Pentraxin 3 accelerates lung injury in high tidal volume ventilation in mice

Molecular Immunology 51 (2012) 82–90

Contents lists available at SciVerse ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Pentraxin 3 accelerates lung injury in high tidal volume ventilation in mice Juliana Monte Real a,b , Graziela Machado Gruner Turco Spilborghs b , Mariana Morato-Marques b , Ricardo Pereira de Moura a,c , Elnara Marcia Negri d , Anamaria Aranha Camargo a,c , Daniel Deheinzelin a,∗,1 , Adriana Abalen Martins Dias b,e,1 a

Hospital Sírio-Libanês, São Paulo, Brazil Laboratory of Inflammation and Cancer, Hospital AC Camargo, São Paulo, Brazil c Laboratory of Molecular Biology and Genomics, Ludwig Institute for Cancer Research, São Paulo, Brazil d Laboratory of Cellular Biology (LIM59), São Paulo University, São Paulo, Brazil e Laboratory of Experimental Genetics, Minas Gerais Federal University, Minas Gerais, Brazil b

a r t i c l e

i n f o

Article history: Received 21 December 2011 Accepted 7 February 2012 Available online 15 March 2012 Keywords: Pentraxin 3 Ventilator-induced lung injury Transgenic mice Mechanical ventilation Inflammation

a b s t r a c t Mechanical ventilation is the major cause of iatrogenic lung damage in intensive care units. Although inflammation is known to be involved in ventilator-induced lung injury (VILI), several aspects of this process are still unknown. Pentraxin 3 (PTX3) is an acute phase protein with important regulatory functions in inflammation which has been found elevated in patients with acute respiratory distress syndrome. This study aimed at investigating the direct effect of PTX3 production in the pathogenesis of VILI. Genetically modified mice deficient and that over express murine Ptx3 gene were subjected to high tidal volume ventilation (VT = 45 mL/kg, PEEPzero ). Morphological changes and time required for 50% increase in respiratory system elastance were evaluated. Gene expression profile in the lungs was also investigated in earlier times in Ptx3-overexpressing mice. Ptx3 knockout and wild-type mice developed same lung injury degree in similar times (156 ± 42 min and 148 ± 41 min, respectively; p = 0.8173). However, Ptx3 overexpression led to a faster development of VILI in Ptx3-overexpressing mice (77 ± 29 min vs 118 ± 41 min, p = 0.0225) which also displayed a faster kinetics of Il1b expression and elevated Ptx3, Cxcl1 and Ccl2 transcripts levels in comparison with wild-type mice assessed by quantitative real-time polymerase chain reaction. Ptx3 deficiency did not impacted the time for VILI induced by high tidal volume ventilation but Ptx3-overexpression increased inflammatory response and reflected in a faster VILI development. © 2012 Elsevier Ltd. All rights reserved.

1. Introduction

Abbreviations: ARDS, acute respiratory distress syndrome; Ccl2, chemokine (C-C motif) ligand 2 (also known as monocyte chemoatractant protein/Mcp1); CRP, C-reactive protein; Cxcl1, chemokine (C-X-C motif) ligand 1 (also known as keratinocyte-derived chemokine/Kc); Hprt, housekeeping gene hypoxanthineguanine phosphoribosyltransferase; Il-10, interleukin-10; IL-1B, interleukin-1 beta; IL-6, interleukin-6; ip, intraperitoneal; MPO, myeloperoxidase; mRNA, messenger RNA; MV, mechanical ventilation; PEEP, positive end-expiratory pressure (cmH2 O); PTX3, pentraxin 3; Ptx3−/− , Ptx3 knockout mice (mixed 129SvEv/C57B/L6 background); Ptx3+/+ , mice mixed 129SvEv/C57B/L6 background; PV, pressure volume loop; qPCR, quantitative real-time polymerase chain reaction; RR, respiratory rate (breaths/min); Tg(Ptx3)CD1, Ptx3-overexpressig mice carrying two extra copies of the murine Ptx3 gene; TNFA, tumor necrosis factor-alpha; VILI, ventilator-induced lung injury; VT , tidal volume (mL/kg). ∗ Corresponding author at: R. Adma Jafet 74/3o Andar, São Paulo, SP 01308-050, Brazil. Tel.: +55 11 96875273; fax: +55 11 35146009. E-mail addresses: juliana [email protected] (J.M. Real), [email protected] (G.M.G.T. Spilborghs), [email protected] (M. Morato-Marques), [email protected] (R.P. de Moura), [email protected] (E.M. Negri), [email protected] (A.A. Camargo), [email protected] (D. Deheinzelin), [email protected] (A.A.M. Dias). 1 These authors contributed equally to this work. 0161-5890/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2012.02.113

Acute respiratory distress syndrome (ARDS) imparts a dim prognosis for acutely ill patients, and only strategies that aimed at reducing mechanical ventilation (MV)-induced lung injury were proven to decrease mortality (Amato et al., 1998; Brower et al., 2000; Villar et al., 2006). As such, a better understanding of the mechanisms underlying ventilator-induced lung injury (VILI) is essential to improve its prognosis. Genomic analysis of alveolar cells submitted to stretching, simulating what happens during mechanical ventilation, disclosed an up regulation of various genes, including pentraxin 3 (PTX3) (dos Santos et al., 2004). An elevation of PTX3 expression was found in pre-injured lungs of rats subjected to high tidal volume ventilation and was directly correlated with lung elastance, and inversely with oxygenation parameters (Okutani et al., 2007). PTX3 belongs to the superfamily of pentraxins, highly conserved through evolution. Unlike classic short pentraxins, of which the most well known is C-reactive protein (CRP), PTX3 is produced locally at the sites of infection and inflammation by a variety of cell

