
Geller, J., Meyer, C., Parker, M., & Hawk, H. (2013). Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all taxa biotic surveys. Molecular Ecology Resources, 13, 851–861.
SC R
Günther, C.P. (1992). Settlement and recruitment of Mya arenaria L. in the Wadden Sea. Journal of Experimental Marine Biology and Ecology, 159, 203-215.
Gutierrez, J.L., Jones, C.G., Strayer, D.L., & Iribarne, O.O. (2003). Mollusks as ecosystem engineers: the role of shell production in aquatic habitats. Oikos, 101(1), 7990.
U
Hall A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95-98.
N
Hessland, I. (1946). On the quaternary Mya period in Europe. Arkiv för zoology, 37A, 151.
M
A
Hewitt, C.L., Campbell, M.L., Thresher, R.E., Martin, R.B., Boyd, S., Cohen, B.F., Currie, D.R., Gomon, M.F., Keough, M.J., Lewis, J.A., Lockett, M.M., Mays, N., McArthur, M.A., O’Hara, T.O., Poore, G.C.B., Ross, D.J., Storey, M.J., Watson, J.E., & Wilson, R.S. (2004). Introduced and cryptogenic species in Port Phillip Bay, Victoria, Australia. Marine Biology, 144, 183-202.
ED
Hopkins, G.W., & Freckleton, R.P. (2002). Declines in the numbers of amateur and professional taxonomists: implications for conservation. Animal Conservation, 5, 245249.
CC E
PT
Hopkins, G.A., Forrest, B.M., Jiang, W., & Gardner, J.P.A. (2011). Successful eradication of a non-indigenous marine bivalve from a subtidal soft sediment environment. Journal of Applied Ecology, 48, 424-431. ICES. ICES Code of Practice on the Introductions and Transfers of Marine Organisms (2004). http://www.ices.dk/reports/general/2004/icescop2004.pdf IMO. International Maritime Organization. International Convention for the Control and Management of Ships ‘Ballast Water and Sediments. (2004). http://www.imo.org
A
Jerde, C.L., Mahon, A.R., Chadderton, W.L., & Lodge, D.M. (2011). “Sight-unseen” detection of rare aquatic species using environmental DNA. Conservation Letters, 4, 150157. Katsanevakis, S., Wallentinus, I., Zenetos, A., Leppäkoski, E., Cinar, M.E., Ozturk, B., Grabowski, M., Golani, D., Cardoso, A.C. (2014a). Impacts of invasive alien marine species on ecosystem services and biodiversity: a Pan-European review. Aquatic Invasions, 9, 391-423.
Katsanevakis, S., Coll, M., Piroddi, C., Steenbeek, J., Lasram, F.B.R., Zenetos, A., & Cardoso, A.C. (2014b). Invading the Mediterranean Sea: biodiversity atterns shaped by human activities. Frontiers in Marine Science, doi: 10.3389/fmars.2014.00032. Kelly, R.P., Port, J.A., Yamahara, K.M., Martone, R.G., Lowell, N., Thomsen, P.F., Mach, M.E., Bennet, M., Prahler, E., Caldwell, M.R., & Crowder, L.B. (2014). Harnessing DNA to improve environmental management. Science, 344, 1455-1456.
IP T
Kobori, H., Dickinson, J.L., Washitani, I., Sakurai, R., Amano, T., Komatsu, N., Kitamura, W., Takagawa, S., Koyama, K., Ogawara, T., & Miller-Rushing, A.J. (2016). Citizen science: a new approach to advance ecology, education and conservation. Ecological Research, 31(1), 1-19.
SC R
Laramie, M.B., Pilliod, D.S., & Goldberg, C.S. (2015). Characterizing the distribution of an endangered salmonid using environmental DNA analysis. Biological Conservation, 183, 29-37. doi: 10.1016/j.biocon.2014.11.025. Lehtiniemi, M., H. Ojaveer, M. David, B. Galil, S. Gollasch, C. McKenzie, D. Minchin, A. Occhipinti-Ambrogi, S. Olenin, & J. Pederson. (2015). Dose of truth - Monitoring marine non-indigenous species to serve legislative requirements. Marine Policy, 54, 2635.
N
U
Leppäkoski, E.J. (1991). Introduced species – Resource or threat in brackish-water seas? Examples from the Baltic and the Black Sea. Marine Pollution Bulletin, 23, 219- 223.
M
A
Lercari, D., & Bergamino, L. (2011). Impacts of two invasive mollusks, Rapana venosa (Gastropoda) and Corbicula fluminea (Bivalvia), on the food web structure of the Río de la Plata estuary and nearshore oceanic ecosystem. Biological Invasions, 13(9), 20532061.
ED
Lodge, D.M., Williams, S., MacIsaac, H.J., Hayes, K.R., Leung, B., Reichard, S., Mack R.N., Moyle, P.B., Smith, M., Andow, D.A. Carlton, J.T., & McMichael, A. (2006). Biological invasions: recommendations for U.S. policy and management. Ecological Applications, 16(6), 2035-2054.
PT
Marchini, A., Ferrario, J., Sfriso, A., & Occhipinti-Ambrogi, A. (2015). Current status and trends of biological invasions in the Lagoon of Venice, a hotspot of marine NIS introductions in the Mediterranean Sea. Biological Invasions, 17, 2943-2962.
CC E
Miralles, L., Dopico, E., Devloo-Delva, F., & Garcia-Vazquez, E. (2016). Controlling populations of invasive pygmy mussel (Xenostrobus securis) trough citizen science and environmental DNA. Marine Pollution Bulletin, 110(1), 127-32. Möller, P., & Røsenberg, R. (1983). Recruitment, abundance and production of Mya arenaria and Cardium edule in marine shallow waters, western Sweden. Ophelia, 22, 3355.
A
Molnar, J.L., Gamboa, R.L., Revenga, C., & Spalding, M.D. (2008). Assessing the global threat of invasive species to marine biodiversity. Frontiers in Ecology and the Environment, 6(9), 485-492. Monari, S. (2009). Phylogeny and biogeography of pholadid bivalve Barnea (Anchomasa) with considerations on the phylogeny of Pholadoidea. Acta Palaeontologica Polonica, 54, 315–335. MPI. Craft Risk Management Standard: Biofouling on vessels arriving to New Zealand. (2014). http://www.biosecurity.govt.nz/files/regs/ships/crms-biofouling-standard.pdf
Muñoz-Colmenero, M., Ardura, A., Clusa, L., Miralles, L., Gower, F., Zaiko, A., & Garcia-Vazquez, E. (2017). New specific molecular marker detects Ficopomatus enigmaticus from water eDNA before positive results of conventional sampling. Journal for Nature Conservation, https://doi.org/10.1016/j.jnc.2017.12.004 JNC. Naylor, R.L., Goldburg, R.J., Primavera, J.H., Kautsky,N., Beveridge, M.C., Clay, J., Folke, C., Lubchenco, J., Mooney, H., & Troell, M. (2000). Effect of aquaculture on world fish supplies. Nature, 405(6790), 1017-1024.
IP T
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., & Hase, T. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), e63.
SC R
Olenin, S., Elliott, M., Bysveen, I., Culverhouse, P.F., Daunys, D., Dubelaar, G.B.J., Gollasch, S., Goulletquer, P., Jelmert, Kantor, Y., Bringsvor-Mezeth, K., Minchin, D., Occhipinti-Ambrogi, A., Olenina, I., & Vandekerkhove, J. (2011). Recommendations on methods for the detection and control of biological pollution in marine coastal waters. Marine Pollution Bulletin, 62, 2598-2604.
