- Email: [email protected]
PERTURBATION OF β1 INTEGRIN FUNCTION USING ANTI-SENSE OR FUNCTION-BLOCKING ANTIBODIES ON CORNEAL CELLS GROWN ON FIBRONECTIN AND TENASCIN
Cell Biology International 2002, Vol. 26, No. 2, 131–144 doi:10.1006/cbir.2001.0818, available online at http://www.idealibrary.com on
PERTURBATION OF 1 INTEGRIN FUNCTION USING ANTI-SENSE OR FUNCTION-BLOCKING ANTIBODIES ON CORNEAL CELLS GROWN ON FIBRONECTIN AND TENASCIN KATHLEEN J. DOANE1*, RAKA BHATTACHARYA1† and JEFF MARCHANT2 1
Department of Anatomy, Northeastern Ohio Universities College of Medicine, 4209 State Route 44, P.O. Box 95, Rootstown, OH 44272-0095, U.S.A.; 2Department of Anatomy and Cellular Biology, Tufts University School of Medicine, U.S.A. Received 15 August 2000; accepted 24 July 2001; published electronically 28 November 2001
During corneal development, neural crest derivatives from the periocular mesenchyme migrate into the cornea and differentiate into corneal fibroblasts. During this time, these cells interact with a variety of extracellular matrices for proper orientation and development. In the present studies, we have examined the interaction of 1 integrins on periocular mesenchyme cells (POM) and corneal fibroblasts (CF) with fibronectin and tenascin by perturbing the function of this integrin. POM and CF attached and spread to a much greater extent on fibronectin than on tenascin. An antibody against 1 integrin, CSAT, decreased spreading and attachment, and resulted in a lack of immuno-detectable 1 integrin in focal adhesions on fibronectin; few 1 positive focal adhesions were observed in cells grown on tenascin. An anti-sense retroviral construct decreased endogenous levels of 1 integrin protein, and caused decreased attachment and spreading as well as sparse, disorganized focal adhesions. These data indicate that in vitro, both POM and CF have 1 integrins that interact with fibronectin and allow them to attach and spread, while tenascin is anti-adhesive. Further studies using both of these experimental 2001 Elsevier Science Ltd. paradigms will clarify whether these interactions also occur in vivo. K: cornea; fibronectin; tenascin; integrin; CSAT; anti-sense retroviral construct. A: E5, embryonic day 5; E14, embryonic day 14; POM, periocular mesenchyme cells; CF, corneal fibroblasts.
INTRODUCTION Interaction of embryonic cells with various extracellular matrices using cellular receptors is an essential component of development, causing a variety of cellular behaviors such as migration, proliferation, spreading and differentiation. Avian corneal stromal development requires that neural crest derivatives (Johnston et al., 1979; Noden, 1975, 1978) stationary within the juxtacorneal region at embryonic day 5 (E5), initiate migration into the cornea at E5.5 (Hay, 1980) along a spatially varied extracellular matrix containing *To whom correspondence and reprint requests should be addressed: Dr Kathleen J. Doane, Fax: (330) 325-5913. E-mail: [email protected] †Currently at University of South Florida/Veterans Administration Hospital. 1065–6995/02/020131+14 $35.00/0
the glycoproteins fibronectin and tenascin (Doane et al., 1996; Kaplony et al., 1991; Kurkinen et al., 1979). Once the cells encounter the primary stroma, comprised of collagens I, II, IX, XII, XIV and other glycoproteins and proteoglycans (Corpuz et al., 1996; Funderburgh et al., 1986; Gordon et al., 1996; Hart, 1976; Hay, 1980; Linsenmayer et al., 1986; Linsenmayer et al., 1990), they differentiate into corneal fibroblasts and begin synthesizing a specialized matrix, the secondary stroma (Hay, 1980). Establishment of proper optical function requires that the corneal fibroblasts deposit orthogonally-arranged collagen lamellae in a precise pattern for proper light refraction to occur (Hay, 1980). For normal development of the cornea, the migrating cells interact with a variety of 2001 Elsevier Science Ltd.