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

types including fibroblasts, endothelial cells, mononuclear phagocytes, and alveolar epithelial cells (He et al., 2007). In these cells, PTX3 is produced in response to proinflammatory signals such as tumor necrosis factor-alpha (TNFA), interleukin-1 beta (IL-1B), and Toll-like receptor agonists (He et al., 2007). Ptx3 is involved in the innate immunological response to many agents, particularly fungi (Garlanda et al., 2002; Diniz et al., 2004), and in the orchestration of the inflammatory response (Dias et al., 2001; Souza et al., 2002; Soares et al., 2006). In humans, high PTX3 serum levels have been associated with an unfavorable outcome in septic patients (Muller et al., 2001) and in patients with acute myocardial infarction (Latini et al., 2004). Elevated PTX3 levels were recently reported as a new serum biomarker for lung carcinoma (Diamandis et al., 2011), and was associated with graft dysfunction after lung transplantation in recipients with idiopathic pulmonary fibrosis as well (Diamond et al., 2011). In ARDS, PTX3 levels in serum are also elevated and correlate with the severity of lung injury (Mauri et al., 2008). Using mice that over express Ptx3 murine gene (Tg(Ptx3)CD1) and knockout mice (Ptx3−/− ) submitted to various experimental models of inflammation, we have previously shown that Ptx3 promotes an important tuning of the host inflammatory response and suggested that in different scenarios the amounts of Ptx3 produced may lead the host inflammatory response to a beneficial or deleterious outcome (Dias et al., 2001; Souza et al., 2002, 2009; Soares et al., 2006). In the present study, Ptx3 genetically modified mice have been submitted to high tidal volume mechanical ventilation in order to investigate if PTX3 would enhance inflammation and worse lung injury. Moreover, the same protocol was employed in knockout mice, to verify if its lack protect lungs from mechanical injury. The data show a similar lung injury developed by Ptx3 knockout and wild-type mice achieved at the same time. However, the augmented expression of Ptx3 exacerbated and accelerated the lung injury in response to high tidal volume ventilation. 2. Materials and methods 2.1. Mice Heterozygous transgenic mice (Tg(Ptx3)CD1; CD1 background) carrying two extra copies of the murine Ptx3 gene under the control of its own promoter were used (Dias et al., 2001). Ptx3 knockout mice (Ptx3−/− , mixed 129SvEv/C57B/L6 background) were generated by homologous recombination (Varani et al., 2002), obtained by deletion of exons 1 and 2 of the Ptx3 gene, thereby preventing any mRNA and Ptx3 protein from being synthesized. For all experiments, the wild-type mice of each genetic background (CD1 and 129SvEv/C57B/L6) were considered. Male mice weighing 29 to 40 grams (CD1 and Tg(Ptx3)CD1) or 21 to 32 grams (Ptx3+/+ and Ptx3−/− ) were used between ages of 6 and 10 weeks. Six nonventilated animals of each group, were euthanized in order to establish a histological control for the morphometric analysis and for the basal gene expression of genes of interest. Mice were maintained in individually ventilated cages and received food and water ad libitum. All the procedures were approved by the Institutional Animal Care and Use Committee from AC Camargo Hospital and were in accordance with the international ethics guidelines. 2.2. In vivo assays Mice (12 animals/group) were anesthetized by intraperitoneal (ip) injection of 100 mg/kg ketamine and 10 mg/kg xylazine, and randomized to receive 100 ␮L of Evans blue dye (2%) or saline (NaCl 0.9%) intravenously. Tracheostomy was performed with a 16-gauge cannulae, and mice were mechanically ventilated (flexiVent, SCIREQ, Canada) in supine position with 10 mL/kg of tidal volume (VT ), zero positive end-expiratory pressure (PEEPzero ), and

83

a respiratory rate (RR) of 150 breaths/min. After muscular paralysis (1.3 mg/kg vecuronium bromide ip), a sustained inflation was given (recruitment) and a pressure volume loop (PV) was performed by applying a 7-step increase and decrease totaling 40 mL/kg volume. Mice were then ventilated with a VT of 45 mL/kg, PEEPzero and 70 breaths/min, and the baseline value of respiratory system elastance (Ers ) was first registered (Ers = 100%). The elastance of the lungs was calculated using the Salazar–Knowles equation (Salazar and Knowles, 1964) (flexiVent software, version 4.02), and subsequent changes in Ers were recorded every 10 min. The end point of mechanical ventilation was determined by a 50% increase of the initial Ers baseline value (Ers = 150%) or, as indicated, at 20, 40 or 60 min. During MV, anesthesia was maintained with half the dose of ketamine/xylazine every 45 min, and mice given vecuronium bromide as needed. At the determined end points, blood was withdrawn by cardiac puncture and the lungs were harvested. In mice injected with Evans blue, a PBS flush was performed to remove the intravascular dye and the left lung was processed for assessment of the dye extravasations and quantification of edema (Souza et al., 2002). The right lungs were immediately frozen in liquid nitrogen and stored at −80 ◦ C for evaluation of myeloperoxidase (MPO) activity (Souza et al., 2002). Results are expressed as total number of neutrophils by the comparison with the myeloperoxidase activity detected from a preparation of thioglycolate-elicited murine peritoneal neutrophils (84% purity) processed in the same way. The lungs of mice injected with saline were used for histological evaluation. Different genotypes of mice were randomized prior to exposure to mechanical ventilation. 2.3. Morphological analysis Morphometry of hematoxylin/eosin lung sections (5 ␮m) was performed by a observer blinded to the study groups who analyzed, for each sample, 10 non-overlapping random fields with an eyepiece integrating a coherent system made of a 100-point grid with 50 lines of known length using conventional light microscopy (Santos et al., 2006; Fernandes et al., 2007). The results about the percentage of collapse, alveolar edema and overdistention in the total area of each microscopic field observed (magnification ×400) are expressed as the mean of 10 randomly selected fields. The inflammatory infiltrate is presented as the number of cells of circular nuclei/area (␮m2 ) of pulmonary tissue presented in each field analyzed (magnification ×1000) (Santos et al., 2006; Fernandes et al., 2007). 2.4. Gene expression analysis The lungs of mice ventilated for fixed times were preserved in RNAlater® (Ambion, USA) for 24 h and stored at −80 ◦ C. Total RNA was isolated from the left lung of ventilated and control (non-ventilated) mice (n = 6/group) using the TRIZOL reagent (Invitrogen, USA). Two micrograms of total RNA were reversetranscribed using ImProm-IITM RT reverse transcriptase (20 U/␮L, Promega, USA) and the oligo-dT primer (5 ␮g/␮L) in a total volume of 20 ␮L. Quantitative Real-Time Polymerase Chain Reaction (qPCR) was performed on the 7300 Real-Time PCR System (Applied Biosystems, USA) using specific primers designed in different exons to avoid genomic DNA amplification (Primer Express 1.5 software, Applied Biosystems, USA) and synthesized by IDT (Integrated DNA Technologies, USA): housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt), used for normalization of the data (Fw TGGATATGCCCTTGACTATAATGAGT, Rv GGCTTTTCCAGTTTCACTAATGACA), Ptx3 (Fw GGACAACGAAATAGACAATGGACTT, Rv CGAGTTCTCCAGCATGATGAAC), Il1b (Fw TCCACCTCAATGGACAGAATATCA, Rv GGTTCTCCTTGTACAAAGCTCATG), Tnfa (Fw CCACGCTCTTCTGTCTACTGAACTT, Rv