U
Palumbi, S.R. (1996). Nucleic acids II: The polymerase chain reaction. In: D.M. Hillis, C. Moritz, & B.K. Mable (Eds), Molecular systematic. (pp. 205-247). Sinauer Associates.
N
Pelorce, J. (1995). Un débarquement pacifique sur les côtes du golfe du Lion. Xenophora, 71, 5.
M
A
Piola, R.F., Denny, C.M., Forrest, B.M., & Taylor M.D. (2009). Marine biosecurity: management options and response tools. In: P.A. Williams, & M.N. Clout (Eds), Invasive species management: a handbook of principles and techniques. (pp. 205-231). United Kingdom, Oxford University Press.
ED
Pochon, X., Bott, N.J., Smith, K.F., & Wood, S.A. (2013). Evaluating detection limits of Next-Generation Sequencing for the surveillance and monitoring of international marine pests. PLoS One, 8, e73935.
PT
Pochon, X., Zaiko, A., Hopkins, G.A., Banks, J.C., Wood, S.A. (2015). Early detection of eukaryotic communities from marine biofilm using high-throughput sequencing: an assessment of different sampling devices. Biofouling, 31, 241-251.
CC E
Porcheddu A.S., Francour P., Soltan D. (1999). Considerazioni sul ritrovamento di una populazione di Mya arenaria L., 1758 negli stagni di Berri e di Vaïne (France meridionale). Bolletino malacologico, 34(9-12), 167-171. Ricciardi, A. (1998). Global range expansion of the Asian Mussel Limnoperna fortunei (Mytilidae): another fouling threat to freshwater systems. Biofouling, 13, 97–106.
A
Sanger, F., Nicklen, S., Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, 74(12), 5463-5467. Stora, G., Arnoux, A., Galas, M. (1995). Time and spatial dynamics of Mediterranean lagoon macrobenthos during an exceptionally prolonged interruption of freshwater inputs. Hydrobiologia, 300/301, 123-132. Strayer, D.L. (2010). Alien species in fresh waters: ecological effects, interactions with other stressors, and prospects for the future. Freshwater Biology, 55, 152–174.
Streftaris, N., & Zenetos, A. (2006). Alien marine species in the Mediterranean – the 100 ‘Worst Invasives’ and their impact. Mediterranean Marine Science, 7(1), 87-118. Streftaris, N., Zenetos, A., & Papathanassiaou, E. (2005). Globalisation in marine ecosystems: the story of non-indigenous marine species across European seas. Oceanography and Marine Biology: an annual review, 43, 419-453. Thompson, J.D., Higgins, D.G., Gibson, T.J. (1994). ClustalW-improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673-4680.
IP T
Thomsen, P.F., Kielgast, J., Iversen, L.I., Wiuf, C., Rasmussen, F., Gilbert, M.T.P., Orlando, L., & Willerslev, E. (2012). Monitoring endangered freshwater biodiversity using environmental DNA. Molecular Ecology, 21, 2565–2573.
SC R
Tomita, N., Mori, Y., Kanda, H., & Notomi, T. (2008). Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols, 3, 877-882. doi:10.1038/nprot.2008.57. Williams, S.L. & Schroeder, S.L. (2004) Eradication of the invasive seaweed Caulerpa taxifolia by chlorine bleach. Marine Ecology Progress Series, 272, 69-76.
N
U
Wood, S.A., Smith, K.F., Banks, J.C., Tremblay, L.A., Rhodes, L., Mountfort, D., Cary, S.C., & Pochon, X. (2013). Molecular genetic tools for environmental monitoring of New Zealand's aquatic habitats, past, present and the future. New Zealand Journal of Marine and Freshwater Research, 47, 90-119.
M
A
Yamamoto, S., Masuda, R., Sato, Y., Sado, T., Araki, H., Kondoh, M., Minamoto, T., & Miya, M. (2017). Environmental DNA metabarcoding reveals local fish communities in a species-rich coastal sea. Scientific Reports, 7, 40368. doi:10.1038/srep40368.
ED
Zaiko, A., Olenin, S., Daunys, D., & Nalepa, T.F. (2007). Vulnerability of benthic habitats to the aquatic invasive species. Biological Invasions, 9, 703-714.
PT
Zaiko, A., Samuiloviene, A., Ardura, A., & Garcia-Vazquez, E. (2015a). Metabarcoding approach for nonindigenous species surveillance in marine coastal waters. Marine Pollution Bulletin, 100, 53-59.
CC E
Zaiko, A., Martinez, J.L., Schmidt-Petersen, J., Ribicic, D., Samuiloviene, A., & GarciaVazquez, E. (2015b). Metabarcoding approach for the ballast water surveillance - an advantageous solution or an awkward challenge? Marine Pollution Bulletin, 92, 25-34. Zenetos A., Gofas S., Russo G. and Templado J. (2004). CIESM Atlas of exotic species in the Mediterranean. Monaco: CIESM Publishers. Molluscs, 3.
A
Zenetos, A., Çinar, M.E., Panucci-Papadopoulou, M.A., Harmelin, J.G., Furnari, G., Andaloro, F., Bellou, N., Streftaris, N., & Zibrowius, H. (2005). Annotated list of marine alien species in the Mediterranean with records of the worst invasive species. Mediterranean Marine Science, 6(2), 63-118. Zenetos, A., Pancucci-Papadopoulou, M., Zogaris, S., Papastergiadou, E., Vardakas, L., Aligizaki, K., & Economou, A.N. (2009). Aquatic alien species in Greece: tracking sources, patterns and effects on the ecosystem. Journal of Biological ResearchThessaloniki, 12, 135-172.
A
CC E
PT
ED
M
A
N
U
SC R
IP T
Figure 1. Locations of the sampling sites in coastal zone of the SE Baltic Sea.
N
U
SC R
IP T
Figure 2. Agarose gel of PCR products amplified with 16S rRNA Mya arenaria-specific primers from M. arenaria (MA), C. glaucum (CG), X. securis (XS), A. senhousia (AS) M. trossulus (MT) and M. galloprovincialis (MG). NC: negative control. Marker (M): DNA size marker 100 bp ladder.
A
CC E
PT
ED
M
A
Figure 3. Agarose gel of PCR products obtained with 16S rRNA M. arenaria-specific primers for serial dilutions 1 to 1:10,000 of M. arenaria in distilled water (1 to 6 correspondingly). NC: negative control. Marker (M): DNA size marker 100 bp ladder.
A
CC E
PT
ED
M
A
N
U
SC R
IP T
Figure 4. Agarose gel of PCR products obtained with universal COI primers (Geller et al., 2013) in water samples from Lithuanian coast in the Baltic Sea (BS-1.1, BS-1.2, BS1.3, BS-2.1, BS-2.2, BS-2.3, BS-3.1, BS-3.2 and BS-3.3). MA: M. arenaria sample as a positive control. Marker: Low DNA Mass Ladder. NC: negative control.
SC R
IP T
Figure 5. Agarose gel of PCR products obtained with 16S rRNA Mya arenaria-specific primers in water samples from the Lithuanian coast in the Baltic Sea (1.1, 1.2, 1.3, 2.1, 2.2, 2.3, 3.1, 3.2 and 3.3). Positive results denoted by the white arrows. MA: M. arenaria sample as positive control. Marker: Low DNA Mass Ladder. NC: Negative control.
