- Email: [email protected]
Peroxisomes Exist in Growth Cones and Move Anterogradely and Retrogradely in Neurites of PC12D Cells
Experimental Cell Research 266, 260 –269 (2001) doi:10.1006/excr.2001.5226, available online at http://www.idealibrary.com on
Peroxisomes Exist in Growth Cones and Move Anterogradely and Retrogradely in Neurites of PC12D Cells Tetsuya Ishikawa,* ,1 Chikage Kawai,* Mamoru Sano,† and Yohsuke Minatogawa* *Department of Biochemistry, Kawasaki Medical School, 577 Matsushima, Kurashiki, Okayama 701-0192, Japan; and †Department of Biology, Kyoto Prefectural University of Medicine, 13 Taishogun kitaku, Kyoto, Kyoto 603-8334, Japan
Localization and movement of peroxisomes have been investigated in neurites of a subline of PC12 pheochromocytoma cells (PC12D cells). The cells were transfected with a construct encoding the green fluorescent protein and bearing the C-terminal peroxisomal targeting signal 1 SKL motif (-Ser-Lys-LeuCOOH). Peroxisomes were detected as green punctate fluorescent signals. Many peroxisomes were observed in neurites of PC12D cells, especially in neural terminal-like structures, growth cones, varicosities, and branch points. Growth cones containing many peroxisomes were active, since they extended several long filopodias. Existence of peroxisomes in growth cones and neuronal terminal-like structures suggests that peroxisomes might have some role in neuronal extension and nerve terminal functioning. Peroxisomal motility was analyzed by time-lapse imaging using a fluorescence microscope at 25°C. Peroxisomes were transported bidirectionally in neurites, i.e., through anterograde and retrograde transport. This result suggests that peroxisomes move to growth cones and neural terminals from the PC12D cell body, play some role in these parts, and go back to cell body. © 2001 Academic Press
Key Words: peroxisome; neurite; growth cone; motility; GFP; anterograde transport; retrograde transport.
INTRODUCTION
The mammalian peroxisome is a versatile and ubiquitous subcellular organelle involved in numerous catabolic and anabolic pathways involved in hydrogen peroxide metabolism such as the -oxidation of (very) long chain fatty acids and the biosynthesis of ether phospholipids [1]. Impaired biogenesis of peroxisomes results in a number of severe debilitating and often lethal diseases in human, showing the importance of the peroxisomal function for survival. In human, the failure to assemble normal peroxisomes results in a 1 To whom reprint requests should be addressed. Fax: ⫹81 86 462 1199. E-mail: [email protected].
0014-4827/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
group of genetically heterogeneous diseases known as peroxisome biogenesis disorders [2]. The Zellweger syndrome is a typical disease caused by a peroxisome biogenesis disorder [3] and presents with multiple malformations [4, 5] characterized by the absence of peroxisomes. Another name for the Zellweger syndrome is cerebrohepatorenal syndrome, having insufficient neurological maturation. But the essential roles of the peroxisomes in neuron growth are not well understood, except for the metabolism of very long chain fatty acids [6]. Many cellular organelles have been described as being motile [7] with shuttling in all directions [8 –12]. Peroxisomes in a cell body possess three distinct motility states, i.e., saltation, oscillation, and arrest [13– 16]. The motility state of a given peroxisome may change with time. In CHO cells, about 10 –20% of the entire peroxisome population are in saltation or arrest, assuming association of the organelles with the cytoskeleton, whereas 70% are thermally oscillating [13]. In CV1 cells, about 5% of the peroxisomes are in a saltation with peak velocities up to 0.75 m/s, and the others are oscillating [14]. The peroxisomal movements in CHO cells have been shown to be regulated by a signaling cascade involving a heterotrimeric G protein of the G i/G o class, phospholipase A 2 (PLA 2). Activation of these proteins followed by the release of arachidonic acid blocked peroxisomal movements [15]. Kinetic analysis by time-lapse imaging revealed that CHO cells respond to the simultaneous addition of ATP and lysophosphatidic acid (LPA) by reducing peroxisomal movements. When Ca 2⫹ was depleted from the extracellular medium, or when the cells were incubated with inhibitors for heterotrimeric G i/G o proteins, phospholipase C, classical protein kinase C isoforms (cPKC), mitogen-activated protein kinase kinase (MEK), or PLA 2, the blocking of the signal-mediated motility was suppressed [16]. HUE cells grown to confluence on microporous membranes respond in a similar manner to the ATP–LPA receptor costimulation, that is only when the ligands had access to the basolateral membrane region [16]. These data indicate that peroxisomal motility is subject to specific modulation from the
260
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
extracellular environment and further suggest that a receptor-mediated signaling cascade (consisting of Ca 2⫹ influx, G i/G o proteins, phospholipase C, cPKC isoforms, MEK, and PLA 2) is involved in the regulation of peroxisomal arrest. There is a new type of regulation of organelle motility mediated by a G i/G o phospholipase A 2 that has not been observed so far with other cell organelles. It has been shown that peroxisomes (microperoxisomes) of neuronal cells are present in cell bodies, axons, dendrites, and presynaptic axon terminals [17– 20]. However, they did not mention the localization of peroxisomes in growing neurites. If peroxisomes localize in growth cones, they must play important roles in them, because growth cones play a role as guidance cues [21]. We have no knowledge about the movements of peroxisomes in living neurites. The transport of organelles in neurites is considered essential for neural activities. We studied the localization and movement of peroxisomes in neurites of cultured PC12D cells using an enhanced green fluorescent protein (EGFP) fused with a C-terminal peroxisomal targeting signal 1 (SKL motif), namely EGFP-SKL.
261
using a Texas red filter set (Nikon). In this case, the cells were fixed for 3 h in 4% (wt/vol) paraformaldehyde in PBS. Electron microscopy. PC12D cells were cultured in the G-DMEM with 50 ng/ml NGF for 2 days and fixed with 2.5% glutaraldehyde in 1/15 M phosphate buffer (pH 7.4) for 1 h. They were washed with PBS and incubated in 3,3⬘-diaminobenzidine (DAB) medium for 1 h. The DAB medium was prepared by dissolving one DAB tablet (DAB 4HCl 5 mg/tablet; Wako Pure Chemical Ind., Japan) in 25 ml of 50 mM Tris–HCl (pH 9.5) and then adding 5 l 30% H 2O 2. Cells were then rinsed several times in PBS. Cells were treated with 1% OsO 4 in 1/15 M phosphate buffer (pH 7.4) for 30 min, rinsed again in PBS, and dehydrated in a graded ethanol series and embedded in Luveak812 (Nacalai Tesque, Japan). Ultrathin sections were stained with lead citrate and examined using a Hitachi H-7100 electron microscopy. Living cell imaging. For studies involving the detection of EGFP in living cells using an inverted fluorescence microscope, PC12D cells were cultured on 35-mm glass-bottom microwell dishes (Matsunami Glass Ind., Ltd., Japan) in the presence of 50 ng/ml NGF. To stabilize the pH, 10 mM Hepes (pH 7.5) was added to the culture medium. A fluorescence microscope (IX70; Olympus, Japan) equipped with a cooled CCD camera (CoolSNAP/OL; Olympus) and a shutter (SHUTTER-TTL-25 mm; Olympus) was used in these imaging experiments. The observations were made at 25°C and the EGFP-expressing cells monitored at 5-s intervals. Time-lapse digital images were taken and analyzed with the program Lumina Vision ( version; Mitani Corp., Japan) running on a Power Macintosh G3 computer. Suitable images were cut out from the time-lapse digital images and presented as figures.
MATERIALS AND METHODS Cell culture. Cultures of PC12D cells were maintained on 60mm-diameter culture dishes at 37°C in a water-saturated atmosphere of 95% air and 5% CO 2. Cells were grown in high-glucose DMEM (Gibco BRL, NY) supplemented with 5% fetal calf serum (Gibco BRL), 10% horse serum (Gibco BRL), and 50 ng/ml NGF (mouse nerve growth factor 2.5S Grade I; Alomone Laboratories, Israel). EGFP-SKL expression plasmid. The EGFP-containing plasmid pEGFP-C1 (Clontech, CA) was used for the formation of the EGFPSKL expression plasmid. The oligonucleotide CCTTGTACAAGAGCAAGCTGTGATCTAGAGC and the reverse oligonucleotide GCTCTAGATCACAGCTTGCTCTTGTACAAGG were annealed and digested with BsrGI and XbaI (serine-lysine-leucine-stop codon shown in bold; BsrGI (TGTACA) and XbaI (TCTAGA) sites are in italic). These fragments were cloned in the BsrGI and XbaI site of the pEGFP-C1 vector, yielding the plasmid pEGFP-SKL. Transient transfections. PC12D cells at 50% confluence were transfected with pEGFP-SKL using the Lipofectin reagent (Gibco BRL), as described in the product manual. The cells were replaced and incubated for 48 h with high-glucose DMEM supplemented with 5% fetal calf serum, 10% horse serum (G-DMEM), and 50 ng/ml NGF. Instead of NGF, 50 nM staurosporine (Sigma Chemical, MO), 10 M forskolin (Research Biochemicals International, MA), or 1 mM dibutyryl cAMP (dbcAMP) (Sigma Chemical) were also used for some experiments as the other neurite extension reagents. Fluorescence microscopy. PC12D cells were cultured on poly-Llysine-treated 13.5-mm LF1 cell disks (Sumitomo Bakelite, Japan) in a 24-well multiplate (Corning, NY) in the presence of 50 ng/ml NGF. Cells were fixed for 20 min in 4% (wt/vol) paraformaldehyde (Nacalai Tesque, Japan) in PBS and washed three times with PBS. Cell disks were mounted on microscope slides in 90% glycerol containing PBS. The EGFP fluorescent pattern was observed using a fluorescence microscope (Eclipse E600, Nikon, Japan) equipped with a GFP filter set (Nikon). The fluorescent pattern of Texas red-labeled phalloidin (Molecular Probes, OR) was observed using the same microscope
RESULTS
EGFP-SKL protein targeted to the peroxisomes of PC12D cells. A cDNA encoding the EGFP-SKL was constructed in the pEGFP-C1 vector under control of the CMV promoter/enhancer (Fig. 1A), yielding the plasmid pEGFP-SKL. After transfection to PC12D cells with pEGFP-SKL, punctate fluorescent signals were detected (Fig. 1C), and the fluorescent EGFP-SKL proteins were observed in peroxisomes in the cell body as also has been reported previously [14, 15, 22]. Many peroxisomes were observed in the compact cytosolic space of PC12D cells. Many peroxisomes observed in the neurites of PC12D cells. To determine whether peroxisomes were localized in neurites, PC12D cells were treated with NGF, which is known to differentiate PC12D cells and to extend the neurites of these cells. After transfection of pEGFP-SKL, the PC12D cells were cultured for 2 days in the presence of NGF. Upon treatment with NGF, neurites were extended (Figs. 2A and 2C) and the fluorescence of EGFP-SKL protein was detected in the neurites along with the cell body as many punctate fluorescent signals, showing the localization in the peroxisomes (Figs. 2B and 2D). Peroxisomes existed in every part of the neurites, although they were more intense in the thick parts. Many peroxisomes were localized at the distal ends of neurites (large arrowheads), varicosities (small arrowheads), and branch points (arrows). Three peroxisomes were shown in a
262
ISHIKAWA ET AL.