84

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

TGAGAGGGAGGCCATTTGG), Ccl2 (Fw GCTGGAGCATCCACGTGTT, Rv GTGAATGAGTAGCAGCAGGTGAGT), Cxcl2 (FwTCCAAAAGATGCTAAAAGGTGTCC, Rv TGTCAGAAGCCAGCGTTCAC), Il6 (Fw CAGAGATACAAAGAAATGATGGATGCT, Rv CAGAAGACCAGAGGAAATTTTCAATA), and Il10 (Fw CCCTGGGTGAGAAGCTGAAG, Rv CACTGCCTTGCTCTTATTTTCACA). Quantitative Real-Time PCR reactions consisted of 1X Master Mix SYBR® Green (Applied Biosystems, USA), 10 ng of cDNA, forward and reverse primers (concentrations varying from 0.4 to 1.6 ␮M, according to the gene) and were performed in duplicate as follows: denaturation step at 95 ◦ C for 10 min followed by 40 cycles of denaturation at 95 ◦ C for 15 s, amplification at 60 ◦ C for 60 s and a cooling step to 4 ◦ C. Amplicons (70–150 mers) were subjected to a melting curve analysis and fractionated on 8% polyacrilamide gels, and in each case a single product of the predicted size was detected confirming specificity (data not shown). The relative expression of the genes was calculated applying Pfaffl mathematical model considering the primers amplification efficiencies (calculated as E = 10(−1/slope) ) (Pfaffl, 2001) and the CP (crossing point) deviation of the ventilated samples vs the non-ventilated controls. 2.5. Statistical analysis Statistical analysis was carried out using the Mann–Whitney test, and results are shown as median and interquartile range. Analysis were made using Prism Software version 4 (Graph Pad Software Inc., USA) and statistical significance was considered when p < 0.05.

(baseline values), and no significant differences were found comparing Ptx3-overexpressig and knockout mice with correspondent wild-type strains as presented in Fig. 1. After the detection of 50% increase in respiratory system elastance, the lungs were evaluated by histological analysis and all groups developed lung injury (Fig. 2). No significant differences were observed between groups of mice concerning breaks in alveolar septa (overdistension), alveolar edema, collapse and inflammatory cell infiltration assessed by morphometric analysis (Table 1). Vascular permeability and polymorphonuclear cells were also assessed by Evans blue dye and myeloperoxidase activity assays as shown in Fig. 3, and no difference was found when ventilated Ptx3-overexpressing and knockout mice were compared with corresponding ventilated wild-type strains. These data indicate that all animals developed similar VILI as a consequence of the mechanical ventilation after reaching a 50% increase from the respiratory elastance baseline value. 3.2. Impact of PTX3 expression on the onset of VILI Elastance was recorded from each animal throughout time of mechanical ventilation (Fig. 4) and the procedure was interrupted just after a confirmatory measurement performed 1 min following the detection of Ers 150%. As depicted in panel C, there was no significant difference in the time required for VILI development between Ptx3−/− and Ptx3+/+ mice (156 ± 42 and 148 ± 41 min, respectively; p = 0.8173). However, Tg(Ptx3)CD1 mice developed VILI significantly more quickly than CD1 control mice (77 ± 29 and 118 ± 41 min, respectively; p = 0.0225), as shown in panel D.

3. Results 3.3. Time-course analysis of early stages of VILI 3.1. Characterization of ventilator-induced lung injury As different strains of mice were used in this study, an analysis of the initial respiratory mechanics was performed when mechanical ventilation with 45 mL/kg of tidal volume was initiated

To further investigate the faster development of VILI in Ptx3overexpressing mice, Tg(Ptx3)CD1 and CD1 were ventilated with 45 mL/kg of tidal volume for 20, 40 and 60 min. The morphometric study disclosed that alveolar edema, breaks in alveolar B

16

Respiratory system elastance (cmH2 O/mL)

Respiratory system elastance (cmH2O/mL)

A

14 12 10 8 6

Ptx3 +/+

16 14 12 10 8 6

Ptx3 -/-

1.00 0.75 0.50 0.25 0.00

Tg(Ptx3)CD1

CD1

Tg(Ptx3)CD1

D

1.25

Ptx3 +/+

Ptx3 -/-

Lung resistence (cmH2O.s/mL)

Lung resistence (cmH2O.s/mL)

C

CD1

1.25 1.00 0.75 0.50 0.25 0.00

Fig. 1. Lung resistance in the initial experimental conditions. In order to characterize the baseline respiratory mechanics of the different strains of mice used in this study, the initial respiratory mechanics were evaluated. Measurement maneuvers were performed to assess initial dynamic resistance and quasi-static elastance of the respiratory system at the initial step of mechanical ventilation with 45 mL/kg of tidal volume. Data represent 12 animals per group. No significant difference was found when comparing Ptx3 knockout (Panels A and C) and Ptx3-overexpressing mice (Panels B and D) with corresponding wild-type strains (Mann–Whitney test).

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

85

Fig. 2. Tissue damage in lungs following high tidal volume mechanical ventilation Tissue sections of the lungs from CD1 (A and B), Tg(Ptx3)CD1 (C and D), Ptx3−/− (E and F) and Ptx3+/+ (G and H) mice non ventilated (left panels) or ventilated with 45 mL/kg of tidal volume until pulmonary elastance increased by 50% (right panels). Hematoxylin-eosin staining. Original magnification ×400.

septa, collapse, and inflammatory cell infiltration were detectable at the early stages of MV (20 min). By comparison between the Ptx3-overexpressing and wild-type mice, there was a slight, but statistically significant, increase in inflammatory cell infiltration in the Ptx3-overexpressing mice after 20 min of MV, suggesting a role for Ptx3 in the recruitment of inflammatory cells towards the damaged tissue at very early stages of VILI (Table 2). The morphologic changes in the pulmonary tissue were accompanied by differences in the gene expression profile of Il1b (Fig. 5,

panel A), Tnfa (Fig. 5, panel B) and Ptx3 (Fig. 5, panel C) and over time. Total RNA was extracted from left lung and the amounts of specific mRNAs were determined by qRT-PCR. A pool of RNAs obtained from the non-ventilated controls CD1 and another pool from Tg(Ptx3)CD1 was used as reference for the estimative of the relative expression rates of each mice strain. Increased expression of Il1b and Tnfa were detectable in both the wild-type and Ptx3overexpressing groups 20 min following MV, whereas increased Ptx3 transcripts were detectable only after 40 min of MV. After