A
CC E
PT
ED
M
A
N
U
NC
I N U SC R
A
Table 1. Marker validation in environmental water samples: eDNA concentration (ng/µl); PCR amplification with universal primers described by Geller (2013) used here as positive amplification controls and with Mya arenaria-specific primers described in this article (+: positive and -: negative)
M
Location #1
A
CC E
PT
ED
DNA quantification (ng/µL) PCR amplification with Geller primers (Geller, 2013) PCR amplification with Mya arenaria-specific primers
Location #2
Location #3
1.1 1.72
1.2 1.38
1.3 1.77
2.1 0.36
2.2 1.57
2.3 1.19
3.1 1.46
3.2 2.73
3.3 3.61
+
+
+
+
+
+
+
+
+
-
+
-
+
+
-
+
+
+
S1617-1381(17)30153-X https://doi.org/10.1016/j.jnc.2018.02.007 JNC 25623
To appear in: Received date: Revised date: Accepted date:
21-3-2017 13-2-2018 13-2-2018
Please cite this article as: Ardura A, Zaiko A, PCR-based assay for Mya arenaria detection from marine environmental samples and tracking its invasion in coastal ecosystems, Journal for Nature Conservation (2010), https://doi.org/10.1016/j.jnc.2018.02.007 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
PCR-based assay for Mya arenaria detection from marine environmental samples and tracking its invasion in coastal ecosystems
Short title:Mya arenaria-specific primers for its early detection
IP T
Alba Ardura1a and Anastasija Zaiko2,3
M
Abstract
PT
ED
The introduction of invasive species into a new environment is one of the most important factors implicated in loss of native biodiversity. Their early detection is indispensable to efficient control and management response, because after their incursion and establishment the eradication is nearly impossible. The Mediterranean Sea is one of the world´s hotspots of biological invasions and existing monitoring programs are often insufficient for effective surveillance of the established invasive populations or early detection of new incursions. The aim of the current study was to design a specific molecular marker for detecting and monitoring the soft shell clam Mya arenaria, listed among 100 Mediterranean Worst Invasive Species, from environmental samples. The 16S marker was designed in silico and validated in vitro on serial dilutions of M. arenaria DNA and other closely related mollusk species; its performance was also tested on complex environmental samples collected from locations in the Baltic Sea with known established M. arenaria population. The new marker allows amplifying small fragments of 279 bp and detecting as low as 0.00103ng/µl of M. arenaria DNA with no cross-amplification detected. We suggest the use of this and other species-specific markers for targeted surveillance of invasive species and prompt detection of the prospective incursions. Such monitoring approach has the potential to be adopted by citizen science programs due to its easy implementation, minimal technical skills requirements and reasonable amount of associated expenditures.
CC E A
N
A
a: Corresponding author: [email protected]
U
SC R
1- PSL Research University: EPHE-UPVD-CNRS, USR 3278 CRIOBE, Université de Perpignan, 52 Avenue Paul Alduy, 66860 Perpignan Cedex, France. 2- Coastal and Freshwater Group, Cawthron Institute, 98 Halifax Street East, 7010 Nelson, New Zealand. 3- Marine Research Institute, Klaipeda University, H. Manto 84, LT-92294, Klaipeda, Lithuania.
Keywords: Invasive species, early detection, Mya arenaria, species-specific primers, 16S rDNA.
1. Introduction
U
SC R
IP T
Marine organisms translocated from their native ecosystems via different humanmediated pathways and established out of their habitual ecological context can become nuisance and ultimately cause adverse effects to the environment and human well-being (Crooks 2002; Katsanevakis et al. 2014a). Such organisms, referred to as alien or NonIndigenous Species (NIS), are those with known negative effect on ecosystem functioning, spreading in adjacent regions and/or expected to invade due to existing introduction pathways and matching environmental conditions (Ardura et al. 2015; Lehtiniemi et al. 2015). They are acknowledged as a major issue to coastal ecosystems worldwide and are high on the environmental management agenda (Molnar et al. 2008; Olenin et al. 2011).
PT
ED
M
A
N
The problem of NIS introduction and spread is addressed in a number of regional and international policy initiatives and legislative acts (e.g. ICES 2004; IMO 2004; Lodge et al. 2006; European Commission 2008; MPI 2014). Still, despite all these efforts species continue spreading and new incursions are reported from different marine ecosystems on a weekly basis (Cohen and Carlton 1998; Hewitt et al. 2004; Streftaris et al. 2005; MuñozColmenero et al., 2017). After incursion occurs, any response measures may be effective if undertaken rapidly. Early detection of the species can facilitate its containment, mitigate its further spread and in rare cases – allow complete eradication (Williams and Schroeder 2004; Piola et al. 2009; Hopkins et al. 2011; Forrest and Hopkins 2013). However, this implies that routine surveillance programs should be in place with appropriate methods implemented to detect and recognize existing and prospective NIS from complex environmental samples (Lehtiniemi et al. 2015).
A
CC E
In recent years, the advance of molecular methods and their application in marine environmental surveillance has been extensively discussed (Wood et al. 2013; Aylagas et al. 2014; Kelly et al. 2014). In particular, these methods are promising for NIS detection, as they are able to overcome the problem of non-evident morphology of dispersive stages (Bott et al. 2010; Pochon et al. 2013; Zaiko et al. 2015a) or lack of specific taxonomic expertise (Hopkins and Freckleton 2002; Costello et al. 2013). When applied to environmental samples - such as sediment, water, zooplankton bulk samples - DNA or RNA-based detection and identification methodologies can register presence of a species from scarce or even partly decayed biological material and the detection of early life history stages such as larvae as well (Armstrong and Ball 2005; Dowle et al. 2015; Pochon et al. 2015; Zaiko et al. 2015b; Briski et al. 2016). This provides the responsible authorities with timely warning of the potential pest arrival or range shift of the already established target NIS. Among molecular methods, those requiring minimal research and development effort, outlays and specific technical or scientific expertise are expected to be more easily
ED
Established NIS known to have a negative effect on ecosystem functioning and spreading in adjacent region. NIS that are expected to invade due to existing introduction pathways and matching environmental conditions.
M
A
N
U
SC R
IP T
adopted within routine monitoring programs (Aylagas et al. 2014; Ardura et al. 2016). For traditional taxonomic tools and monitoring programs sampling is still necessary and requires significant effort in terms of human resources as well as needing a number of specialists systematically sampling all ecosystems, because of the necessity for all physical specimens to be barcoded. This burden is even greater in aquatic habitats which are very difficult to access, sometimes they can be only be accessed from the sea and/or by diving. Metabarcoding appears as an alternative method which reduces the sampling effort (Zaiko et al. 2015a; Ficetola et al. 2008; Yamamoto et al. 2017); it is a rapid method combining DNA based identification and high-throughput DNA sequencing. In this case, genetic data sets obtained are many times quicker to produce, and less reliant on taxonomic expertise; however, a deep bioinformatics data analysis knowledge is necessary (Ficetola et al. 2008; Jerde et al. 2011; Zaiko et al. 2015b). Finally, the use of species-specific markers is a very valuable approach when the target species is known (for example, species coming from adjacent aquatic regions) because it is reproducible, fast, and cost-effective (Leung et al. 2002). This methodology allows the detection of the presence of one target species’ DNA from water samples using PCR; visualized directly in an agarose gel (Ardura et al. 2015a; Ardura et al. 2016; Devloo-Delva et al. 2016; Clusa et al. 2016; Clusa et al. 2017). In this case, only basic technical skills in PCR and gel electrophoresis are needed. Therefore, emphasis is being put on designing speciesspecific detection assays for the target NIS and take into consideration two important points of view:
A
CC E
PT
In the Mediterranean region, the world’s hotspot of biological invasions (Katsanevakis et al. 2014b; Marchini et al. 2015), the distributional data for many important NIS is lacking or absent due to deficiency of the existing monitoring programs. For example, the current status of the population of the soft shell clam Mya arenaria remains largely undetermined despite the fact that the species is listed among 100 Mediterranean Worst Invasives (Crocetta and Turolla 2011). In the Mediterranean region, M. arenaria proliferates locally, and where abundant, outcompetes native bivalves and affects benthic habitats (Zenetos et al. 2005; Streftaris and Zenetos 2006). There is also evidence of its further spread within the region (Çinar et al. 2011; Crocetta and Turolla 2011), thus it can be attributed to invasive NIS and assigned high priority in the targeted monitoring programs (Lehtiniemi et al. 2015). Here we present the newly developed PCR-based assay for M. arenaria detection to seawater samples. We have designed and validated species-specific marker enabling easy and cost-effective reporting of species presence and allowing advanced alerts of its further spread within the Mediterranean region and adjacent regions. This method avoids the traditional manual sampling methods, allows for rapid detection with molecular techniques through environmental DNA (eDNA) and it can be easily adopted by the
existing monitoring and citizen science programs (Dopico et al. 2014; Borrell et al. 2016). It is highly reproducible, fast, cheap and technically easy method, without the need of expensive equipment and extensive technical skill.