FIG. 1. EGFP-SKL expression construct and subcellular localization of EGFP-SKL in PC12D cells. (A) EGFP-SKL was controlled by the human cytomegalovirus intermediate-early promoter/enhancer (CMV). SV40 polyA signal, SV40 polyadenylation signal; P SV40 promoter; SV40 ori, SV40 origin; Kan r/Neo r, kanamycin/neomycin resistance gene; HSV TK polyA signal, polyadenylation signal from herpes simplex thymidine kinase; pUC ori, pUC19 origin of replication for propagation in Escherichia coli; f1 ori, f1 origin for singlestranded DNA replication. Phase-contrast image (B) corresponds to fluorescence image (C). PC12D cells cultured on cell disks. In the 48 h of transfection with pEGFP-SKL (no addition of NGF), the cells expressed the EGFP-SKL protein localized in the peroxisomes as punctate fluorescent signals (C). Bar represents 20 m.
neural terminal-like structure (Figs. 2A and 2B asterisks), while only a few peroxisomes existed in short neurites (Figs. 2A and 2B). Effects of neurite extension reagents on peroxisomes localization in neurites. To investigate whether localization of peroxisomes in neurites was a response to neurite extension or a direct effect of NGF, neurite outgrowth was also induced by other reagents, i.e., dbcAMP, forskolin, and staurosporine, which are well known as neurite outgrowth reagents in PC12D cells [23, 24]. DbcAMP, forskolin, and staurosporine could extend neurites as did NGF (Figs. 3A, 3C, and 3E). By addition of dbcAMP, peroxisomes were localized in the neurites of PC12D cells (Fig. 3B), and many peroxisomes localized at the distal ends of neurites (arrowheads). In the case of forskolin and staurosporine, many peroxisomes were also located in neurites (Figs. 3D and 3F). By treatment with staurosporine, peroxi-
somes were seen in the big distal ends of neurites (arrowheads). Most distal ends of neurites were considered to be growth cones. These results suggest that localization of peroxisomes in neurites is caused by the neurite extension and not a direct effect of NGF. Peroxisomes localized in neurites of PC12D cells cultured with NGF as a function of time. PC12D cells cultured with NGF for 1 day extended short neurites (Fig. 4A), which neurites already included peroxisomes (Fig. 4B). Peroxisomes were thought to be localized in neurites in the exceedingly early stage. After 5 days culture with NGF, long neurites were formed (Fig. 4C). In these long neurites, many peroxisomes were shown to be linearly arranged (Fig. 4D). These results suggest that peroxisomes exert some essential function for the extension and the maintenance of neurites in PC12D cells. Peroxisomes localized in neural terminal-like structures and growth cones. In Figs. 2 and 5, peroxisomes were shown in neuronal terminal-like structures. One neural terminal-like structure was shown to be attached to a cell body (Figs. 5A and 5B, arrowheads). In Figs. 2A and 2B (asterisks), three peroxisomes were also observed in neural terminal-like structure. The other terminal-like structure was shown to be attached to neurites (Figs. 5A and 5B, arrow). This structure probably occurs at the thick branch point of a neurite. Figure 5C represents electron microscopy imaging of a neural terminal-structure. The distal end of the neurite was ampullaceous and attached to a cell body. When the cells were stained with DAB, the dense reaction product clearly distinguished the peroxisomes from other organelles. Many peroxisomes localized in the neural terminal-like structure, and a few peroxisomes existed in the cell body. In general, peroxisomes were more frequently localized in neuronal terminallike structures than in the neural arbor in PC12D cells. Peroxisomes were close to or within the growth cones of the neurites of PC12D cells as shown in Fig. 2 (large arrowheads) and Fig. 3 (arrowheads). Peroxisome localization to a growth cone was examined. Figure 6A shows double staining of peroxisomes and F-actin. EGFP-SKL-positive peroxisomes as punctate fluorescent signals were observed in the growth cone, which was identified by staining of F-actin with Texas redlabeled phalloidin [25]. The end-free F-actin construct in Fig. 6A revealed that this ampullaceous structure is a growth cone. There were many peroxisomes in this growth cone with green fluorescence. This observation was further confirmed by electron microscopy (Fig. 6B). Many peroxisomes also existed in the growth cone as DAB-positive organelles. The growth cones in Fig. 6 were active, since all of the filopodias were spread enough (arrowheads). These peroxisomes, therefore, may have some important roles in growing neurites.
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
263
FIG. 2. Effect of NGF on the localization of peroxisomes in PC12D cells. After the transfection of pEGFP-SKL, cells were treated with 50 ng/ml NGF for 2 days. Phase-contrast image (A) corresponds to fluorescence image (B), and phase contrast (C) corresponds to (D). Large arrowheads, small arrowheads, arrows, and asterisks indicate distal ends of neurites (presumably growth cones), varicosities, branch points, and presynaptic terminal-like structures, respectively. The fluorescence of peroxisomes of cell bodies displayed halation. Bars represent 20 m.
Analysis of peroxisomal dynamics. The movement of a single peroxisome in neurites of PC12D cells was studied by time-lapse high-resolution fluorescence microscopy. In the cell body, almost all peroxisomes moved randomly in a small limited area with sudden saltation or arrest (data not shown). Most peroxisomes in the neurites were also oscillating with some peroxisomes moving fast in one direction. Figure 7 shows peroxisomes tracked over four consecutive frames taken at 4.8-s intervals. Figure 7A represents a peroxisome (arrow) moving by anterograde transport in the direction from a cell body to a growth cone. The anterograde transport was calculated at an average velocity of 0.21 m/s measured over a distance of 7.2 m. The peak velocity from frame 001 to 004 was 0.29 m/s over 1.38 m (frames 001 and 002). In Fig. 7B two peroxisomes are shown to move retrogradely in the direction from a growth cone to the cell body. The retrograde movement (large arrow) was calculated at an average velocity of 0.16 m/s measured over a distance of 3.8 m. The peak velocity from frame 001 to 004 was 0.21 m/s over 1.1 m (frames 001 and 002). The average velocity of the anterograde transport was 0.18 ⫾ 0.042 m/s (n ⫽ 3) and exhibited variations ranging between 0.13 and 0.21 m/s. The peak velocity and distance of anterograde transport ranged from 0.15 to 0.48 m/s
and 1.8 to 7.2 m, respectively. The average velocity of the retrograde transports was 0.16 ⫾ 0.033 m/s (n ⫽ 5) and exhibited variations ranging between 0.11 and 0.20 m/s. The fastest speed of peak velocity of retrograde transport in 5 s was 0.25 m/s. The peak velocity and the distance of retrograde transports ranged from 0.15 to 0.25 m/s and 1.1 to 4 m, respectively. Peroxisomes seemed to move in neurites according to an anterograde transport to localize in growth cones and neural terminal-like structures and subsequently return to the cell bodies by a retrograde transport. DISCUSSION
Localization of peroxisomes in neurites of PC12D cells. PC12D cells, in which neurites extend within 24 h in response to cAMP-enhancing reagents such as NGF, are a subline of PC12 cells. This cell line was found appropriate to elucidate the behavior of peroxisomes fluorescently stained by GFP in neurites extending in response to NGF. After the PC12D cells were transfected with pEGFP-SKL and treated with NGF for 2 days, peroxisomes were detected in both the cell bodies and the neurites as punctate green fluorescent signals. Without NGF, neurites were not extruded and peroxisomes were detected in the cell bodies. After
264
ISHIKAWA ET AL.