86

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

Table 1 Morphometric parameters and cellularity in lung parenchyma. CD1

Tg(Ptx3)CD1

Ptx3−/−

Ptx3+/+

Overdistension (%)

Control MV

4 (4–6) 41 (32–46)*

6 (4–9) 35 (25–39)*

6 (5–9) 27 (22–34)*

8 (4–9) 31 (25–35)*

Alveolar edema (%)

Control MV

0 16 (8–19)*

0 16 (10–23)*

0 7 (4–11)*

0 8 (4–10)*

Alveolar collapse (%)

Control MV

0 10 (6–18)*

0 17 (12–29)*

0 14 (6–24)*

Inflammatory infiltrate (Cell/␮m2 )

Control MV

*

0.10 (0.07–0.14) 1.44 (1.19–1.57)*

0.08 (0.05–0.10) 1.19 (1.04–1.40)*

0.09 (0.07–0.12) 1.50 (1.41–1.65)*

0 18 (12–28)* 0.10 (0.07–0.11) 1.44 (1.28–1.54)*

Significantly different from the control group (p < 0.05, Mann–Whitney test).

Fig. 3. Evaluation of edema and neutrophil infiltration in the lungs of mice submitted to high tidal volume ventilation Ptx3-overexpressing mice (Tg(Ptx3)CD1), knockout (Ptx3−/− ) and respective wild-type control mice (n = 6/group) were submitted to mechanical ventilation with 45 mL/kg of tidal volume until an increase of 50% from the elastance initial baseline value was observed. Changes in vascular permeability (Panels A and B) and neutrophil infiltration (Panels C and D) were evaluated by measuring the extravasation of Evans blue dye into lung tissue and the tissue myeloperoxidase activity, respectively. No statistical differences were found in the comparison between the genetically engineered mice and respective wild-type controls (Mann–Whitney test).

60 min of MV, a drastically higher expression of Il1b, followed by an increase in Ptx3 transcripts, were detected in Ptx3-overexpressing mice, in comparison with CD1 wild-type animals (Fig. 5, panels A and C). Besides Ptx3 and Il1b, Ptx3-overexpressing mice also presented higher expression of the chemokines Cxcl1 (also known

as keratinocyte-derived chemokine/Kc) and Ccl2 (also known as monocyte chemoatractant protein/Mcp1), compared with wildtype mice at 60 min following MV (Fig. 5, panel D). Such findings could, at least in part, account for the faster development of VILI in Ptx3-overexpressing group.

Table 2 Morphometric parameters and cellularity in lung parenchyma throughout lenght of MV. Groups

Overdistendend area (%)

Alveolar edema (%)

Alveolar collapse (%)

Inflammatory infiltrate (cells/␮m2 ) 0.10 (0.07–0.14) 0.95 (0.80–1.25)* 1.20 (0.90–1.60)* 1.55 (1.20–1.60)*

Control CD1 CD1 (20 min MV) CD1 (40 min MV) CD1 (60 min MV)

4 (4–6) 39 (35–45)* 38 (33–44)* 38 (35–41)*

0 3 (2–4)* 3 (2–5)* 3 (2–4)*

0 7 (4–10)* 7 (5–11)* 10 (6–12)*

Control Tg(Ptx3)CD1 Tg(Ptx3)CD1 (20 min MV) Tg(Ptx3)CD1 (40 min MV) Tg(Ptx3)CD1 (60 min MV)

6 (4–9) 41 (30–43)* 35 (32–38)* 32 (28–38)*

0 3 (2–5)* 3 (3–5)* 3 (2–5)*

0 9 (5–18)* 7 (3–13)* 8 (5–13)*

* †

p < 0.05 vs control non-ventilated group (Mann–Whitney test). p = 0.008 vs CD1 20 min MV (Mann–Whitney test).

0.08 (0.05–0.10) 1.40 (1.25–1.40)* , † 1.20 (1.10–1.35)* 1.45 (1.30–1.65)*

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

87

Fig. 4. Time course of respiratory system elastance increase and mean time required to develop VILI Ptx3−/− and Ptx3+/+ (Panel A), CD1 and Tg(Ptx3)CD1 (Panel B) were submitted to mechanical ventilation (n = 12/group) with 45 mL/kg of tidal volume and the respiratory elastance values were measured every 10 min until an increase above 50% from its initial baseline value (Ers 150%) was observed. The line across the graphs A and B represents the point of Ers 150%. The time required by Ptx3 knockout (Ptx3−/− ) (Panel C), Ptx3-overexpressing (Tg(Ptx3)CD1) (Panel D) and their respective wild-type controls to develop VILI was recorded. *Significantly different from control group (p = 0.0225; Mann–Whitney test).

Fig. 5. Changes in gene expression profile within the lungs of Ptx3-overexpressing mice following mechanical ventilation Ptx3-overexpressing and respective CD1 wild-type control mice (n = 6/time point/group) were submitted to mechanical ventilation with 45 mL/kg of tidal volume for 20, 40, or 60 min. Panels A, B and C show the kinetics of Il1b (A), Tnfa (B) and Ptx3 (C) expression in the lungs of ventilated mice during the time course of mechanical ventilation. Panel D shows the gene expression profile evaluated 60 min after the beginning of mechanical ventilation. The relative gene expression of inflammatory mediators in the lungs of ventilated Tg(Ptx3)CD1 and CD1 mice in comparison with corresponding non-ventilated control mice was assessed by RT-qPCR. Amplification of the housekeeping gene Hprt was used for normalization of the data. Results are the median and interquartile range and significant differences are indicated (p < 0.05; Mann–Whitney test).