2. Material and methods 2.1. Mollusk samples, DNA extraction and sequencing
IP T
Five M. arenaria adult specimens were collected from the southeast Baltic Sea (Figure 1). They were identified de visu by experts and served for reference sequencing and further experimental work. Total DNA was extracted employing a method based on silica gel columns (QIAmp DNA Mini kit, Qiagen) following the manufacturer´s instructions. DNA was quantified with Qubit® fluorimeter platform (by Life Technologies).
SC R
In order to verify the specificity of the designed marker, five other bivalve mollusk species with planktonic larval phase and coexisting with M. arenaria, were sampled: (i) from the Baltic Sea: natives Cerastoderma glaucum and Mytilus trossulus;
U
(ii) from the Gulf of Lyon, Mediterranean Sea: natives Mytilus galloprovincialis and invasive Xenostrobus securis and Arcuatula senhousia.
A
N
Five voucher adults from each species were sampled and DNA of these species was extracted in the same way as described above. DNA was quantified with Qubit® fluorimeter platform (by Life Technologies).
ED
M
The 16S rRNA gene was amplified for each of the mollusk samples analyzed. The 16S rRNA was amplified using the primers 16Sar and 16Sbr described by Palumbi (1996) in a total volume of 20 µl, with Promega (Madison, WI), Buffer 1x, 1.5 mM MgCl2, 0.25 mM dNTPs, 20pmol of each primer, approximately 20ng of template DNA and 1U of DNA Taq polymerase (Promega). The following PCR conditions were applied: initial denaturing at 95ºC for 5 min; 40 cycles of denaturing at 94ºC for 1 min; annealing at 55ºC for 1 min; extension at 72ºC for 2 minutes; and, a final extension at 72ºC for 7 minutes.
PT
PCR products were visualized under UV light on a 2% agarose gel stained with SimplySafe™ from EURx and using Promega 100 bp DNA Ladder Molecular Weight Marker for the band size determination.
A
CC E
Sequencing of amplification products was performed by the Macrogen Europe, Amsterdam, Netherlands, using standard Sanger sequencing method (Sanger et al., 1977). The obtained sequences were edited with BioEdit software (Hall 1999) and aligned against reference databases employing the program BLASTn within the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih. gov/) in order to confirm species identity. 2.2. Development of the Mya arenaria-specific primers.
To design the new primers, 16S rRNA sequences were aligned using the ClustalW tool (Thompson et al. 1994) included in the BioEdit Sequence Alignment Editor software (Hall 1999). This region has been used to develop species-specific primers in other species and has yielded promising results, because in most cases the data available on
databases is high and the intra-specific variation is lower in this gene (Ardura et al. 2015; 2016). Regions of about 20 nucleotides long were searched within the alignment being invariant within species but different among the species considered. The specificity of the new marker was first validated in silico. The primers’ sequences were aligned against the GenBank database employing BLAST tool in order to search for highly similar sequences (MEGABLAST) with parameters adjusted for short input sequences.
U
2.3. Marker validation on environmental samples
SC R
IP T
Further, the sensitivity and specificity of the designed marker was experimentally assayed in vitro. For sensitivity test, successive dilutions of M. arenaria adult tissue DNA in distilled water (1, 1:5, 1:10, 1:100, 1: 1,000, 1: 10,000) were used as a template for PCRs. For specificity assay, DNA samples of the five mollusk species that co-occur with M. arenaria in coastal waters were used as templates. The PCR conditions were applied as described above for 16S rRNA amplified with Palumbi primers (Palumbi 1996) at 55ºC as annealing temperature.
M
A
N
In order to validate the designed marker on complex and natural environmental samples, water samples from the southeast Baltic Sea, with established M. arenaria population (Zaiko et al. 2007) were analyzed. Environmental samples were collected in triplicates from three locations within the Lithuanian coastal zone (Figure 1). Taking into account, that in north European waters M. arenaria spawns during the early summer months, at temperatures of 10-15° C (Möller and Rosenberg 1983; Günther 1992), the sampling dates were selected as presumably favorable for the larvae occurrence (June 10, water temperature 14° C).
PT
ED
The samples were collected by plankton net (55 µm mesh size), 10 m vertical tow from the upper water layer, filtered on-board through the 0.2 µm NucleporeTM membrane filters, and preserved with ethanol (96%, molecular grade) for the future bulk DNA extraction. Between sample tows, the plankton net was washed with a 2% bleach solution and rinsed with sea water.
CC E
Bulk DNA (eDNA in any case) was extracted from the filters using the PowerWater DNA Isolation kit (MoBio Laboratories Inc., Carlsbad, CA) following manufacturer's recommendations. Extracted DNA was quantified with Qubit® fluorimeter platform (by Life Technologies). Nine eDNA samples were used as PCR templates for testing the designed assay.
A
The COI gene fragment, used as a positive control in eDNA samples, was amplified using the primers designed by Geller et al. (2013) in a total volume of 20μL and with a PCR mix containing components and proportions as those described above. The PCR conditions were: initial denaturing at 95°C for 5 min; 35 cycles of denaturing at 95°C for 1 min; annealing at 48°C for 1 min; extension at 72°C for 1 min; and, final extension at 72°C for 5 min.
3. Results
3.1. Species-specific primers The 16S rRNA gene sequences (470 bp) obtained from amplifications with Palumbi (1996) primers were submitted to GenBank and are available with the accession numbers, KP052749, KP052743, KP052750, KY272990, KY272988, KY272989, corresponding to Mya arenaria, Cerastoderma glaucum, Mytilus trossulus, Mytilus galloprovincialis, Arcuatula senhousia and Xenostrobus securis.
IP T
The design of species-specific primers was based on a region within the 16S rRNA gene conserved in M. arenaria but variable in the other bivalve species considered (Supplementary data 1).
MA-16Sar: 5´- TTGGGGGACGGAATGAATGG -3´ MA-16Sbr: 5´- CGATTAGTCCTCTAAAAGAAGA -3´
SC R
The sequences of the newly designed primers are:
N
U
The pair of new species-specific primers flanks a region of 279 base pairs.
A
3.2. Marker validation: specificity and sensitivity tests
ED
M
The in silico validation evidenced that forward primer only matched (100% of query coverage and 100% of identity) with M. arenaria and the reverse one matched (100% of query coverage and 100% of identity) with M. arenaria and another reference sequence assigned to Barnea davidi, a Pholadidae species present in East China Sea (Monari 2009). This species does not co-occur with M. arenaria within the current distribution range of the latter; therefore, we assume that there is no risk of confounding species detection due to cross-amplification of the new marker. The forward primer is specific exclusively for M. arenaria suggesting that non-specific amplification is complicated to impossible.