FIG. 3. Effect of dbcAMP, forskolin, and staurosporine on the localization of peroxisomes in PC12D cells. After the transfection of pEGFP-SKL, cells were treated with 1 mM dbcAMP (A, B), 10 M forskolin (C, D), or 50 nM staurosporine (E, F) for 2 days. Phase-contrast images A, C, and E correspond to fluorescence images B, D, and F, respectively. Arrowheads indicate growth cones. Bars represent 20 m.
addition of NGF, many peroxisomes in neurites were found. This finding is consistent with reports showing the presence of peroxisomes in neural processes and in the astrocytic processes [19, 26]. However, peroxisomes in neurites were mostly found in the thicker parts at varicosities, branch points, and close to or within growth cones. Varicosity has a possible function of exocytosis [27, 28], suggesting an active metabolic process with some correlation of peroxisomes. As indicated in Fig. 6, peroxisomes existed in the growth cones that were active, since filopodia were well developed. Growth cones play very important roles as guidance cues [21]. Therefore, peroxisomes may have some roles in varicosities and growth cones. Peroxisomes were also present in neural terminal-like structures (Figs. 2A and 2B, asterisks, and Figs. 5A and 5B). This observation is consistent with the presence of peroxisomes in the nerve terminal [18] and in the presynaptic axon terminal [20]. The presence of peroxisomes in growth cones, varicosities, and neuronal terminal-like
structures suggests their importance in the development or maintenance of neurites. In hippocampal neurons, peroxisomes are present in axons more than in dendrites [29]. It was consistent to find peroxisomes in neurites of PC12D cells since neurites of PC12D cells behave like axons. Many peroxisomes were found in long neurites with growth cones in PC12D cells cultured with NGF for 2 days (Fig. 2), while only a few peroxisomes were found in short neurites (Figs. 2A and 2B). These short neurites may be at rest, since no growth cone-like structures were observed on them. Therefore, localization of peroxisomes in neurites may be related to the metabolic or extending activity of neurites. In cultures of PC12D cells, treatment with NGF for 1 day elicited the formation of short neurites. And even in these short ones, peroxisomes obviously existed. After culture for 5 days with NGF, many peroxisomes were observed in very long neurites. These observations suggest that peroxisomes possibly relate to the
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
265
PC12D cells treated with these reagents, peroxisomes were also localized in extended neurites. Therefore, localization of peroxisomes in neurites was not considered a direct effect of NGF, but the localization might be related to the stimulation of outgrowth of neurites.
FIG. 4. PC12D cells transfected with pEGFP-SKL and treated with NGF for 1 day (A, B) and 5 days (C, D). The punctate fluorescent signals of EGFP-SKL were detected as peroxisomes. Phase-contrast image (A) corresponds to fluorescence image (B), and phase contrast (C) corresponds to (D). Bars represent 20 m.
outgrowth or maintenance of neurites. We were interested in whether the peroxisome localization in neurites was the direct effect of NGF. DbcAMP, forskolin, and staurosporine were used instead of NGF, since dbcAMP is a membrane-permeable analog of cAMP and forskolin is an adenylate cyclase activator. These compounds and staurosporine are potent promoters of neurite outgrowth in the PC12 cell variant [24]. In
FIG. 5. Relationship between peroxisomes and neural terminallike structures. (A, B) After transfection with pEGFP-SKL, cells were treated with 50 nM staurosporine for 2 days. Phase-contrast image (A) corresponds to fluorescence image (B). Arrow and arrowhead indicate neural terminal-like structures. Bar represents 20 m. (C) Electron microscopy imaging of neural terminal-like structure is shown. Typical DAB-positive peroxisomes are indicated by arrows. N and CB represent neurite and cell body, respectively. Bar represents 1 m.
266
ISHIKAWA ET AL.
FIG. 6. Relationship between peroxisomes and growth cone. (A) Double-fluorescence imaging of PC12D cells expressing EGFP-SKL in peroxisomes (green) and staining of Texas red-labeled phalloidin associated with F-actin (red). Arrowheads indicate filopodia. Bar represents 20 m. (B) Electron microscopy imaging of growth cone is shown. Typical DAB-positive peroxisomes are indicated by arrows. Arrowheads indicate filopodia. Bar represents 1 m.
Peroxisomal motility in neurites of PC12D cells. Many peroxisomes were observed in neurites of PC12D cells, although their transport mechanism is not yet understood. The peroxisomal movement in cell bodies and neurites of PC12D cells was studied using timelapse high-resolution fluorescence microscopy. Almost all peroxisomes in the cell bodies randomly oscillated in a small limited area with occasionally sudden saltation or arrest (data not shown). A similar peroxisomal behavior has been found in CHO cells [13] and CV1 cells [14]. Most peroxisomes in the neurites were found to oscillate or arrest, although some peroxisomes moved fast in one direction. The average velocities of anterograde transports ranged from 0.13 to 0.21 m/s at 25°C. It is claimed that the average velocity is more than 0.05 m/s at the saltation state of peroxisomes in CV1 cells [14]. The speeds of analyzed samples were over 0.05 m/s. The maximum velocities ranged from 0.15 to 0.48 m/s in the anterograde transport in this report. It is claimed that the maximum velocity is more
than 0.2 m/s at the saltation state of peroxisomes in CV1 cells [14]. The lower speed example, however, might be ascribed to the lower experimental temperature in this investigation, 25°C. Therefore, the found peroxisomal movements are considered to be saltations [13, 14]. The average velocity of retrograde transport ranged from 0.11 to 0.17 m/s at 25°C and the maximum velocity of retrograde transport ranged from 0.15 to 0.25 m/s. This movement is also considered to be a saltation [13, 14]. We therefore conclude that the fast movements of peroxisomes in the neurites of PC12D cells are saltations. Cell organelles move along cytoskeletal tracks and are driven by microtubule- or actin-based motor enzymes [30 –32]. Evidence from various different cell types has demonstrated that movements of the Golgi apparatus [33], endoplasmic reticulum [34], lysosomes [35], mitochondria [36], and intracellular transport vesicles [37] are all microtubule dependent. Two microtubule-associated motor protein families, kinesins and cytoplasmic dyneins, have been well characterized. These motor proteins generate movements at the expense of ATP hydrolysis. Kinesins are involved in both so-called minus- and plus-end-directed movements on the microtubules, as has been described [38, 39]. Dyneins are involved in the general intracellular movement toward the minus end of microtubule [40]. For mitochondrial movements, the microtubules act as an important cytoskeletal track and the kinesin homologs, i.e., KIF1B and KIF5B, are involved as the motor proteins [41, 42]. KIF1B is expressed abundantly in differentiated nerve cells [41]. Kinesin-related proteins on synaptic vesicles, KIF1A in mouse [43] and UNC104 in Caenorhabditis elegans [44], are involved in anterograde axonal transport as microtubule-based motors. KIF2, an alternative spliced isoform of the KIF2 as a neural kinesin, is responsible for the peripheral translocation of lysosomes [45]. The KIF1B-specific mitochondrial movement along microtubules has been observed in vitro at a maximum velocity of 0.5 m/s [41] and is consistent with the orthograde velocities of mitochondrial transports reported previously (0.23–1.12 m/s) [8, 46 – 48]. The velocity analysis strongly suggests that KIF1B is involved in the anterograde translocation of mitochondria. To our knowledge, peroxisomal motor proteins have not yet been reported. However, the maximum velocity of the peroxisomal anterograde transport (0.48 m/s at 25°C) is close to that of mitochondrial transports, suggesting that a specific kinesin homolog for peroxisomes is present in neural cells and that this homolog transports peroxisomes anterogradely in neurites. Our observations suggest the following hypothesis about peroxisomal movement in neurites (Fig. 8). Peroxisomes occurs via endoplasmic reticulum [49], that is to say, peroxisomes are formed in the cell body. Per-
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
267
FIG. 7. Time-lapse motion analysis of the dynamics of peroxisomes in living PC12D cells expressing EGFP-SKL. (A) Peroxisome anterograde transport in the direction from the cell body to the growth cone. (B) Peroxisome retrograde transport in the direction from the growth cone to the cell body. Four consecutive frames (001– 004) were taken at 5-s intervals. Neurites are shown by broken lines. Arrowheads represent direction of distal neurites. Peroxisomes indicated with arrows show rapid movement in one direction. Big arrows indicate peroxisomes which were moved though four consecutive frames (A, B). Small arrow indicates peroxisomes moved from the second frame (B). Bars represent 10 m. FIG. 8. A model of peroxisome transport from cell body to growth cone. Peroxisomes which are formed in the cell body move to the growth cone via varicosity by an anterograde transport. In this place, peroxisomes play some important role and then return to the cell body by a retrograde transport. During transportation, peroxisomes are saltating and/or oscillating repeatedly.
oxisomes in the cell body move to growth cones and neural terminals via varicosities by an anterograde transport. Peroxisomes play some role in these parts and subsequently return to the cell bodies by a retro-
grade transport. Through transportation, peroxisomes are carried by saltation and sometimes pause by oscillation or arrest. Therefore, it is thought that peroxisomes are localized constantly but replaced freshly in
268
ISHIKAWA ET AL.
growth cones through development of neurites. What functions do peroxisomes play in neurites? What kinds of motor proteins participate in peroxisomal transport in neurites? Many questions are, however, to be solved. We thank technical assistants Kenzo Uehira and Taiji Suda, Electron Microscopy Center, Kawasaki Medical School, for the electron microscopy. This work was supported by a Research Project Grant from Kawasaki Medical School (No. 11-703).
REFERENCES 1.
2. 3.
4.
5.
6. 7.
8.
9.
10.
11.
12.
13.
14.
15.