88

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

4. Discussion Inflammation is known to contribute to the pathogenesis of VILI, and its reduction as a result of protective ventilatory modes represents the only effective approach towards improving the survival of ARDS patients (Amato et al., 1998). Although a heightened expression of PTX3 in the lungs of rats submitted to experimental high tidal volume ventilation (Okutani et al., 2007) and also in the serum of patients with acute lung injury and ARDS has been reported (Okutani et al., 2007; Mauri et al., 2008), little is known about the role of PTX3 in VILI. Using Ptx3-overexpressing and knockout mice we were able to show that Ptx3-overexpression accelerated the VILI development. PTX3 plays an important role in innate immunity and in resistance to many agents that infect the lungs, such as Aspergillus fumigatus, Pseudomonas aeruginosa (Garlanda et al., 2002), Paracoccidioides brasiliensis (Diniz et al., 2004), and Klebsiella pneumonie (Soares et al., 2006). Pathogens and proinflammatory signals such as IL1B and TNFA, characteristic in VILI, can trigger a rapid release of PTX3 by neutrophils (Jaillon et al., 2007), lung mononuclear phagocytes (Alles et al., 1994) and pulmonary epithelial cells (dos Santos et al., 2004; Han et al., 2005), leading to a local inflammatory response. In mechanical ventilation, PTX3 can be directly produced by lung epithelial cells in response to mechanical stress (dos Santos et al., 2004) and, during the early course of VILI, we observed that Ptx3-overexpression was associated with higher mRNA levels of Il1b, Cxcl1(Kc) and Ccl2(Mcp1) expression and also with earlier neutrophil recruitment, a characteristic feature in the pathogenesis of VILI (Choudhury et al., 2004). In accordance with this data, when Ptx3-overexpressing mice were submitted to intestinal isquemia and reperfusion, the impaired survival rate was also correlated with higher protein concentrations of Tnfa, Il1b, Cxcl1 and Ccl2 in the tissue as compared to wild-type mice (Souza et al., 2002). Inhibition of CXCR-2, an important CXCL1/KC receptor, has been found to impair neutrophil infiltration and to attenuate VILI (Belperio et al., 2002). Monocytes, sequestered into the lungs mainly by CCL2 (Maus et al., 2002), have also been related to the development of stretch-induced pulmonary edema in mice (Wilson et al., 2009). Besides the prompt release by neutrophils (Jaillon et al., 2007), the synthesis of PTX3 by pulmonary epithelial cells and by monocytes/macrophages is also locally promoted by IL1B (Alles et al., 1994), a cytokine increased in response to MV associated with a poorer clinical outcome (Frank et al., 2006). Our findings in Ptx3-overexpressed ventilated mice showing increased Il1b RNA expression, a stimulus for PTX3 synthesis, corroborate other previous data in vivo (Souza et al., 2002). The important relationship between PTX3 and IL1B signaling to an amplified inflammatory response was also reported in a cigarette smoke model of COPD where PTX3 up-regulation in pulmonary veins was dependent on the IL1 pathway (Pauwels et al., 2010). Elevated PTX3 protein levels are highly correlated with the number of neutrophils in the sputum of COPD patients (Van Pottelberge et al., 2011). While PTX3 may act as an enhancer of the inflammation in response to high tidal volume ventilation, not all MV-induced damage is mediated by this pentraxin. Ptx3 knockout mice developed lung injury in a pattern similar to that observed in the respective wild-type control group. Similarly, although TNFA is recognized as an important mediator of VILI, mice lacking Tnfa receptors also develop lung inflammation in response to high-stretch ventilation (Wilson et al., 2005). Those findings suggest the role of alternative cytokine or inflammation pathways, thus reflecting the complexity and redundancy of the cytokine network in inflammation. Indeed, our results suggest that while Ptx3 plays a non redundant role in the resistance against A. fumigatus and P. aeruginosa infection (Garlanda et al., 2002), the complete removal of Ptx3 in knockout mice was not sufficient to abrogate VILI because PTX3 exerts a redundant role

in the pathogenesis of this disorder. However, the action of Ptx3 in VILI is crucial when this pentraxin is present in elevated levels. Earlier studies from our group have shown the critical impact of Ptx3 as a fine-tuner of inflammation, playing a dual role depending on the nature of the insult and the amount of Ptx3 expressed (Soares et al., 2006; Dias et al., 2001; Souza et al., 2002). While the production of Ptx3 was advantageous and seemed to reduce mortality resulting from endotoxic shock or cecal ligation and puncture (Dias et al., 2001), it was extremely deleterious in a model of intestinal ischemia and reperfusion, increasing tissue damage and mortality (Souza et al., 2002, 2009). Another evidence of the dual Ptx3 action was observed in a model of pulmonary infection caused by Klebsiella pneumoniae. Ptx3-overexpressing mice exposed to a small K. pneumoniae lung inoculum exhibited a protective profile with improved survival, while animals inoculated with a larger amount of bacteria had a higher mortality rate (Soares et al., 2006). In acute lung injury model induced by LPS instillation in mice, Ptx3 levels increased in bronchoalveolar lavage 24 h after incremental LPS doses (0, 1, 2.5 and 5 mg/kg) and correlated with lung injury scores (He et al., 2009). Interestingly, 6 h after 5 mg/kg instillation of LPS, Ptx3 knock-out mice showed increased lung injury compared to WT mice, suggesting that Ptx3 could play a protective role in ALI (Han et al., 2010). Recently, it was demonstrated that PTX3 attenuates P-selectin-dependent neutrophil recruitment in mice exposed to pleurisy and acid-induced ARDS (Deban et al., 2010). The PTX3 degranulation from neutrophils of patients with acute myocardial infarction seems to be an acute and transient event, where PTX3 binds to activated platelets and dampens their action, acting as a negative feedback loop on the inflammatory response (Maugeri et al., 2011). In the present study we showed the role of Ptx3 in an acute lung injury model caused by high tidal volume in a short period of time, but it is possible that the consequences of Ptx3 production in a long-term MV, using ventilatory strategies set to avoid lung injury may have a different outcome and should be further investigated. Although the ventilatory strategy adopted in this study (VT = 45 mL/kg, PEEPzero ) is not used in clinical practice in humans, the PTX3 proinflammatory action may also occur even when “normal” tidal volume (VT = 6–8 mL/kg) is delivered to the lungs, since patients do not present similar obstructive pulmonary disease and regional overinflation in healthy regions may occur (Macintyre, 2005). It is reasonable to propose that patients who start mechanical ventilation with previously higher PTX3 levels will have a worse prognosis. Frequently, these patients have pneumonia, cancer and other inflammatory processes in which an increased PTX3 expression has been reported (Latini et al., 2004; Mauri et al., 2008). Possible mechanisms by which Ptx3 amplifies the inflammatory response is the local activation of coagulation cascade mediated by the Tissue Factor pathway (He et al., 2009), interaction with Fc␥ receptor (Fc␥RIII/CD16 and Fc␥RII/CD32) (Lu et al., 2008), or other mechanism not yet described. Importantly, PTX3 can interact with key components of all three complement pathways (C1q, Ficolin-2, Factor H) (Deban et al., 2011). Depending on the way that PTX3 is presented to C1q, it can result in the activation (PTX3 interaction with plastic-immobilized C1q) (Bottazzi et al., 1997), or inhibition of the classical pathway (fluid-phase PTX3 binding to C1q) (Nauta et al., 2003). PTX3 glycosylation also contributes to modulate PTX3/C1q. PTX3 protein produced by cells after an inflammatory stimulus, enhances the classical complement pathway activation when compared to PTX3 native protein (Inforzato et al., 2006). Takahashi and cols pointed the complement cascade as a mechanism involved in VILI. The pretreatment with humanized cobra venon factor, which inactivates C3, attenuates acute lung injury in mice submitted to high tidal volume ventilation (VT = 35 mL/kg, PEEP = 2 cmH2 O, 2 h) (Takahashi et al., 2011). In the lung injury environment caused by mechanical stress, PTX3 could