CC E
PT
In vitro assays confirmed the specificity of the primers. Mya-specific primers yielded positive PCR amplifications with one single apparent band of expected length (approx. 280 bp) only when M. arenaria was present in a sample, and never from DNA of other considered mollusks (Figure 2).
A
The sensitivity assay performed on serially diluted DNA of M. arenaria adult tissue (stock concentration - 10.3 ng/µl), resulted in successful PCR amplifications with clearly visible bands of the expected amplicon size at 1: 10,000 (Figure 3). Hence DNA detection limit could be set at a concentration of 0.00103 ng/µl. 3.3. Validation of molecular markers in environmental samples
DNA extractions from the nine environmental samples had different DNA concentration as indicated by Qubit® quantification results (Table 1). However, PCR amplifications with the universal COI primers (Geller et al. 2013) used as positive control, were successful and yielded bands of expected size in all samples analyzed (Table 1, Figure 4). PCR amplification products obtained with the newly designed specific primers for M. arenaria on eDNA samples were visualized in agarose gel in most of the analyzed
samples (Table 1, Figure 5), indicating presence of the species DNA at all three sampled locations. The performed sequencing of these PCR products verified that they were indeed M. arenaria sequences, belonging to two different haplotypes (Supplementary data 2).
Discussion and Conclusion
N
U
SC R
IP T
Species-specific molecular markers for marine NIS detection from environmental samples have a wide applicability in biosecurity programs (Jerde et al. 2011; Thomsen et al. 2012). The PCR-based approach provides a reasonably cheap cost per sample. Even being cheap, it is a robust tool for alerting users to the presence of a target organism even when propagules are very small and/or scarce in the environment (Ardura et al. 2015; Dougherty et al. 2016). Extreme sensitivity of this method allowing signal detection from non-living material (such as free-floating DNA) is considered as a drawback in biodiversity studies, but can be valuable for the early detection purposes (Darling and Mahon 2011; Jerde et al. 2011; Barnes and Turner 2016). Particularly for benthic species with restricted dispersive stage, presence of biological material containing DNA from detritus or shed cells can provide information on plausible species arrival, presence or spread (Ardura et al. 2015; Ardura et al. 2016; Clusa et al. 2016; Devloo-Delva et al. 2016).
PT
ED
M
A
Among benthic invertebrate species, bivalve mollusks are often very successful invaders (Molnar et al. 2008). Due to their biological traits (e.g. extended broadcast spawning, planktonic larvae, non-selective feeding) they can rapidly proliferate in an incursion area and exhibit successful secondary spread within and beyond the invaded region (Carlton et al. 1990; Ricciardi 1998; Corsi et al. 2007; Alonso and Castro-Diez 2008; Molnar et al. 2008; Strayer 2010; Benson 2013). Moreover, during the expansion phase, bivalves can noticeably affect local ecosystem through habitat modification (reef-building, biodeposition, production of shell deposits), filter-feeding, creating pools of standing biomass, redirecting energy and material flow within the food web (Naylor et al. 2000; Gutierrez et al. 2003; Crocetta and Turolla 2011; Lercari and Bergamino 2011).
A
CC E
However, in many cases the invasion of these species is detected not early enough after incursion, so the population is already widespread and impossible to eradicate or manage. The early detection of non-indigenous and particularly potentially invasive species is a prerequisite for the efficient and timely response – further spread prevention, eradication (if possible) and mitigation of threats to ecosystems and economy (Olenin et al. 2011; Pochon et al. 2015). New coming species are not established yet and they can be difficult to detect using traditional monitoring methodologies due to their low density and different development stages. The species-specific markers applied to eDNA samples allows for detection of the species before it is encountered in traditional surveillance, which is reliant on morphological identification (Ardura et al. 2016). Mya arenaria has become such a typical biodiversity component in the Baltic Sea during the last few centuries that the last stage of the Baltic development has been called the Mya Sea (Hessland 1946). In the Baltic Sea, salinity gradually decreases in a northward direction and this gradient served as a natural experiment to determine the lower salinity tolerance of M. arenaria (Beres and Pierce 1981). Unlike the Baltic with salinity of 10º/ºº, in the Mediterranean Sea (38º/ºº), the soft shell clam proliferates locally and is currently
spreading within the region (Streftaris and Zenetos 2006; Crocetta and Turolla 2011); it affects the native bivalve communities and benthic habitats by altering the granulometric structure of soft bottom deposits in shallow waters (Leppäkoski 1991). Its shells form a secondary hard substrate that attracts mobile benthic fauna thus redistributing the local communities (Zenetos et al. 2005; Streftaris and Zenetos 2006). The first reliable Mediterranean record of living specimens seems to be along the French shores in the ’90s (Stora et al. 1995), and the species remains invasive mainly in the Gulf of Lion (Stora et al. 1995; Pelorce 1995; Porcheddu et al. 1999; Zenetos et al. 2004). The presence of the population in Greek waters is suspected, as only a single dead specimen was found in 1984 in Saronikos Gulf (Zenetos et al. 2005; Zenetos et al. 2009).
U
SC R
IP T
Due to lack of information about its distribution the new marker seems very timely, since it could be applied for defining the abundance and distribution range of this species. However, eDNA methodology has some limitations (e.g. Bohmann et al. 2014). For example, false negatives can happen if the PCR protocol (and/or the primers designed) fails to anneal on different haplotypes in case of intraspecific polymorphism. In our study we did not find positive PCR amplification from some replica from each sampling point (1.1, 1.3 and 2.3) (Figure 5). These results show the importance of having some replicas from the same sampling point. Another possible solution, after marker validation, is the use of quantitative PCR (qPCR) which has been shown to be highly sensitive, particularly when determining the presence of rare or low-density species (Laramie et al. 2015), although this technique is more expensive and extra technique skills are necessary.
PT
ED
M
A
N
The suggested tool provides an additional advantage of easy uptake by amateur naturalists or citizen science programs. These types of program have already been developed with good results, such as the case of the Xenostrobus securis population control using citizen science and eDNA (Miralles et al. 2016). Public involvement in NIS detection and monitoring is acknowledged as an advantageous contribution to the implementation of bioinvasion management strategies, allowing overall upscaling of the monitoring effort (Kobori et al. 2016; Miralles et al. 2016). It is important to clarify that, although in this study we have used plankton nets due to the tools available during the cruise, the technique is useful for easy and in-field monitoring for amateur and citizen programs. Currently, they have to collect few litters of water as a very easy sampling effort and deliver this to the reference lab. However, the use of portable PCR machine or LAMP amplification technique could be developed for this type of studies (Notomi et al. 2000; Tomita et al. 2008) and used directly in the field by citizen science programs.
A
CC E
The marker created here is specific and sensitive enough, detecting DNA signal from the water samples. We believe that it can be a handy tool for getting more insight into the current distribution of the species and advise managers on its current invasive status and possible further spread. More studies are needed to use the specific marker for getting more details on the species distribution in the Mediterranean Sea or any other area. The first one must be an assessment of the efficiency of designed marker on eDNA sampling from Mediterranean Sea or any new analyzed area. In conclusion, although more analysis are necessary, we recommend the application of species-specific markers for screening environmental samples as complimentary routine monitoring tool with a following ground truth surveillance of the inferred distribution areas.
References
Alonso, A. & Castro-Diez, P. (2008). What explains the invading success of the aquatic mud snail Potamopyrgus antipodarum (Hydrobiidae, Mollusca)? Hydrobiologia, 614, 107–116.