Van den Bosch, H., Schutgens, R. B., Wanders, R. J., and Tager, J. M. (1992). Biochemistry of peroxisomes. Annu. Rev. Biochem. 61, 157–197. Lasarow, P. B., and Moser, H. W. (1995). “Disorders of Peroxisome Biogenesis,” pp. 2287–2324, McGraw–Hill, New York. Goldfischer, S., Moore, C. L., Johnson, A. B., Spiro, A. J., Valsamis, M. P., Wisniewski, H. K., Ritch, R. H., Norton, W. T., Rapin, I., and Gartner, L. M. (1973). Peroxisomal and mitochondrial defects in the cerebro-hepato-renal syndrome. Science 182, 62– 64. Bowen, P., Lee, C. S. N., Zellweger, H., and Lindenberg, R. (1964). A familial syndrome of multiple congenital defects. Bull. Johns Hopkins Hosp. 114, 402– 414. Opitz, J. M., ZuRhein, G. M., Vitale, L., Shahidi, N. T., Howe, J. J., Chou, S. M., Shanklin, D. R., Sybers, H. D., Dood, A. R., and Gerritsen, T. (1969). The Zellweger syndrome (cerebrohepato-renal syndrome). Birth Defects. V, 144 –160. Moser, H. W. (1997). Adrenoleukodystrophy: Phenotype, genetics, pathogenesis and therapy. Brain 120, 1485–1508. Cole, N. B., and Lippincott Schwartz, J. (1995). Organization of organelles and membrane traffic by microtubules. Curr. Opin. Cell Biol. 7, 55– 64. Forman, D. S., Lynch, K. J., and Smith, R. S. (1987). Organelle dynamics in lobster axons: Anterograde, retrograde and stationary mitochondria. Brain Res. 412, 96 –106. Murphy, C., Saffrich, R., Grummt, M., Gournier, H., Rybin, V., Rubino, M., Auvinen, P., Lutcke, A., Parton, R. G., and Zerial, M. (1996). Endosome dynamics regulated by a Rho protein. Nature 384, 427– 432. Nilsson, H., and Wallin, M. (1997). Evidence for several roles of dynein in pigment transport in melanophores. Cell Motil. Cytoskeleton 38, 397– 409. Wacker, I., Kaether, C., Kromer, A., Migala, A., Almers, W., and Gerdes, H. H. (1997). Microtubule-dependent transport of secretory vesicles visualized in real time with a GFP-tagged secretory protein. J. Cell Sci. 110, 1453–1463. Rodionov, V. I., Hope, A. J., Svitkina, T. M., and Borisy, G. G. (1998). Functional coordination of microtubule-based and actinbased motility in melanophores. Curr. Biol. 8, 165–168. Rapp, S., Saffrich, R., Anton, M., Jakle, U., Ansorge, W., Gorgas, K., and Just, W. W. (1996). Microtubule-based peroxisome movement. J. Cell Sci. 109, 837– 849. Wiemer, E. A., Wenzel, T., Deerinck, T. J., Ellisman, M. H., and Subramani, S. (1997). Visualization of the peroxisomal compartment in living mammalian cells: Dynamic behavior and association with microtubules. J. Cell Biol. 136, 71– 80. Huber, C., Saffrich, R., Anton, M., Passrciter, M., Ansorge, W., Gorgas, K., and Just, W. (1997). A heterotrimeric G protein– phospholipase A2 signaling cascade is involved in the regulation of peroxisomal motility in CHO cells. J. Cell Sci. 110, 2955–2968.
16.
17. 18. 19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30. 31. 32.
33.
34.
35.
Huber, C., Saffrich, R., Ansorge, W., and Just, W. (1999). Receptor-mediated regulation of peroxisomal motility in CHO and endothelial cells. EMBO J. 18, 5476 –5485. Citkowitz, E., and Holtzman, E. (1973). Peroxisomes in dorsal root ganglia. J. Histochem. Cytochem. 21, 34 – 41. Arnold, G., and Holtzman, E. (1975). Peroxisomes in rat sympathetic ganglia and adrenal medulla. Brain Res. 83, 509 –515. McKenna, O., Arnold, G., and Holtzman, E. (1976). Microperoxisome distribution in the central nervous system of the rat. Brain Res. 117, 181–194. Arnold, G., and Holtzman, E. (1978). Microperoxisomes in the central nervous system of the postnatal rat. Brain Res. 155, 1–17. Mueller, B. K. (1999). Growth cone guidance: First steps towards a deeper understanding. Annu. Rev. Neurosci. 22, 351– 388. Kalish, J. E., Keller, G. A., Morrell, J. C., Mihalik, S. J., Smith, B., Cregg, J. M., and Gould, S. J. (1996). Characterization of a novel component of the peroxisomal protein import apparatus using fluorescent peroxisomal proteins. EMBO J. 15, 3275– 3285. Katoh Semba, R., Kitajima, S., Yamazaki, Y., and Sano, M. (1987). Neuritic growth from a new subline of PC12 pheochromocytoma cells: Cyclic AMP mimics the action of nerve growth factor. J. Neurosci. Res. 17, 36 – 44. Sano, M., Iwanaga, M., Fujisawa, H., Nagahama, M., and Yamazaki, Y. (1994). Staurosporine induces the outgrowth of neurites from the dorsal root ganglion of the chick embryo and PC12D cells. Brain Res. 639, 115–124. Sano, M., and Iwanaga, M. (1992). Requirement for specific protein kinase activities during the rapid redistribution of Factin that precedes the outgrowth of neurites in PC12D cells. Cell Struct. Funct. 17, 341–350. Arnold, G., Liscum, L., and Holtzman, E. (1979). Ultrastructural localization of D-amino acid oxidase in microperoxisomes of the rat nervous system. J. Histochem. Cytochem. 27, 735– 745. Brain, K. L., Cottee, L. J., and Bennett, M. R. (1997). Varicosities of single sympathetic nerve terminals possess syntaxin zones and different synaptotagmin N-terminus labelling following stimulation. J. Neurocytol. 26, 491–500. Zerby, S. E., and Ewing, A. G. (1996). Electrochemical monitoring of individual exocytotic events from the varicosities of differentiated PC12 cells. Brain Res. 712, 1–10. Bradke, F., and Dotti, C. G. (1997). Neuronal polarity: Vectorial cytoplasmic flow precedes axon formation. Neuron 19, 1175– 1186. Schliwa, M. (1984). Mechanisms of intracellular organelle transport. Cell Muscle Motil. 5, 1– 82. Walker, R. A., and Sheetz, M. P. (1993). Cytoplasmic microtubule-associated motors. Annu. Rev. Biochem. 62, 429 – 451. Langford, G. M. (1995). Actin- and microtubule-dependent organelle motors: Interrelationships between the two motility systems. Curr. Opin. Cell Biol. 7, 82– 88. Ho, W. C., Allan, V. J., van Meer, G., Berger, E. G., and Kreis, T. E. (1989). Reclustering of scattered Golgi elements occurs along microtubules. Eur. J. Cell Biol. 48, 250 –263. Terasaki, M., Chen, L. B., and Fujiwara, K. (1986). Microtubules and the endoplasmic reticulum are highly interdependent structures. J. Cell Biol. 103, 1557–1568. Hollenbeck, P. J., and Swanson, J. A. (1990). Radial extension of macrophage tubular lysosomes supported by kinesin. Nature 346, 864 – 866.
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES 36.
37. 38.
39.
40.
41.
42.
43.
Morris, R. L., and Hollenbeck, P. J. (1995). Axonal transport of mitochondria along microtubules and F-actin in living vertebrate neurons. J. Cell Biol. 131, 1315–1326. Allan, V. (1994). Organelle movement. Dynactin: Portrait of a dynein regulator. Curr. Biol. 4, 1000 –1002. Vale, R. D., Reese, T. S., and Sheetz, M. P. (1985). Identification of a novel force-generating protein, kinesin, involved in microtubule-based motility. Cell 42, 39 –50. McDonald, H. B., Stewart, R. J., and Goldstein, L. S. (1990). The kinesin-like ncd protein of Drosophila is a minus enddirected microtubule motor. Cell 63, 1159 –1165. Holzbaur, E. L., and Vallee, R. B. (1994). DYNEINS: Molecular structure and cellular function. Annu. Rev. Cell Biol. 10, 339 – 372. Nangaku, M., Sato Yoshitake, R., Okada, Y., Noda, Y., Takemura, R., Yamazaki, H., and Hirokawa, N. (1994). KIF1B, a novel microtubule plus end-directed monomeric motor protein for transport of mitochondria. Cell 79, 1209 –1220. Tanaka, Y., Kanai, Y., Okada, Y., Nonaka, S., Takeda, S., Harada, A., and Hirokawa, N. (1998). Targeted disruption of mouse conventional kinesin heavy chain, kif5B, results in abnormal perinuclear clustering of mitochondria. Cell 93, 1147– 1158. Okada, Y., Yamazaki, H., Sekine Aizawa, Y., and Hirokawa, N. (1995). The neuron-specific kinesin superfamily protein KIF1A
Received March 14, 2001
44.
45.
46.
47.
48.
49.
269
is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell 81, 769 –780. Hall, D. H., and Hedgecock, E. M. (1991). Kinesin-related gene unc-104 is required for axonal transport of synaptic vesicles in C. elegans. Cell 65, 837– 847. Santama, N., Krijnse Locker, J., Griffiths, G., Noda, Y., Hirokawa, N., and Dotti, C. G. (1998). KIF2beta, a new kinesin superfamily protein in non-neuronal cells, is associated with lysosomes and may be implicated in their centrifugal translocation. EMBO J. 17, 5855–5867. Partlow, L. M., Ross, C. D., Motwani, R., and McDougal, D. B. J. (1972). Transport of axonal enzymes in surviving segments of frog sciatic nerve. J. Gen. Physiol. 60, 388 – 405. Lorenz, T., and Willard, M. (1978). Subcellular fractionation of intra-axonally transported polypeptides in the rabbit visual system. Proc. Natl. Acad. Sci. USA 75, 505–509. Allen, R. D., Weiss, D. G., Hayden, J. H., Brown, D. T., Fujiwake, H., and Simpson, M. (1985). Gliding movement of and bidirectional transport along single native microtubules from squid axoplasm: Evidence for an active role of microtubules in cytoplasmic transport. J. Cell Biol. 100, 1736 –1752. Titorenko, V. I., and Rachubinski, R. A. (1998). Mutants of the yeast Yarrowia lipolytica defective in protein exit from the endoplasmic reticulum are also defective in peroxisome biogenesis. Mol. Cell Biol. 18, 2789 –2803.