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

be increasing the complement system activation. Moreover, PTX3 can also recognize apoptotic cells and debris (Manfredi et al., 2008), shaping the outcome of the acute tissue injury. The elevated levels of inflammatory mediators such as Il1b, Cxcl1 and Ccl2, found in Ptx3-overexpressing mice, provide a clue that enhanced induction of cytokines leads to worsened local tissue injury and to a faster VILI development. 5. Conclusion The data presented here contribute to a better understanding of the pathophysiology of VILI by addressing the role of Ptx3 as a protein that exacerbates lung injury induced by high tidal volume ventilation in mice. Conclusions on the role of Ptx3 in protective ventilator strategies, warrants further investigation. As the final balance between pro- and anti-inflammatory signals will determine the severity and the outcome of VILI/ARDS, future studies on PTX3 function will be crucial to assess its potential for clinical interventions. Contributions Real JM carried out all mice and molecular studies, performed the statistical analysis and drafted the manuscript. Spilborghs GMGT helped on mouse experiments. Marques MM and Moura RP participated in the RT-qPCR assays. Negri EM participated in the histological analysis. Camargo AA helped in RT-qPCR analysis. Deheinzelin D and Dias AAM participated in the design and coordination of the study and also helped to draft the manuscript. All authors read and approved the final manuscript. Conflict of interest statement The authors declare that they have no competing interests. Acknowledgements We thank Dr. Luiz Fernando Lima Reis for his support and critical discussions; Dr. Sibele Inácio Meireles for the critical review of the manuscript; Dr. Martin Matzuk for Ptx3−/− animals; the technical assistance of Carlos Nascimento in the preparation of tissue sections for histology; and Wanderley Lourenc¸o Gonc¸alves, Oraci de Lima Leite and Ederval de Oliveira Machado, for animal care. This work was funded by The State of Sao Paulo Research Foundation’s (FAPESP) grant number 06/02348-0 and awarded the “Cell and Molecular Biology Young Scientist Travel Award” at the 2007 European Respiratory Society Congress. An article was published at European Respiratory Review about this honor (Eur Respir Rev 2008; 17: 108, 81–82). References Alles, V.V., Bottazzi, B., Peri, G., Golay, J., Introna, M., Mantovani, A., 1994. Inducible expression of Ptx3, a new member of the pentraxin family, in human mononuclear phagocytes. Blood 84, 3483–3493. Amato, M.B., Barbas, C.S., Medeiros, D.M., Magaldi, R.B., Schettino, G.P., Lorenzi-Filho, G., Kairalla, R.A., Deheinzelin, D., Munoz, C., Oliveira, R., Takagaki, T.Y., Carvalho, C.R., 1998. Effect of a protective-ventilation strategy on mortality in the acute respiratory distress syndrome. New England Journal of Medicine 338, 347–354. Belperio, J.A., Keane, M.P., Burdick, M.D., Londhe, V., Xue, Y.Y., Li, K.W., Phillips, R.J., Strieter, R.M., 2002. Critical role for CXCR2 and CXCR2 ligands during the pathogenesis. Journal of Clinical Investigation 110, 1703–1716. Bottazzi, B., Vouret-Craviari, V., Bastone, A., De Gioia, L., Matteucci, C., Peri, G., Spreafico, F., Pausa, M., D’Ettorre, C., Gianazza, E., Tagliabue, A., Salmona, M., Tedesco, F., Introna, M., Mantovani, A., 1997. Multimer formation and ligand recognition by the long pentraxin PTX3—similarities and differences with the short pentraxins C-reactive protein and serum amyloid P component. Journal of Biological Chemistry 272, 32817–32823. Brower, R.G., Matthay, M.A., Morris, A., Schoenfeld, D., Thompson, B.T., Wheeler, A., Wiedemann, H.P., Arroliga, A.C., Fisher, C.J., Komara, J.J., Perez-Trepichio, P.,