IP T
Ardura, A., Zaiko, A., Martinez, J.L., Samuiloviene, A., Semenova, A., & GarciaVazquez, E. (2015). eDNA and specific primers for early detection of invasive species A case study on the bivalve Rangia cuneata, currently spreading in Europe. Marine Environmental Research, 112, 48-55.
SC R
Ardura, A., Zaiko, A., Borrell, Y.J., Samuiloviene, A., & Garcia-Vazquez, E. (2016). Novel tool for early detection of a global aquatic invasive, the zebra mussel Dreissena polymorpha. Aquatic Conservation: Marine and Freshwater Ecosystems, 27(1), 165-176.
Armstrong, K. & Ball, S. (2005). DNA barcodes for biosecurity: invasive species identification. Philosophical Transactions of the Royal Society B: Biological Sciences, 360 (1462), 1813-1823. http://dx.doi.org/10.1098/rstb.2005.1713
N
U
Aylagas, E., Borja, A., & Rodrigues-Ezpeleta, N. (2014). Environmental status assessment using DNA metabarcoding: towards a genetic based marine biotic index (gAMBI). PLoS One, 9, e90529.
A
Barnes, M.A., & Turner, C.R. (2016). Conservation Genetics, 17, 1, doi:10.1007/s10592015-0775-4.
M
Benson, A.J. (2013). Chronological history of Zebra and Quagga Mussels (Dreissenidae) in North America, 1988–2010. In: T. Nalepa, & D. Schlosser (Eds.), Quagga and zebra mussels: biology, impacts and control. (pp. 9–32). CRC Press, Boca Raton, FL.
ED
Beres, L.S., & Pierce, S.K. (1981). The effects of salinity stress on the electrophysiological properties of Mya arenaria neurons. Journal of Comparative Physiology, 144, 165-173.
PT
Bohmann, K., Evans, A., Gilbert, M.T.P., Carvalho, G.R., Creer, S., Knapp, M., Yu, D.W., de Bruyn, M., 2014. Environmental DNA for wildlife biology and biodiversity monitoring. Trends in Ecology and Evolution, 29, 358e367.
CC E
Borrell, Y.J., Muñoz-Colmenero, M., Dopico, E., Miralles, L. & Garcia-Vazquez, E. (2016). Food Control and a Citizen Science approach for improving teaching of Genetics in Universities. Biochemistry and Molecular Biology Education, 44(5), 450-462.
A
Bott, N.J., Ophel-Keller, K.M., Sierp, M.T., Herdina, Rowling, K.P., McKay, A.C., Loo, M.G.K., Tanner, J.E. & Deveney, M.R. (2010). Toward routine, DNA-based detection methods for marine pests. Biotechnology Advances, 28, 706-714. Briski, E., Ghabooli, S., Bailey, S.A., & MacIsaac, H.J. (2016). Are genetic databases sufficiently populated to detect non-indigenous species? Biological Invasions, 18(7), 1911-1922. Carlton, J.T., Thompson, J.K., Schemel, L.E. & Nichols, F.H. (1990). Remarkable invasion of San Francisco Bay (California, USA) by the Asian clam Potamocorbula amurensis. Introduction and dispersal. Marine Ecology Progress Series, 66, 81–94.
Çinar, M.E., Bilecenoglu, M., Öztürk, B., Katagan, T., Yokes, M.B., Aysel, V., Dagli, E., Açik, S., Özcan, T., & Erdogan, H. (2011). An update review of alien species on the coasts of Turkey. Mediterranean Science, 12(2), 257-315. Clusa, L., Ardura, A., Gower, F., Miralles, L., Tsatsianidou, V., Zaiko, A., & GarciaVazquez, E. (2016). An Easy Phylogenetically Informative Method to Trace the Globally Invasive Potamopyrgus Mud Snail from River’s eDNA. PLoSO One, doi: 10.1371/journal.pone.0162899.
IP T
Clusa, L., Ardura, A., Fernandez, S., Roca, A., & Garcia-Vazquez, E. (2017). An extremely sensitive nested PCR-RFLP mitochondrial marker for detection and identification of salmonids in eDNA from water samples. PeerJ, DOI 10.7717/peerj.3045. Cohen, A.N., & Carlton, J.T. (1998). Accelerating invasión rate in a highly invaded estuary. Science, 279(5350), 555-558.
SC R
Corsi, I., Pastore, A. M., Lodde, A., Palmerini, E., Castagnolo, L., & Focardi, S. (2007). Potential role of cholinesterases in the invasive capacity of the freshwater bivalve, Anodonta woodiana (Bivalvia: Unionacea): A comparative study with the indigenous species of the genus, Anodonta sp. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 145(3), 413-419.
N
U
Costello M.J., May, R.M., & Stork, N.E. (2013). Can we name Earth’s species before they go extinct? Science, 339(6118), 413-416.
M
A
Crocetta, F., & Turolla, E. (2011). Mya arenaria Linné, 1758 (Mollusca: Bivalvia) in the Mediteranean Sea: its distribution revisited. Journal of Biology Research-Thessaloniki, 16, 188-193. Crooks, J. A. (2002). Characterizing ecosystem-level consequences of biological invasions: the role of ecosystem engineers. Oikos, 97, 153-166.
ED
Darling, J.A., & Mahon, A.R. (2011). From molecules to management: Adopting DNAbased methods for monitoring biological invasions in aquatic environments. Environmental Research, 111, 978–988.
CC E
PT
Devloo-Delva, F., Miralles, L., Ardura, A., Borrell, Y. J., Pejovic, I., Tsartsianidou, V., & Garcia-Vazquez, E. (2016). Detection and characterisation of the biopollutant Xenostrobus securis (Lamarck, 1819) Asturian population from DNA Barcoding and eBarcoding. Marine pollution bulletin, 105(1), 23-29. Dopico, E., Linde A.R., & Garcia-Vazquez, E. (2014). Learning gains in lab practices: Teach science doing science. Journal of Biological Education 48, 46-52.
A
Dougherty, M.M., Lrson, E.R., Renshaw, M.A., Gantz, C.A., Egan,S.P., Erickson, D.M., & Lodge, D.M. (2016). Environmental DNA (eDNA) detects the invasive rustycrayfish Orconectes rusticus at low abundances. Journal of Applied Ecology, doi: 10.1111/13652664.12621. Dowle, E., Pochon, X., Keeley, N., & Wood, S.A. (2015). Assessing the effects of salmon farming seabed enrichment using bacterial community diversity and high-throughput sequencing. FEMS Microbiology Ecology, 91, fiv089. European Commission. (2008). Directive 2008/56/EC of the European Parliament and of the Council of 17 June 2008 establishing a framework for community action in the field
of marine environmental policy (Marine Strategy Framework Directive). Official Journal of the European Union, L164, 19–40. Ficetola, G.F., Miaud, C., Pompanon, F., & Taberlet, P. (2008). Species detection using environmental DNA from wáter samples. Biology Letters, 4, 423e425. Forrest B.M., & Hopkins G.A. (2013) Population control to mitigate the spread of marine pests: insights from management of the Asian kelp Undaria pinnatifida and colonial ascidian Didemnum vexillum. Management of Biological Invasions, 4(4), 317-326.
IP T
Geller, J., Meyer, C., Parker, M., & Hawk, H. (2013). Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all taxa biotic surveys. Molecular Ecology Resources, 13, 851–861.
SC R
Günther, C.P. (1992). Settlement and recruitment of Mya arenaria L. in the Wadden Sea. Journal of Experimental Marine Biology and Ecology, 159, 203-215.