Peroxisomes Exist in Growth Cones and Move Anterogradely and Retrogradely in Neurites of PC12D Cells Tetsuya Ishikawa,* ,1 Chikage Kawai,* Mamoru Sano,† and Yohsuke Minatogawa* *Department of Biochemistry, Kawasaki Medical School, 577 Matsushima, Kurashiki, Okayama 701-0192, Japan; and †Department of Biology, Kyoto Prefectural University of Medicine, 13 Taishogun kitaku, Kyoto, Kyoto 603-8334, Japan
Localization and movement of peroxisomes have been investigated in neurites of a subline of PC12 pheochromocytoma cells (PC12D cells). The cells were transfected with a construct encoding the green fluorescent protein and bearing the C-terminal peroxisomal targeting signal 1 SKL motif (-Ser-Lys-LeuCOOH). Peroxisomes were detected as green punctate fluorescent signals. Many peroxisomes were observed in neurites of PC12D cells, especially in neural terminal-like structures, growth cones, varicosities, and branch points. Growth cones containing many peroxisomes were active, since they extended several long filopodias. Existence of peroxisomes in growth cones and neuronal terminal-like structures suggests that peroxisomes might have some role in neuronal extension and nerve terminal functioning. Peroxisomal motility was analyzed by time-lapse imaging using a fluorescence microscope at 25°C. Peroxisomes were transported bidirectionally in neurites, i.e., through anterograde and retrograde transport. This result suggests that peroxisomes move to growth cones and neural terminals from the PC12D cell body, play some role in these parts, and go back to cell body. © 2001 Academic Press
Key Words: peroxisome; neurite; growth cone; motility; GFP; anterograde transport; retrograde transport.
INTRODUCTION
The mammalian peroxisome is a versatile and ubiquitous subcellular organelle involved in numerous catabolic and anabolic pathways involved in hydrogen peroxide metabolism such as the -oxidation of (very) long chain fatty acids and the biosynthesis of ether phospholipids [1]. Impaired biogenesis of peroxisomes results in a number of severe debilitating and often lethal diseases in human, showing the importance of the peroxisomal function for survival. In human, the failure to assemble normal peroxisomes results in a 1 To whom reprint requests should be addressed. Fax: ⫹81 86 462 1199. E-mail: [email protected].
0014-4827/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
group of genetically heterogeneous diseases known as peroxisome biogenesis disorders [2]. The Zellweger syndrome is a typical disease caused by a peroxisome biogenesis disorder [3] and presents with multiple malformations [4, 5] characterized by the absence of peroxisomes. Another name for the Zellweger syndrome is cerebrohepatorenal syndrome, having insufficient neurological maturation. But the essential roles of the peroxisomes in neuron growth are not well understood, except for the metabolism of very long chain fatty acids [6]. Many cellular organelles have been described as being motile [7] with shuttling in all directions [8 –12]. Peroxisomes in a cell body possess three distinct motility states, i.e., saltation, oscillation, and arrest [13– 16]. The motility state of a given peroxisome may change with time. In CHO cells, about 10 –20% of the entire peroxisome population are in saltation or arrest, assuming association of the organelles with the cytoskeleton, whereas 70% are thermally oscillating [13]. In CV1 cells, about 5% of the peroxisomes are in a saltation with peak velocities up to 0.75 m/s, and the others are oscillating [14]. The peroxisomal movements in CHO cells have been shown to be regulated by a signaling cascade involving a heterotrimeric G protein of the G i/G o class, phospholipase A 2 (PLA 2). Activation of these proteins followed by the release of arachidonic acid blocked peroxisomal movements [15]. Kinetic analysis by time-lapse imaging revealed that CHO cells respond to the simultaneous addition of ATP and lysophosphatidic acid (LPA) by reducing peroxisomal movements. When Ca 2⫹ was depleted from the extracellular medium, or when the cells were incubated with inhibitors for heterotrimeric G i/G o proteins, phospholipase C, classical protein kinase C isoforms (cPKC), mitogen-activated protein kinase kinase (MEK), or PLA 2, the blocking of the signal-mediated motility was suppressed [16]. HUE cells grown to confluence on microporous membranes respond in a similar manner to the ATP–LPA receptor costimulation, that is only when the ligands had access to the basolateral membrane region [16]. These data indicate that peroxisomal motility is subject to specific modulation from the
260
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
extracellular environment and further suggest that a receptor-mediated signaling cascade (consisting of Ca 2⫹ influx, G i/G o proteins, phospholipase C, cPKC isoforms, MEK, and PLA 2) is involved in the regulation of peroxisomal arrest. There is a new type of regulation of organelle motility mediated by a G i/G o phospholipase A 2 that has not been observed so far with other cell organelles. It has been shown that peroxisomes (microperoxisomes) of neuronal cells are present in cell bodies, axons, dendrites, and presynaptic axon terminals [17– 20]. However, they did not mention the localization of peroxisomes in growing neurites. If peroxisomes localize in growth cones, they must play important roles in them, because growth cones play a role as guidance cues [21]. We have no knowledge about the movements of peroxisomes in living neurites. The transport of organelles in neurites is considered essential for neural activities. We studied the localization and movement of peroxisomes in neurites of cultured PC12D cells using an enhanced green fluorescent protein (EGFP) fused with a C-terminal peroxisomal targeting signal 1 (SKL motif), namely EGFP-SKL.
261
using a Texas red filter set (Nikon). In this case, the cells were fixed for 3 h in 4% (wt/vol) paraformaldehyde in PBS. Electron microscopy. PC12D cells were cultured in the G-DMEM with 50 ng/ml NGF for 2 days and fixed with 2.5% glutaraldehyde in 1/15 M phosphate buffer (pH 7.4) for 1 h. They were washed with PBS and incubated in 3,3⬘-diaminobenzidine (DAB) medium for 1 h. The DAB medium was prepared by dissolving one DAB tablet (DAB 4HCl 5 mg/tablet; Wako Pure Chemical Ind., Japan) in 25 ml of 50 mM Tris–HCl (pH 9.5) and then adding 5 l 30% H 2O 2. Cells were then rinsed several times in PBS. Cells were treated with 1% OsO 4 in 1/15 M phosphate buffer (pH 7.4) for 30 min, rinsed again in PBS, and dehydrated in a graded ethanol series and embedded in Luveak812 (Nacalai Tesque, Japan). Ultrathin sections were stained with lead citrate and examined using a Hitachi H-7100 electron microscopy. Living cell imaging. For studies involving the detection of EGFP in living cells using an inverted fluorescence microscope, PC12D cells were cultured on 35-mm glass-bottom microwell dishes (Matsunami Glass Ind., Ltd., Japan) in the presence of 50 ng/ml NGF. To stabilize the pH, 10 mM Hepes (pH 7.5) was added to the culture medium. A fluorescence microscope (IX70; Olympus, Japan) equipped with a cooled CCD camera (CoolSNAP/OL; Olympus) and a shutter (SHUTTER-TTL-25 mm; Olympus) was used in these imaging experiments. The observations were made at 25°C and the EGFP-expressing cells monitored at 5-s intervals. Time-lapse digital images were taken and analyzed with the program Lumina Vision ( version; Mitani Corp., Japan) running on a Power Macintosh G3 computer. Suitable images were cut out from the time-lapse digital images and presented as figures.
MATERIALS AND METHODS Cell culture. Cultures of PC12D cells were maintained on 60mm-diameter culture dishes at 37°C in a water-saturated atmosphere of 95% air and 5% CO 2. Cells were grown in high-glucose DMEM (Gibco BRL, NY) supplemented with 5% fetal calf serum (Gibco BRL), 10% horse serum (Gibco BRL), and 50 ng/ml NGF (mouse nerve growth factor 2.5S Grade I; Alomone Laboratories, Israel). EGFP-SKL expression plasmid. The EGFP-containing plasmid pEGFP-C1 (Clontech, CA) was used for the formation of the EGFPSKL expression plasmid. The oligonucleotide CCTTGTACAAGAGCAAGCTGTGATCTAGAGC and the reverse oligonucleotide GCTCTAGATCACAGCTTGCTCTTGTACAAGG were annealed and digested with BsrGI and XbaI (serine-lysine-leucine-stop codon shown in bold; BsrGI (TGTACA) and XbaI (TCTAGA) sites are in italic). These fragments were cloned in the BsrGI and XbaI site of the pEGFP-C1 vector, yielding the plasmid pEGFP-SKL. Transient transfections. PC12D cells at 50% confluence were transfected with pEGFP-SKL using the Lipofectin reagent (Gibco BRL), as described in the product manual. The cells were replaced and incubated for 48 h with high-glucose DMEM supplemented with 5% fetal calf serum, 10% horse serum (G-DMEM), and 50 ng/ml NGF. Instead of NGF, 50 nM staurosporine (Sigma Chemical, MO), 10 M forskolin (Research Biochemicals International, MA), or 1 mM dibutyryl cAMP (dbcAMP) (Sigma Chemical) were also used for some experiments as the other neurite extension reagents. Fluorescence microscopy. PC12D cells were cultured on poly-Llysine-treated 13.5-mm LF1 cell disks (Sumitomo Bakelite, Japan) in a 24-well multiplate (Corning, NY) in the presence of 50 ng/ml NGF. Cells were fixed for 20 min in 4% (wt/vol) paraformaldehyde (Nacalai Tesque, Japan) in PBS and washed three times with PBS. Cell disks were mounted on microscope slides in 90% glycerol containing PBS. The EGFP fluorescent pattern was observed using a fluorescence microscope (Eclipse E600, Nikon, Japan) equipped with a GFP filter set (Nikon). The fluorescent pattern of Texas red-labeled phalloidin (Molecular Probes, OR) was observed using the same microscope
RESULTS
EGFP-SKL protein targeted to the peroxisomes of PC12D cells. A cDNA encoding the EGFP-SKL was constructed in the pEGFP-C1 vector under control of the CMV promoter/enhancer (Fig. 1A), yielding the plasmid pEGFP-SKL. After transfection to PC12D cells with pEGFP-SKL, punctate fluorescent signals were detected (Fig. 1C), and the fluorescent EGFP-SKL proteins were observed in peroxisomes in the cell body as also has been reported previously [14, 15, 22]. Many peroxisomes were observed in the compact cytosolic space of PC12D cells. Many peroxisomes observed in the neurites of PC12D cells. To determine whether peroxisomes were localized in neurites, PC12D cells were treated with NGF, which is known to differentiate PC12D cells and to extend the neurites of these cells. After transfection of pEGFP-SKL, the PC12D cells were cultured for 2 days in the presence of NGF. Upon treatment with NGF, neurites were extended (Figs. 2A and 2C) and the fluorescence of EGFP-SKL protein was detected in the neurites along with the cell body as many punctate fluorescent signals, showing the localization in the peroxisomes (Figs. 2B and 2D). Peroxisomes existed in every part of the neurites, although they were more intense in the thick parts. Many peroxisomes were localized at the distal ends of neurites (large arrowheads), varicosities (small arrowheads), and branch points (arrows). Three peroxisomes were shown in a
262
ISHIKAWA ET AL.