89

Parsons, P.E., Wolkin, R., Welsh, C., Fulkerson, W.J., MacIntyre, N., Mallatratt, L., Sebastian, M., McConnell, R., Wilcox, C., Govert, J., Thompson, D., Clemmer, T., Davis, R., Orme, J., Weaver, L., Grissom, C., Eskelson, M., Young, M., Gooder, V., McBride, K., Lawton, C., d’Hulst, J., Peerless, J.R., Smith, C., Brownlee, J., Pluss, W., Kallet, R., Luce, J.M., Gottlieb, J., Elmer, M., Girod, A., Park, P., Daniel, B., Gropper, M., Abraham, E., Piedalue, F., Glodowski, J., Lockrem, J., McIntyre, R., Reid, K., Stevens, C., Kalous, D., Silverman, H.J., Shanholtz, C., Corral, W., Toews, G.B., Arnoldi, D., Bartlett, R.H., Dechert, R., Watts, C., Lanken, P.N., Anderson, H., Finkel, B., Hanson, C.W., Barton, R., Mone, M., Hudson, L.D., Lee, C., Carter, G., Maier, R.V., Steinberg, K.P., Bernard, G., Stroud, M., Swindell, B., Stone, L., Collins, L., Mogan, S., Ancukiewicz, M., Hayden, D., Molay, F., Ringwood, N., Wenzlow, G., Kazeroonian, A.S., Gail, D.B., Bosken, C.H., Randall, P., Waclawiw, M., Spragg, R.G., Boyett, J., Kelley, J., Leeper, K., Secundy, M.G., Slutsky, A., Hyers, T.M., Emerson, S.S., Garcia, J.G.N., Marini, J.J., Pingleton, S.K., Shasby, M.D., Sibbald, W.J., 2000. Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute respiratory distress syndrome. New England Journal of Medicine 342, 1301–1308. Choudhury, S., Wilson, M.R., Goddard, M.E., O’Dea, K.P., Takata, M., 2004. Mechanisms of early pulmonary neutrophil sequestration in ventilator-induced lung injury in mice. American Journal of Physiology: Lung Cellular and Molecular Physiology 287, L902–L910. Deban, L., Jaillon, S., Garlanda, C., Bottazzi, B., Mantovani, A., 2011. Pentraxins in innate immunity: lessons from PTX3. Cell and Tissue Research 343, 237–249. Deban, L., Russo, R.C., Sironi, M., Moalli, F., Scanziani, M., Zambelli, V., Cuccovillo, I., Bastone, A., Gobbi, M., Valentino, S., Doni, A., Garlanda, C., Danese, S., Salvatori, G., Sassano, M., Evangelista, V., Rossi, B., Zenaro, E., Constantin, G., Laudanna, C., Bottazzi, B., Mantovani, A., 2010. Regulation of leukocyte recruitment by the long pentraxin PTX3. Nature Immunology 11, 328–334. Diamandis, E.P., Goodglick, L., Planque, C., Thornquist, M.D., 2011. Pentraxin-3 is a novel biomarker of lung carcinoma. Clinical Cancer Research 17, 2395–2399. Diamond, J.M., Lederer, D.J., Kawut, S.M., Lee, J., Ahya, V.N., Bellamy, S., Palmer, S.M., Lama, V.N., Bhorade, S., Crespo, M., Demissie, E., Sonett, J., Wille, K., Orens, J., Shah, P.D., Weinacker, A., Weill, D., Kohl, B.A., Deutschman, C.C., Arcasoy, S., Shah, A.S., Belperio, J.A., Wilkes, D., Reynolds, J.M., Ware, L.B., Christie, J.D., 2011. Elevated plasma long pentraxin-3 levels and primary graft dysfunction after lung transplantation for idiopathic pulmonary fibrosis. American Journal of Transplantation 11, 2517–2522. Dias, A.A.M., Goodman, A.R., Dos Santos, J.L., Gomes, R.N., Altmeyer, A., Bozza, P.T., Horta, M.D., Vilcek, J., Reis, L.F.L., 2001. TSG-14 transgenic mice have improved survival to endotoxemia and to CLP-induced sepsis. Journal of Leukocyte Biology 69, 928–936. Diniz, S.N., Nomizo, R., Cisalpino, P.S., Teixeira, M.M., Brown, G.D., Mantovani, A., Gordon, S., Reis, L.F.L., Dias, A.A.M., 2004. PTX3 function as an opsonin for the dectin-1-dependent internalization of zymosan by macrophages. Journal of Leukocyte Biology 75, 649–656. dos Santos, C.C., Han, B., Andrade, C.F., Bai, X., Uhlig, S., Hubmayr, R., Tsang, M., Lodyga, M., Keshavjee, S., Slutsky, A.S., Liu, M., 2004. DNA microarray analysis of gene expression in alveolar epithelial cells in response to TNF alpha, LPS, and cyclic stretch. Physiological Genomics 19, 331–342. Fernandes, T.R., Pontieri, V., Moretti, A.I., Teixeira, D.O., Abatepaulo, F., Soriano, F.G., Negri, E.M., Velasco, I.T., Souza, H.P., 2007. Hypertonic saline solution increases the expression of heat shock protein 70 and improves lung inflammation early after reperfusion in a rodent model of controlled hemorrhage. Shock 27, 172–178. Frank, J.A., Parsons, P.E., Matthay, M.A., 2006. Pathogenetic significance of biological markers of ventilator-associated lung injury in experimental and clinical studies. Chest 130, 1906–1914. Garlanda, C., Hirsch, E., Bozza, S., Salustri, A., De Acetis, M., Nota, R., Maccagno, A., Riva, F., Bottazzi, B., Peri, G., Doni, A., Vago, L., Botto, M., De Santis, R., Carminati, P., Siracusa, G., Altruda, F., Vecchi, A., Romani, L., Mantovani, A., 2002. Non-redundant role of the long pentraxin PTX3 in anti-fungal innate immune response. Nature 420, 182–186. Han, B., Haitsma, J.J., Zhang, Y., Bai, X., Rubacha, M., Keshavjee, S., Zhang, H., Liu, M., 2010. Long pentraxin PTX3 deficiency worsens LPS-induced acute lung injury. Intensive Care Medicine 37, 334–342. Han, B., Mura, M., Andrade, C.F., Okutani, D., Lodyga, M., dos Santos, C.C., Keshavjee, S., Matthay, M., Liu, M., 2005. TNFalpha-induced long pentraxin PTX3 expression in human lung epithelial cells via JNK. Journal of Immunology 175, 8303–8311. He, X., Han, B., Bai, X., Zhang, Y., Cypel, M., Mura, M., Keshavjee, S., Liu, M., 2009. PTX3 as a potential biomarker of acute lung injury: supporting evidence from animal experimentation. Intensive Care Medicine 36, 356–364. He, X.L., Han, B., Liu, M.Y., 2007. Long pentraxin 3 in pulmonary infection and acute lung injury. American Journal of Physiology: Lung Cellular and Molecular Physiology 292, L1039–L1049. Inforzato, A., Peri, G., Doni, A., Garlanda, C., Mantovani, A., Bastone, A., Carpentieri, A., Amoresano, A., Pucci, P., Roos, A., Daha, M.R., Vincenti, S., Gallo, G., Carminati, P., De, S.R., Salvatori, G., 2006. Structure and function of the long pentraxin PTX3 glycosidic moiety: fine-tuning of the interaction with C1q and complement activation. Biochemistry 45, 11540–11551. Jaillon, S., Peri, G., Delneste, Y., Fremaux, I., Doni, A., Moalli, F., Garlanda, C., Romani, L., Gascan, H., Bellocchio, S., Bozza, S., Cassatella, M.A., Jeannin, P., Mantovani, A., 2007. The humoral pattern recognition receptor PTX3 is stored in neutrophil granules and localizes in extracellular traps. Journal of Experimental Medicine 204, 793–804. Latini, R., Maggioni, A.P., Peri, G., Gonzini, L., Lucci, D., Mocarelli, P., Vago, L., Pasqualini, F., Signorini, S., Soldateschi, D., Tarli, L., Schweiger, C., Fresco, C.,