Gutierrez, J.L., Jones, C.G., Strayer, D.L., & Iribarne, O.O. (2003). Mollusks as ecosystem engineers: the role of shell production in aquatic habitats. Oikos, 101(1), 7990.
U
Hall A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95-98.
N
Hessland, I. (1946). On the quaternary Mya period in Europe. Arkiv för zoology, 37A, 151.
M
A
Hewitt, C.L., Campbell, M.L., Thresher, R.E., Martin, R.B., Boyd, S., Cohen, B.F., Currie, D.R., Gomon, M.F., Keough, M.J., Lewis, J.A., Lockett, M.M., Mays, N., McArthur, M.A., O’Hara, T.O., Poore, G.C.B., Ross, D.J., Storey, M.J., Watson, J.E., & Wilson, R.S. (2004). Introduced and cryptogenic species in Port Phillip Bay, Victoria, Australia. Marine Biology, 144, 183-202.
ED
Hopkins, G.W., & Freckleton, R.P. (2002). Declines in the numbers of amateur and professional taxonomists: implications for conservation. Animal Conservation, 5, 245249.
CC E
PT
Hopkins, G.A., Forrest, B.M., Jiang, W., & Gardner, J.P.A. (2011). Successful eradication of a non-indigenous marine bivalve from a subtidal soft sediment environment. Journal of Applied Ecology, 48, 424-431. ICES. ICES Code of Practice on the Introductions and Transfers of Marine Organisms (2004). http://www.ices.dk/reports/general/2004/icescop2004.pdf IMO. International Maritime Organization. International Convention for the Control and Management of Ships ‘Ballast Water and Sediments. (2004). http://www.imo.org
A
Jerde, C.L., Mahon, A.R., Chadderton, W.L., & Lodge, D.M. (2011). “Sight-unseen” detection of rare aquatic species using environmental DNA. Conservation Letters, 4, 150157. Katsanevakis, S., Wallentinus, I., Zenetos, A., Leppäkoski, E., Cinar, M.E., Ozturk, B., Grabowski, M., Golani, D., Cardoso, A.C. (2014a). Impacts of invasive alien marine species on ecosystem services and biodiversity: a Pan-European review. Aquatic Invasions, 9, 391-423.
Katsanevakis, S., Coll, M., Piroddi, C., Steenbeek, J., Lasram, F.B.R., Zenetos, A., & Cardoso, A.C. (2014b). Invading the Mediterranean Sea: biodiversity atterns shaped by human activities. Frontiers in Marine Science, doi: 10.3389/fmars.2014.00032. Kelly, R.P., Port, J.A., Yamahara, K.M., Martone, R.G., Lowell, N., Thomsen, P.F., Mach, M.E., Bennet, M., Prahler, E., Caldwell, M.R., & Crowder, L.B. (2014). Harnessing DNA to improve environmental management. Science, 344, 1455-1456.
IP T
Kobori, H., Dickinson, J.L., Washitani, I., Sakurai, R., Amano, T., Komatsu, N., Kitamura, W., Takagawa, S., Koyama, K., Ogawara, T., & Miller-Rushing, A.J. (2016). Citizen science: a new approach to advance ecology, education and conservation. Ecological Research, 31(1), 1-19.
SC R
Laramie, M.B., Pilliod, D.S., & Goldberg, C.S. (2015). Characterizing the distribution of an endangered salmonid using environmental DNA analysis. Biological Conservation, 183, 29-37. doi: 10.1016/j.biocon.2014.11.025. Lehtiniemi, M., H. Ojaveer, M. David, B. Galil, S. Gollasch, C. McKenzie, D. Minchin, A. Occhipinti-Ambrogi, S. Olenin, & J. Pederson. (2015). Dose of truth - Monitoring marine non-indigenous species to serve legislative requirements. Marine Policy, 54, 2635.
N
U
Leppäkoski, E.J. (1991). Introduced species – Resource or threat in brackish-water seas? Examples from the Baltic and the Black Sea. Marine Pollution Bulletin, 23, 219- 223.
M
A
Lercari, D., & Bergamino, L. (2011). Impacts of two invasive mollusks, Rapana venosa (Gastropoda) and Corbicula fluminea (Bivalvia), on the food web structure of the Río de la Plata estuary and nearshore oceanic ecosystem. Biological Invasions, 13(9), 20532061.
ED
Lodge, D.M., Williams, S., MacIsaac, H.J., Hayes, K.R., Leung, B., Reichard, S., Mack R.N., Moyle, P.B., Smith, M., Andow, D.A. Carlton, J.T., & McMichael, A. (2006). Biological invasions: recommendations for U.S. policy and management. Ecological Applications, 16(6), 2035-2054.
PT
Marchini, A., Ferrario, J., Sfriso, A., & Occhipinti-Ambrogi, A. (2015). Current status and trends of biological invasions in the Lagoon of Venice, a hotspot of marine NIS introductions in the Mediterranean Sea. Biological Invasions, 17, 2943-2962.
CC E
Miralles, L., Dopico, E., Devloo-Delva, F., & Garcia-Vazquez, E. (2016). Controlling populations of invasive pygmy mussel (Xenostrobus securis) trough citizen science and environmental DNA. Marine Pollution Bulletin, 110(1), 127-32. Möller, P., & Røsenberg, R. (1983). Recruitment, abundance and production of Mya arenaria and Cardium edule in marine shallow waters, western Sweden. Ophelia, 22, 3355.
A
Molnar, J.L., Gamboa, R.L., Revenga, C., & Spalding, M.D. (2008). Assessing the global threat of invasive species to marine biodiversity. Frontiers in Ecology and the Environment, 6(9), 485-492. Monari, S. (2009). Phylogeny and biogeography of pholadid bivalve Barnea (Anchomasa) with considerations on the phylogeny of Pholadoidea. Acta Palaeontologica Polonica, 54, 315–335. MPI. Craft Risk Management Standard: Biofouling on vessels arriving to New Zealand. (2014). http://www.biosecurity.govt.nz/files/regs/ships/crms-biofouling-standard.pdf
Muñoz-Colmenero, M., Ardura, A., Clusa, L., Miralles, L., Gower, F., Zaiko, A., & Garcia-Vazquez, E. (2017). New specific molecular marker detects Ficopomatus enigmaticus from water eDNA before positive results of conventional sampling. Journal for Nature Conservation, https://doi.org/10.1016/j.jnc.2017.12.004 JNC. Naylor, R.L., Goldburg, R.J., Primavera, J.H., Kautsky,N., Beveridge, M.C., Clay, J., Folke, C., Lubchenco, J., Mooney, H., & Troell, M. (2000). Effect of aquaculture on world fish supplies. Nature, 405(6790), 1017-1024.
IP T
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., & Hase, T. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), e63.
SC R
Olenin, S., Elliott, M., Bysveen, I., Culverhouse, P.F., Daunys, D., Dubelaar, G.B.J., Gollasch, S., Goulletquer, P., Jelmert, Kantor, Y., Bringsvor-Mezeth, K., Minchin, D., Occhipinti-Ambrogi, A., Olenina, I., & Vandekerkhove, J. (2011). Recommendations on methods for the detection and control of biological pollution in marine coastal waters. Marine Pollution Bulletin, 62, 2598-2604.
U
Palumbi, S.R. (1996). Nucleic acids II: The polymerase chain reaction. In: D.M. Hillis, C. Moritz, & B.K. Mable (Eds), Molecular systematic. (pp. 205-247). Sinauer Associates.
N
Pelorce, J. (1995). Un débarquement pacifique sur les côtes du golfe du Lion. Xenophora, 71, 5.