FIG. 1. EGFP-SKL expression construct and subcellular localization of EGFP-SKL in PC12D cells. (A) EGFP-SKL was controlled by the human cytomegalovirus intermediate-early promoter/enhancer (CMV). SV40 polyA signal, SV40 polyadenylation signal; P SV40 promoter; SV40 ori, SV40 origin; Kan r/Neo r, kanamycin/neomycin resistance gene; HSV TK polyA signal, polyadenylation signal from herpes simplex thymidine kinase; pUC ori, pUC19 origin of replication for propagation in Escherichia coli; f1 ori, f1 origin for singlestranded DNA replication. Phase-contrast image (B) corresponds to fluorescence image (C). PC12D cells cultured on cell disks. In the 48 h of transfection with pEGFP-SKL (no addition of NGF), the cells expressed the EGFP-SKL protein localized in the peroxisomes as punctate fluorescent signals (C). Bar represents 20 m.
neural terminal-like structure (Figs. 2A and 2B asterisks), while only a few peroxisomes existed in short neurites (Figs. 2A and 2B). Effects of neurite extension reagents on peroxisomes localization in neurites. To investigate whether localization of peroxisomes in neurites was a response to neurite extension or a direct effect of NGF, neurite outgrowth was also induced by other reagents, i.e., dbcAMP, forskolin, and staurosporine, which are well known as neurite outgrowth reagents in PC12D cells [23, 24]. DbcAMP, forskolin, and staurosporine could extend neurites as did NGF (Figs. 3A, 3C, and 3E). By addition of dbcAMP, peroxisomes were localized in the neurites of PC12D cells (Fig. 3B), and many peroxisomes localized at the distal ends of neurites (arrowheads). In the case of forskolin and staurosporine, many peroxisomes were also located in neurites (Figs. 3D and 3F). By treatment with staurosporine, peroxi-
somes were seen in the big distal ends of neurites (arrowheads). Most distal ends of neurites were considered to be growth cones. These results suggest that localization of peroxisomes in neurites is caused by the neurite extension and not a direct effect of NGF. Peroxisomes localized in neurites of PC12D cells cultured with NGF as a function of time. PC12D cells cultured with NGF for 1 day extended short neurites (Fig. 4A), which neurites already included peroxisomes (Fig. 4B). Peroxisomes were thought to be localized in neurites in the exceedingly early stage. After 5 days culture with NGF, long neurites were formed (Fig. 4C). In these long neurites, many peroxisomes were shown to be linearly arranged (Fig. 4D). These results suggest that peroxisomes exert some essential function for the extension and the maintenance of neurites in PC12D cells. Peroxisomes localized in neural terminal-like structures and growth cones. In Figs. 2 and 5, peroxisomes were shown in neuronal terminal-like structures. One neural terminal-like structure was shown to be attached to a cell body (Figs. 5A and 5B, arrowheads). In Figs. 2A and 2B (asterisks), three peroxisomes were also observed in neural terminal-like structure. The other terminal-like structure was shown to be attached to neurites (Figs. 5A and 5B, arrow). This structure probably occurs at the thick branch point of a neurite. Figure 5C represents electron microscopy imaging of a neural terminal-structure. The distal end of the neurite was ampullaceous and attached to a cell body. When the cells were stained with DAB, the dense reaction product clearly distinguished the peroxisomes from other organelles. Many peroxisomes localized in the neural terminal-like structure, and a few peroxisomes existed in the cell body. In general, peroxisomes were more frequently localized in neuronal terminallike structures than in the neural arbor in PC12D cells. Peroxisomes were close to or within the growth cones of the neurites of PC12D cells as shown in Fig. 2 (large arrowheads) and Fig. 3 (arrowheads). Peroxisome localization to a growth cone was examined. Figure 6A shows double staining of peroxisomes and F-actin. EGFP-SKL-positive peroxisomes as punctate fluorescent signals were observed in the growth cone, which was identified by staining of F-actin with Texas redlabeled phalloidin [25]. The end-free F-actin construct in Fig. 6A revealed that this ampullaceous structure is a growth cone. There were many peroxisomes in this growth cone with green fluorescence. This observation was further confirmed by electron microscopy (Fig. 6B). Many peroxisomes also existed in the growth cone as DAB-positive organelles. The growth cones in Fig. 6 were active, since all of the filopodias were spread enough (arrowheads). These peroxisomes, therefore, may have some important roles in growing neurites.
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
263
FIG. 2. Effect of NGF on the localization of peroxisomes in PC12D cells. After the transfection of pEGFP-SKL, cells were treated with 50 ng/ml NGF for 2 days. Phase-contrast image (A) corresponds to fluorescence image (B), and phase contrast (C) corresponds to (D). Large arrowheads, small arrowheads, arrows, and asterisks indicate distal ends of neurites (presumably growth cones), varicosities, branch points, and presynaptic terminal-like structures, respectively. The fluorescence of peroxisomes of cell bodies displayed halation. Bars represent 20 m.
Analysis of peroxisomal dynamics. The movement of a single peroxisome in neurites of PC12D cells was studied by time-lapse high-resolution fluorescence microscopy. In the cell body, almost all peroxisomes moved randomly in a small limited area with sudden saltation or arrest (data not shown). Most peroxisomes in the neurites were also oscillating with some peroxisomes moving fast in one direction. Figure 7 shows peroxisomes tracked over four consecutive frames taken at 4.8-s intervals. Figure 7A represents a peroxisome (arrow) moving by anterograde transport in the direction from a cell body to a growth cone. The anterograde transport was calculated at an average velocity of 0.21 m/s measured over a distance of 7.2 m. The peak velocity from frame 001 to 004 was 0.29 m/s over 1.38 m (frames 001 and 002). In Fig. 7B two peroxisomes are shown to move retrogradely in the direction from a growth cone to the cell body. The retrograde movement (large arrow) was calculated at an average velocity of 0.16 m/s measured over a distance of 3.8 m. The peak velocity from frame 001 to 004 was 0.21 m/s over 1.1 m (frames 001 and 002). The average velocity of the anterograde transport was 0.18 ⫾ 0.042 m/s (n ⫽ 3) and exhibited variations ranging between 0.13 and 0.21 m/s. The peak velocity and distance of anterograde transport ranged from 0.15 to 0.48 m/s
and 1.8 to 7.2 m, respectively. The average velocity of the retrograde transports was 0.16 ⫾ 0.033 m/s (n ⫽ 5) and exhibited variations ranging between 0.11 and 0.20 m/s. The fastest speed of peak velocity of retrograde transport in 5 s was 0.25 m/s. The peak velocity and the distance of retrograde transports ranged from 0.15 to 0.25 m/s and 1.1 to 4 m, respectively. Peroxisomes seemed to move in neurites according to an anterograde transport to localize in growth cones and neural terminal-like structures and subsequently return to the cell bodies by a retrograde transport. DISCUSSION
Localization of peroxisomes in neurites of PC12D cells. PC12D cells, in which neurites extend within 24 h in response to cAMP-enhancing reagents such as NGF, are a subline of PC12 cells. This cell line was found appropriate to elucidate the behavior of peroxisomes fluorescently stained by GFP in neurites extending in response to NGF. After the PC12D cells were transfected with pEGFP-SKL and treated with NGF for 2 days, peroxisomes were detected in both the cell bodies and the neurites as punctate green fluorescent signals. Without NGF, neurites were not extruded and peroxisomes were detected in the cell bodies. After
264
ISHIKAWA ET AL.