90

J.M. Real et al. / Molecular Immunology 51 (2012) 82–90

Cecere, R., Tognoni, G., Mantovani, A., 2004. Prognostic significance of the long pentraxin PTX3 in acute myocardial infarction. Circulation 110, 2349–2354. Lu, J., Marnell, L.L., Marjon, K.D., Mold, C., Du Clos, T.W., Sun, P.D., 2008. Structural recognition and functional activation of FcgammaR by innate pentraxins. Nature 456, 989–992. Macintyre, N.R., 2005. Current issues in mechanical ventilation for respiratory failure. Chest 128, 561S–567S. Manfredi, A.A., Rovere-Querini, P., Bottazzi, B., Garlanda, C., Mantovani, A., 2008. Pentraxins humoral innate immunity and tissue injury. Current Opinion in Immunology 20, 538–544. Maugeri, N., Rovere-Querini, P., Slavich, M., Coppi, G., Doni, A., Bottazzi, B., Garlanda, C., Cianflone, D., Maseri, A., Mantovani, A., Manfredi, A.A., 2011. Early and transient release of leukocyte pentraxin 3 during acute myocardial infarction. Journal of Immunology 187, 970–979. Mauri, T., Coppadoro, A., Bellani, G., Bombino, M., Patroniti, N., Peri, G., Mantovani, A., Pesenti, A., 2008. Pentraxin 3 in acute respiratory distress syndrome: an early marker of severity. Critical Care Medicine 36, 2302–2308. Maus, U., von Grote, K., Kuziel, W.A., Mack, M., Miller, E.J., Cihak, J., Stangassinger, M., Maus, R., Schlondorff, D., Seeger, W., Lohmeyer, J., 2002. The role of CC chemokine receptor 2 in alveolar monocyte and neutrophil immigration in intact mice. American Journal of Respiratory and Critical Care Medicine 166, 268–273. Muller, B., Peri, G., Doni, A., Torri, V., Landmann, R., Bottazzi, B., Mantovani, A., 2001. Circulating levels of the long pentraxin PTX3 correlate with severity of infection in critically ill patients. Critical Care Medicine 29, 1404–1407. Nauta, A.J., Bottazzi, B., Mantovani, A., Salvatori, G., Kishore, U., Schwaeble, W.J., Gingras, A.R., Tzima, S., Vivanco, F., Egido, J., Tijsma, O., Hack, E.C., Daha, M.R., Roos, A., 2003. Biochemical and functional characterization of the interaction between pentraxin 3 and C1q. European Journal of Immunology 33, 465–473. Okutani, D., Han, B., Mura, M., Waddell, T.K., Keshavjee, S., Liu, M.Y., 2007. Highvolume ventilation induces pentraxin 3 expression in multiple acute lung injury models in rats. American Journal of Physiology: Lung Cellular and Molecular Physiology 292, L144–L153. Pauwels, N.S., Bracke, K.R., Maes, T., Van Pottelberge, G.R., Garlanda, C., Mantovani, A., Joos, G.F., Brusselle, G.G., 2010. Cigarette smoke induces PTX3 expression in pulmonary veins of mice in an IL-1 dependent manner. Respiratory Research 11, 134. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research, 29.

Salazar, E., Knowles, J.H., 1964. Analysis of pressure-volume characteristics of lungs. Journal of Applied Physiology 19, 97. Santos, F.B., Nagato, L.K.S., Boechem, N.M., Negri, E.M., Guimaraes, A., Capelozzi, V.L., Faffe, D.S., Zin, W.A., Rocco, P.R.M., 2006. Time course of lung parenchyma remodeling in pulmonary and extrapulmonary acute lung injury. Journal of Applied Physiology 100, 98–106. Soares, A.C., Souza, D.G., Pinho, V., Vieira, A.T., Nicoli, J.R., Cunha, F.Q., Mantovani, A., Reis, L.F.L., Dias, A.A.M., Teixeira, M.M., 2006. Dual function of the long pentraxin PTX3 in resistance against pulmonary infection with Klebsiella pneumoniae in transgenic mice. Microbes and Infection 8, 1321–1329. Souza, D.G., Amaral, F.A., Fagundes, C.T., Coelho, F.M., Arantes, R.M.E., Sousa, L.P., Matzuk, M.M., Garlanda, C., Mantovani, A., Dias, A.A., Teixeira, M.M., 2009. The long pentraxin PTX3 is crucial for tissue inflammation after intestinal ischemia and reperfusion in mice. American Journal of Pathology 174, 1309–1318. Souza, D.G., Soares, A.C., Pinho, V., Torloni, H., Reis, L.F.L., Teixeira, M.M., Dias, A.A.M., 2002. Increased mortality and inflammation in tumor necrosis factor-stimulated gene-14 transgenic mice after ischemia and reperfusion injury. American Journal of Pathology 160, 1755–1765. Takahashi, K., Saha, D., Shattino, I., Pavlov, V.I., Stahl, G.L., Finnegan, P., Melo, M.F., 2011. Complement 3 is involved with ventilator-induced lung injury. International Immunopharmacology 11, 2138–2143. Van Pottelberge, G.R., Bracke, K.R., Pauwels, N.S., Vermassen, F.E., Joos, G.F., Brusselle, G.G., 2011. COPD is associated with reduced pulmonary interstitial expression of Pentraxin-3. European Respiratory Journal [Epub ahead of printing]. Varani, S., Elvin, J.A., Yan, C.N., DeMayo, J., Demayo, F.J., Horton, H.F., Byrne, M.C., Matzuk, M.M., 2002. Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Molecular Endocrinology 16, 1154–1167. Villar, J., Kacmarek, R.M., Perez-Mendez, L., Aguirre-Jaime, A., 2006. A high positive end-expiratory pressure, low tidal volume ventilatory strategy improves outcome in persistent acute respiratory distress syndrome: a randomized, controlled trial. Critical Care Medicine 34, 1311–1318. Wilson, M.R., Choudhury, S., Takata, M., 2005. Pulmonary inflammation induced by high-stretch ventilation is mediated by tumor necrosis factor signaling in mice. American Journal of Physiology: Lung Cellular and Molecular Physiology 288, L599–L607. Wilson, M.R., O’Dea, K.P., Zhang, D., Shearman, A.D., van Rooijen, N., Takata, M., 2009. Role of lung-marginated monocytes in an in vivo mouse model of ventilatorinduced lung injury. American Journal of Respiratory and Critical Care Medicine 179, 914–922.