M
A
Piola, R.F., Denny, C.M., Forrest, B.M., & Taylor M.D. (2009). Marine biosecurity: management options and response tools. In: P.A. Williams, & M.N. Clout (Eds), Invasive species management: a handbook of principles and techniques. (pp. 205-231). United Kingdom, Oxford University Press.
ED
Pochon, X., Bott, N.J., Smith, K.F., & Wood, S.A. (2013). Evaluating detection limits of Next-Generation Sequencing for the surveillance and monitoring of international marine pests. PLoS One, 8, e73935.
PT
Pochon, X., Zaiko, A., Hopkins, G.A., Banks, J.C., Wood, S.A. (2015). Early detection of eukaryotic communities from marine biofilm using high-throughput sequencing: an assessment of different sampling devices. Biofouling, 31, 241-251.
CC E
Porcheddu A.S., Francour P., Soltan D. (1999). Considerazioni sul ritrovamento di una populazione di Mya arenaria L., 1758 negli stagni di Berri e di Vaïne (France meridionale). Bolletino malacologico, 34(9-12), 167-171. Ricciardi, A. (1998). Global range expansion of the Asian Mussel Limnoperna fortunei (Mytilidae): another fouling threat to freshwater systems. Biofouling, 13, 97–106.
A
Sanger, F., Nicklen, S., Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, 74(12), 5463-5467. Stora, G., Arnoux, A., Galas, M. (1995). Time and spatial dynamics of Mediterranean lagoon macrobenthos during an exceptionally prolonged interruption of freshwater inputs. Hydrobiologia, 300/301, 123-132. Strayer, D.L. (2010). Alien species in fresh waters: ecological effects, interactions with other stressors, and prospects for the future. Freshwater Biology, 55, 152–174.
Streftaris, N., & Zenetos, A. (2006). Alien marine species in the Mediterranean – the 100 ‘Worst Invasives’ and their impact. Mediterranean Marine Science, 7(1), 87-118. Streftaris, N., Zenetos, A., & Papathanassiaou, E. (2005). Globalisation in marine ecosystems: the story of non-indigenous marine species across European seas. Oceanography and Marine Biology: an annual review, 43, 419-453. Thompson, J.D., Higgins, D.G., Gibson, T.J. (1994). ClustalW-improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673-4680.
IP T
Thomsen, P.F., Kielgast, J., Iversen, L.I., Wiuf, C., Rasmussen, F., Gilbert, M.T.P., Orlando, L., & Willerslev, E. (2012). Monitoring endangered freshwater biodiversity using environmental DNA. Molecular Ecology, 21, 2565–2573.
SC R
Tomita, N., Mori, Y., Kanda, H., & Notomi, T. (2008). Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nature Protocols, 3, 877-882. doi:10.1038/nprot.2008.57. Williams, S.L. & Schroeder, S.L. (2004) Eradication of the invasive seaweed Caulerpa taxifolia by chlorine bleach. Marine Ecology Progress Series, 272, 69-76.
N
U
Wood, S.A., Smith, K.F., Banks, J.C., Tremblay, L.A., Rhodes, L., Mountfort, D., Cary, S.C., & Pochon, X. (2013). Molecular genetic tools for environmental monitoring of New Zealand's aquatic habitats, past, present and the future. New Zealand Journal of Marine and Freshwater Research, 47, 90-119.
M
A
Yamamoto, S., Masuda, R., Sato, Y., Sado, T., Araki, H., Kondoh, M., Minamoto, T., & Miya, M. (2017). Environmental DNA metabarcoding reveals local fish communities in a species-rich coastal sea. Scientific Reports, 7, 40368. doi:10.1038/srep40368.
ED
Zaiko, A., Olenin, S., Daunys, D., & Nalepa, T.F. (2007). Vulnerability of benthic habitats to the aquatic invasive species. Biological Invasions, 9, 703-714.
PT
Zaiko, A., Samuiloviene, A., Ardura, A., & Garcia-Vazquez, E. (2015a). Metabarcoding approach for nonindigenous species surveillance in marine coastal waters. Marine Pollution Bulletin, 100, 53-59.
CC E
Zaiko, A., Martinez, J.L., Schmidt-Petersen, J., Ribicic, D., Samuiloviene, A., & GarciaVazquez, E. (2015b). Metabarcoding approach for the ballast water surveillance - an advantageous solution or an awkward challenge? Marine Pollution Bulletin, 92, 25-34. Zenetos A., Gofas S., Russo G. and Templado J. (2004). CIESM Atlas of exotic species in the Mediterranean. Monaco: CIESM Publishers. Molluscs, 3.
A
Zenetos, A., Çinar, M.E., Panucci-Papadopoulou, M.A., Harmelin, J.G., Furnari, G., Andaloro, F., Bellou, N., Streftaris, N., & Zibrowius, H. (2005). Annotated list of marine alien species in the Mediterranean with records of the worst invasive species. Mediterranean Marine Science, 6(2), 63-118. Zenetos, A., Pancucci-Papadopoulou, M., Zogaris, S., Papastergiadou, E., Vardakas, L., Aligizaki, K., & Economou, A.N. (2009). Aquatic alien species in Greece: tracking sources, patterns and effects on the ecosystem. Journal of Biological ResearchThessaloniki, 12, 135-172.
A
CC E
PT
ED
M
A
N
U
SC R
IP T
Figure 1. Locations of the sampling sites in coastal zone of the SE Baltic Sea.
N
U
SC R
IP T
Figure 2. Agarose gel of PCR products amplified with 16S rRNA Mya arenaria-specific primers from M. arenaria (MA), C. glaucum (CG), X. securis (XS), A. senhousia (AS) M. trossulus (MT) and M. galloprovincialis (MG). NC: negative control. Marker (M): DNA size marker 100 bp ladder.
A
CC E
PT
ED
M
A
Figure 3. Agarose gel of PCR products obtained with 16S rRNA M. arenaria-specific primers for serial dilutions 1 to 1:10,000 of M. arenaria in distilled water (1 to 6 correspondingly). NC: negative control. Marker (M): DNA size marker 100 bp ladder.
A
CC E
PT
ED
M
A
N
U
SC R
IP T
Figure 4. Agarose gel of PCR products obtained with universal COI primers (Geller et al., 2013) in water samples from Lithuanian coast in the Baltic Sea (BS-1.1, BS-1.2, BS1.3, BS-2.1, BS-2.2, BS-2.3, BS-3.1, BS-3.2 and BS-3.3). MA: M. arenaria sample as a positive control. Marker: Low DNA Mass Ladder. NC: negative control.
SC R
IP T
Figure 5. Agarose gel of PCR products obtained with 16S rRNA Mya arenaria-specific primers in water samples from the Lithuanian coast in the Baltic Sea (1.1, 1.2, 1.3, 2.1, 2.2, 2.3, 3.1, 3.2 and 3.3). Positive results denoted by the white arrows. MA: M. arenaria sample as positive control. Marker: Low DNA Mass Ladder. NC: Negative control.
A
CC E
PT
ED
M
A
N
U
NC
I N U SC R
A
Table 1. Marker validation in environmental water samples: eDNA concentration (ng/µl); PCR amplification with universal primers described by Geller (2013) used here as positive amplification controls and with Mya arenaria-specific primers described in this article (+: positive and -: negative)
M
Location #1
A
CC E
PT
ED
DNA quantification (ng/µL) PCR amplification with Geller primers (Geller, 2013) PCR amplification with Mya arenaria-specific primers
Location #2
Location #3
1.1 1.72
1.2 1.38
1.3 1.77
2.1 0.36
2.2 1.57
2.3 1.19
3.1 1.46
3.2 2.73
3.3 3.61
+
+
+
+
+
+
+
+
+
-
+
-
+
+
-
+
+
+