FIG. 3. Effect of dbcAMP, forskolin, and staurosporine on the localization of peroxisomes in PC12D cells. After the transfection of pEGFP-SKL, cells were treated with 1 mM dbcAMP (A, B), 10 M forskolin (C, D), or 50 nM staurosporine (E, F) for 2 days. Phase-contrast images A, C, and E correspond to fluorescence images B, D, and F, respectively. Arrowheads indicate growth cones. Bars represent 20 m.
addition of NGF, many peroxisomes in neurites were found. This finding is consistent with reports showing the presence of peroxisomes in neural processes and in the astrocytic processes [19, 26]. However, peroxisomes in neurites were mostly found in the thicker parts at varicosities, branch points, and close to or within growth cones. Varicosity has a possible function of exocytosis [27, 28], suggesting an active metabolic process with some correlation of peroxisomes. As indicated in Fig. 6, peroxisomes existed in the growth cones that were active, since filopodia were well developed. Growth cones play very important roles as guidance cues [21]. Therefore, peroxisomes may have some roles in varicosities and growth cones. Peroxisomes were also present in neural terminal-like structures (Figs. 2A and 2B, asterisks, and Figs. 5A and 5B). This observation is consistent with the presence of peroxisomes in the nerve terminal [18] and in the presynaptic axon terminal [20]. The presence of peroxisomes in growth cones, varicosities, and neuronal terminal-like
structures suggests their importance in the development or maintenance of neurites. In hippocampal neurons, peroxisomes are present in axons more than in dendrites [29]. It was consistent to find peroxisomes in neurites of PC12D cells since neurites of PC12D cells behave like axons. Many peroxisomes were found in long neurites with growth cones in PC12D cells cultured with NGF for 2 days (Fig. 2), while only a few peroxisomes were found in short neurites (Figs. 2A and 2B). These short neurites may be at rest, since no growth cone-like structures were observed on them. Therefore, localization of peroxisomes in neurites may be related to the metabolic or extending activity of neurites. In cultures of PC12D cells, treatment with NGF for 1 day elicited the formation of short neurites. And even in these short ones, peroxisomes obviously existed. After culture for 5 days with NGF, many peroxisomes were observed in very long neurites. These observations suggest that peroxisomes possibly relate to the
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
265
PC12D cells treated with these reagents, peroxisomes were also localized in extended neurites. Therefore, localization of peroxisomes in neurites was not considered a direct effect of NGF, but the localization might be related to the stimulation of outgrowth of neurites.
FIG. 4. PC12D cells transfected with pEGFP-SKL and treated with NGF for 1 day (A, B) and 5 days (C, D). The punctate fluorescent signals of EGFP-SKL were detected as peroxisomes. Phase-contrast image (A) corresponds to fluorescence image (B), and phase contrast (C) corresponds to (D). Bars represent 20 m.
outgrowth or maintenance of neurites. We were interested in whether the peroxisome localization in neurites was the direct effect of NGF. DbcAMP, forskolin, and staurosporine were used instead of NGF, since dbcAMP is a membrane-permeable analog of cAMP and forskolin is an adenylate cyclase activator. These compounds and staurosporine are potent promoters of neurite outgrowth in the PC12 cell variant [24]. In
FIG. 5. Relationship between peroxisomes and neural terminallike structures. (A, B) After transfection with pEGFP-SKL, cells were treated with 50 nM staurosporine for 2 days. Phase-contrast image (A) corresponds to fluorescence image (B). Arrow and arrowhead indicate neural terminal-like structures. Bar represents 20 m. (C) Electron microscopy imaging of neural terminal-like structure is shown. Typical DAB-positive peroxisomes are indicated by arrows. N and CB represent neurite and cell body, respectively. Bar represents 1 m.
266
ISHIKAWA ET AL.
FIG. 6. Relationship between peroxisomes and growth cone. (A) Double-fluorescence imaging of PC12D cells expressing EGFP-SKL in peroxisomes (green) and staining of Texas red-labeled phalloidin associated with F-actin (red). Arrowheads indicate filopodia. Bar represents 20 m. (B) Electron microscopy imaging of growth cone is shown. Typical DAB-positive peroxisomes are indicated by arrows. Arrowheads indicate filopodia. Bar represents 1 m.
Peroxisomal motility in neurites of PC12D cells. Many peroxisomes were observed in neurites of PC12D cells, although their transport mechanism is not yet understood. The peroxisomal movement in cell bodies and neurites of PC12D cells was studied using timelapse high-resolution fluorescence microscopy. Almost all peroxisomes in the cell bodies randomly oscillated in a small limited area with occasionally sudden saltation or arrest (data not shown). A similar peroxisomal behavior has been found in CHO cells [13] and CV1 cells [14]. Most peroxisomes in the neurites were found to oscillate or arrest, although some peroxisomes moved fast in one direction. The average velocities of anterograde transports ranged from 0.13 to 0.21 m/s at 25°C. It is claimed that the average velocity is more than 0.05 m/s at the saltation state of peroxisomes in CV1 cells [14]. The speeds of analyzed samples were over 0.05 m/s. The maximum velocities ranged from 0.15 to 0.48 m/s in the anterograde transport in this report. It is claimed that the maximum velocity is more
than 0.2 m/s at the saltation state of peroxisomes in CV1 cells [14]. The lower speed example, however, might be ascribed to the lower experimental temperature in this investigation, 25°C. Therefore, the found peroxisomal movements are considered to be saltations [13, 14]. The average velocity of retrograde transport ranged from 0.11 to 0.17 m/s at 25°C and the maximum velocity of retrograde transport ranged from 0.15 to 0.25 m/s. This movement is also considered to be a saltation [13, 14]. We therefore conclude that the fast movements of peroxisomes in the neurites of PC12D cells are saltations. Cell organelles move along cytoskeletal tracks and are driven by microtubule- or actin-based motor enzymes [30 –32]. Evidence from various different cell types has demonstrated that movements of the Golgi apparatus [33], endoplasmic reticulum [34], lysosomes [35], mitochondria [36], and intracellular transport vesicles [37] are all microtubule dependent. Two microtubule-associated motor protein families, kinesins and cytoplasmic dyneins, have been well characterized. These motor proteins generate movements at the expense of ATP hydrolysis. Kinesins are involved in both so-called minus- and plus-end-directed movements on the microtubules, as has been described [38, 39]. Dyneins are involved in the general intracellular movement toward the minus end of microtubule [40]. For mitochondrial movements, the microtubules act as an important cytoskeletal track and the kinesin homologs, i.e., KIF1B and KIF5B, are involved as the motor proteins [41, 42]. KIF1B is expressed abundantly in differentiated nerve cells [41]. Kinesin-related proteins on synaptic vesicles, KIF1A in mouse [43] and UNC104 in Caenorhabditis elegans [44], are involved in anterograde axonal transport as microtubule-based motors. KIF2, an alternative spliced isoform of the KIF2 as a neural kinesin, is responsible for the peripheral translocation of lysosomes [45]. The KIF1B-specific mitochondrial movement along microtubules has been observed in vitro at a maximum velocity of 0.5 m/s [41] and is consistent with the orthograde velocities of mitochondrial transports reported previously (0.23–1.12 m/s) [8, 46 – 48]. The velocity analysis strongly suggests that KIF1B is involved in the anterograde translocation of mitochondria. To our knowledge, peroxisomal motor proteins have not yet been reported. However, the maximum velocity of the peroxisomal anterograde transport (0.48 m/s at 25°C) is close to that of mitochondrial transports, suggesting that a specific kinesin homolog for peroxisomes is present in neural cells and that this homolog transports peroxisomes anterogradely in neurites. Our observations suggest the following hypothesis about peroxisomal movement in neurites (Fig. 8). Peroxisomes occurs via endoplasmic reticulum [49], that is to say, peroxisomes are formed in the cell body. Per-
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES
267
FIG. 7. Time-lapse motion analysis of the dynamics of peroxisomes in living PC12D cells expressing EGFP-SKL. (A) Peroxisome anterograde transport in the direction from the cell body to the growth cone. (B) Peroxisome retrograde transport in the direction from the growth cone to the cell body. Four consecutive frames (001– 004) were taken at 5-s intervals. Neurites are shown by broken lines. Arrowheads represent direction of distal neurites. Peroxisomes indicated with arrows show rapid movement in one direction. Big arrows indicate peroxisomes which were moved though four consecutive frames (A, B). Small arrow indicates peroxisomes moved from the second frame (B). Bars represent 10 m. FIG. 8. A model of peroxisome transport from cell body to growth cone. Peroxisomes which are formed in the cell body move to the growth cone via varicosity by an anterograde transport. In this place, peroxisomes play some important role and then return to the cell body by a retrograde transport. During transportation, peroxisomes are saltating and/or oscillating repeatedly.
oxisomes in the cell body move to growth cones and neural terminals via varicosities by an anterograde transport. Peroxisomes play some role in these parts and subsequently return to the cell bodies by a retro-
grade transport. Through transportation, peroxisomes are carried by saltation and sometimes pause by oscillation or arrest. Therefore, it is thought that peroxisomes are localized constantly but replaced freshly in
268
ISHIKAWA ET AL.
growth cones through development of neurites. What functions do peroxisomes play in neurites? What kinds of motor proteins participate in peroxisomal transport in neurites? Many questions are, however, to be solved. We thank technical assistants Kenzo Uehira and Taiji Suda, Electron Microscopy Center, Kawasaki Medical School, for the electron microscopy. This work was supported by a Research Project Grant from Kawasaki Medical School (No. 11-703).
REFERENCES 1.
2. 3.
4.
5.
6. 7.
8.
9.
10.
11.
12.
13.
14.
15.
Van den Bosch, H., Schutgens, R. B., Wanders, R. J., and Tager, J. M. (1992). Biochemistry of peroxisomes. Annu. Rev. Biochem. 61, 157–197. Lasarow, P. B., and Moser, H. W. (1995). “Disorders of Peroxisome Biogenesis,” pp. 2287–2324, McGraw–Hill, New York. Goldfischer, S., Moore, C. L., Johnson, A. B., Spiro, A. J., Valsamis, M. P., Wisniewski, H. K., Ritch, R. H., Norton, W. T., Rapin, I., and Gartner, L. M. (1973). Peroxisomal and mitochondrial defects in the cerebro-hepato-renal syndrome. Science 182, 62– 64. Bowen, P., Lee, C. S. N., Zellweger, H., and Lindenberg, R. (1964). A familial syndrome of multiple congenital defects. Bull. Johns Hopkins Hosp. 114, 402– 414. Opitz, J. M., ZuRhein, G. M., Vitale, L., Shahidi, N. T., Howe, J. J., Chou, S. M., Shanklin, D. R., Sybers, H. D., Dood, A. R., and Gerritsen, T. (1969). The Zellweger syndrome (cerebrohepato-renal syndrome). Birth Defects. V, 144 –160. Moser, H. W. (1997). Adrenoleukodystrophy: Phenotype, genetics, pathogenesis and therapy. Brain 120, 1485–1508. Cole, N. B., and Lippincott Schwartz, J. (1995). Organization of organelles and membrane traffic by microtubules. Curr. Opin. Cell Biol. 7, 55– 64. Forman, D. S., Lynch, K. J., and Smith, R. S. (1987). Organelle dynamics in lobster axons: Anterograde, retrograde and stationary mitochondria. Brain Res. 412, 96 –106. Murphy, C., Saffrich, R., Grummt, M., Gournier, H., Rybin, V., Rubino, M., Auvinen, P., Lutcke, A., Parton, R. G., and Zerial, M. (1996). Endosome dynamics regulated by a Rho protein. Nature 384, 427– 432. Nilsson, H., and Wallin, M. (1997). Evidence for several roles of dynein in pigment transport in melanophores. Cell Motil. Cytoskeleton 38, 397– 409. Wacker, I., Kaether, C., Kromer, A., Migala, A., Almers, W., and Gerdes, H. H. (1997). Microtubule-dependent transport of secretory vesicles visualized in real time with a GFP-tagged secretory protein. J. Cell Sci. 110, 1453–1463. Rodionov, V. I., Hope, A. J., Svitkina, T. M., and Borisy, G. G. (1998). Functional coordination of microtubule-based and actinbased motility in melanophores. Curr. Biol. 8, 165–168. Rapp, S., Saffrich, R., Anton, M., Jakle, U., Ansorge, W., Gorgas, K., and Just, W. W. (1996). Microtubule-based peroxisome movement. J. Cell Sci. 109, 837– 849. Wiemer, E. A., Wenzel, T., Deerinck, T. J., Ellisman, M. H., and Subramani, S. (1997). Visualization of the peroxisomal compartment in living mammalian cells: Dynamic behavior and association with microtubules. J. Cell Biol. 136, 71– 80. Huber, C., Saffrich, R., Anton, M., Passrciter, M., Ansorge, W., Gorgas, K., and Just, W. (1997). A heterotrimeric G protein– phospholipase A2 signaling cascade is involved in the regulation of peroxisomal motility in CHO cells. J. Cell Sci. 110, 2955–2968.
16.
17. 18. 19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30. 31. 32.
33.
34.
35.
Huber, C., Saffrich, R., Ansorge, W., and Just, W. (1999). Receptor-mediated regulation of peroxisomal motility in CHO and endothelial cells. EMBO J. 18, 5476 –5485. Citkowitz, E., and Holtzman, E. (1973). Peroxisomes in dorsal root ganglia. J. Histochem. Cytochem. 21, 34 – 41. Arnold, G., and Holtzman, E. (1975). Peroxisomes in rat sympathetic ganglia and adrenal medulla. Brain Res. 83, 509 –515. McKenna, O., Arnold, G., and Holtzman, E. (1976). Microperoxisome distribution in the central nervous system of the rat. Brain Res. 117, 181–194. Arnold, G., and Holtzman, E. (1978). Microperoxisomes in the central nervous system of the postnatal rat. Brain Res. 155, 1–17. Mueller, B. K. (1999). Growth cone guidance: First steps towards a deeper understanding. Annu. Rev. Neurosci. 22, 351– 388. Kalish, J. E., Keller, G. A., Morrell, J. C., Mihalik, S. J., Smith, B., Cregg, J. M., and Gould, S. J. (1996). Characterization of a novel component of the peroxisomal protein import apparatus using fluorescent peroxisomal proteins. EMBO J. 15, 3275– 3285. Katoh Semba, R., Kitajima, S., Yamazaki, Y., and Sano, M. (1987). Neuritic growth from a new subline of PC12 pheochromocytoma cells: Cyclic AMP mimics the action of nerve growth factor. J. Neurosci. Res. 17, 36 – 44. Sano, M., Iwanaga, M., Fujisawa, H., Nagahama, M., and Yamazaki, Y. (1994). Staurosporine induces the outgrowth of neurites from the dorsal root ganglion of the chick embryo and PC12D cells. Brain Res. 639, 115–124. Sano, M., and Iwanaga, M. (1992). Requirement for specific protein kinase activities during the rapid redistribution of Factin that precedes the outgrowth of neurites in PC12D cells. Cell Struct. Funct. 17, 341–350. Arnold, G., Liscum, L., and Holtzman, E. (1979). Ultrastructural localization of D-amino acid oxidase in microperoxisomes of the rat nervous system. J. Histochem. Cytochem. 27, 735– 745. Brain, K. L., Cottee, L. J., and Bennett, M. R. (1997). Varicosities of single sympathetic nerve terminals possess syntaxin zones and different synaptotagmin N-terminus labelling following stimulation. J. Neurocytol. 26, 491–500. Zerby, S. E., and Ewing, A. G. (1996). Electrochemical monitoring of individual exocytotic events from the varicosities of differentiated PC12 cells. Brain Res. 712, 1–10. Bradke, F., and Dotti, C. G. (1997). Neuronal polarity: Vectorial cytoplasmic flow precedes axon formation. Neuron 19, 1175– 1186. Schliwa, M. (1984). Mechanisms of intracellular organelle transport. Cell Muscle Motil. 5, 1– 82. Walker, R. A., and Sheetz, M. P. (1993). Cytoplasmic microtubule-associated motors. Annu. Rev. Biochem. 62, 429 – 451. Langford, G. M. (1995). Actin- and microtubule-dependent organelle motors: Interrelationships between the two motility systems. Curr. Opin. Cell Biol. 7, 82– 88. Ho, W. C., Allan, V. J., van Meer, G., Berger, E. G., and Kreis, T. E. (1989). Reclustering of scattered Golgi elements occurs along microtubules. Eur. J. Cell Biol. 48, 250 –263. Terasaki, M., Chen, L. B., and Fujiwara, K. (1986). Microtubules and the endoplasmic reticulum are highly interdependent structures. J. Cell Biol. 103, 1557–1568. Hollenbeck, P. J., and Swanson, J. A. (1990). Radial extension of macrophage tubular lysosomes supported by kinesin. Nature 346, 864 – 866.
PEROXISOME LOCALIZATION AND MOTILITY IN NEURITES 36.
37. 38.
39.
40.
41.
42.
43.
Morris, R. L., and Hollenbeck, P. J. (1995). Axonal transport of mitochondria along microtubules and F-actin in living vertebrate neurons. J. Cell Biol. 131, 1315–1326. Allan, V. (1994). Organelle movement. Dynactin: Portrait of a dynein regulator. Curr. Biol. 4, 1000 –1002. Vale, R. D., Reese, T. S., and Sheetz, M. P. (1985). Identification of a novel force-generating protein, kinesin, involved in microtubule-based motility. Cell 42, 39 –50. McDonald, H. B., Stewart, R. J., and Goldstein, L. S. (1990). The kinesin-like ncd protein of Drosophila is a minus enddirected microtubule motor. Cell 63, 1159 –1165. Holzbaur, E. L., and Vallee, R. B. (1994). DYNEINS: Molecular structure and cellular function. Annu. Rev. Cell Biol. 10, 339 – 372. Nangaku, M., Sato Yoshitake, R., Okada, Y., Noda, Y., Takemura, R., Yamazaki, H., and Hirokawa, N. (1994). KIF1B, a novel microtubule plus end-directed monomeric motor protein for transport of mitochondria. Cell 79, 1209 –1220. Tanaka, Y., Kanai, Y., Okada, Y., Nonaka, S., Takeda, S., Harada, A., and Hirokawa, N. (1998). Targeted disruption of mouse conventional kinesin heavy chain, kif5B, results in abnormal perinuclear clustering of mitochondria. Cell 93, 1147– 1158. Okada, Y., Yamazaki, H., Sekine Aizawa, Y., and Hirokawa, N. (1995). The neuron-specific kinesin superfamily protein KIF1A
Received March 14, 2001
44.
45.
46.
47.
48.
49.
269
is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell 81, 769 –780. Hall, D. H., and Hedgecock, E. M. (1991). Kinesin-related gene unc-104 is required for axonal transport of synaptic vesicles in C. elegans. Cell 65, 837– 847. Santama, N., Krijnse Locker, J., Griffiths, G., Noda, Y., Hirokawa, N., and Dotti, C. G. (1998). KIF2beta, a new kinesin superfamily protein in non-neuronal cells, is associated with lysosomes and may be implicated in their centrifugal translocation. EMBO J. 17, 5855–5867. Partlow, L. M., Ross, C. D., Motwani, R., and McDougal, D. B. J. (1972). Transport of axonal enzymes in surviving segments of frog sciatic nerve. J. Gen. Physiol. 60, 388 – 405. Lorenz, T., and Willard, M. (1978). Subcellular fractionation of intra-axonally transported polypeptides in the rabbit visual system. Proc. Natl. Acad. Sci. USA 75, 505–509. Allen, R. D., Weiss, D. G., Hayden, J. H., Brown, D. T., Fujiwake, H., and Simpson, M. (1985). Gliding movement of and bidirectional transport along single native microtubules from squid axoplasm: Evidence for an active role of microtubules in cytoplasmic transport. J. Cell Biol. 100, 1736 –1752. Titorenko, V. I., and Rachubinski, R. A. (1998). Mutants of the yeast Yarrowia lipolytica defective in protein exit from the endoplasmic reticulum are also defective in peroxisome biogenesis. Mol. Cell Biol. 18, 2789 –2803.