132
extracellular matrices by using multiple matrix receptors. Integrins are a major matrix receptor family responsible for cell-matrix interactions (Hynes, 1992), particularly during developmental stages. A variety of integrins are present in the avian cornea during development, and several of these receptors are known to interact with many of the matrix components present during this time (Doane and Birk, 1994; Doane et al., 1998). To understand the function of these receptors, it is useful to block their function. We have used two paradigms to block the function of 1 integrin in vitro: using a function blocking antibody, and using an antisense retroviral vector to deliver antisense to the cell and cause decreased levels of protein to be present. By blocking the function of matrix receptors while allowing cells to interact with specific extracellular matrix components in vitro, it is possible to characterize potential cellmatrix interactions that could occur in vivo. Two important extracellular matrix components present during corneal development are fibronectin and tenascin. Fibronectin is a major embryonic migratory substrate found in many embryonic migratory pathways (Dufour et al., 1988; Newgreen and Thiery, 1980). This glycoprotein is present in the cornea and periocular mesenchyme in abundance at E5 (Doane et al., 1996; Kurkinen et al., 1979), and is present only in the anterior stroma and Decemet’s membrane by E14, when the cornea is fully differentiated (Kurkinen et al., 1979). Fibronectin is present only in Decemet’s membrane in newborn chicken corneas (Kurkinen et al., 1979). Tenascin is a large, multidomain, multifunction glycoprotein present throughout the corneal stroma and periocular mesenchyme during early corneal stromal development (Doane et al., 1996; Kaplony et al., 1991), but much more restricted in its distribution by E14 (Kaplony et al., 1991). These findings suggest differentiation of function of these two matrix proteins during development. In contrast, other components which the cells encounter along the migratory pathway, such as decorin and collagens I and VI, are present early in development and are increased in amount by E14 (Doane et al., 1996; Linsenmayer et al., 1990). To analyse the functional role of fibronectin, tenascin, and 1 integrin heterodimers in corneal development, we have investigated the interaction of the undifferentiated periocular mesenchyme cell population, which contains the corneal fibroblast and scleral precursors, and fully differentiated corneal fibroblasts with fibronectin and tenascin. Using cell culture techniques, we asked whether both cell types adhere and spread on fibronectin
Cell Biology International, Vol. 26, No. 2, 2002
and tenascin and whether they use 1 in this adherence. To characterize the interaction of 1containing integrins, we perturbed 1 integrin function using the monoclonal antibody CSAT, which has been shown to bind 1 integrin and prevent its interaction with matrix (Neff et al., 1982). Additionally, we perturbed the function of 1 integrin using an antisense retroviral construct. These studies demonstrate the importance of 1 integrin interaction with fibronectin in development and indicate that tenascin is functioning as an anti-adhesive substrate for both cell types. These data also demonstrate that both function blocking antibodies and antisense retroviral vectors are useful methods for characterizing matrix receptor function.
MATERIALS AND METHODS Tissue Fertilized White Leghorn chicken eggs were purchased from Truslow Farms, Inc. (Chestertown, MD, U.S.A.), and were maintained at 37C in a humidified atmosphere. Embryos were harvested and staged according to Hamburger and Hamilton (1951). The following developmental stages were utilized: E5 (stage 26) and E14 (stage 40). These stages represent an undifferentiated, heterogeneous cell population containing both corneal fibroblast and scleral precursors (E5) and fully differentiated corneal fibroblasts (E14).
Cell culture POM cells were isolated from E5 avian eyes as previously described (Doane and Birk, 1994). Eyes were trimmed to approximately 3 mm around the cornea, the pigment epithelium and presumptive retina removed manually, and the remainder of the epithelium and endothelium removed by treatment with Versene (Life Technologies, Gaithersburg, MD, U.S.A.). The tissue was dissociated in 200 units/ml collagenase (Sigma Chemical Co., St Louis, MO, U.S.A.; type IV collagenase) in Complete Minimal Essential Medium (CMEM; Life Technologies, Gaithersburg, MD, U.S.A.) with antibiotics (50 g/ml gentamicin, 2.5 g/ml fungizone) and 2 mM glutamine. CFs were isolated from E14 embryonic corneas as previously described (Doane and Birk, 1991). Cells were grown in CMEM with 20% fetal bovine serum (CMEM-20) or CMEM-10 with 50 g/ml ascorbate
Cell Biology International, Vol. 26, No. 2, 2002
added. Cells from passages 1 to 3 were used in these studies. Matrix components Bovine plasma fibronectin was purchased from Sigma Chemical Co. (St Louis, MO, U.S.A.). Human tenascin, isolated from a glioblastoma cell line, was purchased from Life Technologies (Gaithersburg, MD, U.S.A.) or Sigma Chemical Co. (St Louis, MO, U.S.A.). Matrix coating of slides Fibronectin or tenascin, at a concentration of 20 g/ml in 20 mM carbonate, pH 9.6, were allowed to coat 5 mm2 well slides (CelLine, Newfield, NJ, U.S.A.) overnight at 4C. Matrixcoated and uncoated wells (for use as controls) were blocked in 2% bovine serum albumin in PBS, rinsed, and cells were applied at appropriate concentrations. Spreading assays Spreading assays were similar to published protocols (Doane et al., 1992). Wells (5 mm2) on Tefloncoated well slides (CelLine, Newfield, NJ, U.S.A.) were coated with 50 l of a 20 g/ml solution of matrix protein in 20 mM carbonate, pH 9.6. Slides were blocked in 2% bovine serum albumin in PBS, pH 7.5, and cells were added at a concentration of 5000 cells per well in CMEM with no serum present (CMEM-0). Cells were allowed to spread for 4 h, fixed in methanol/acetone, and air dried. BSAblocked glass served as a control matrix. The total area covered by cells was measured using a BioQuant Image Analysis System. A total of 5 cells per well, and 3 wells per experiment were quantified, with each experiment replicated 3 times. To analyse the data obtained from spreading assays, the analysis of variance (Anova) table for means test was used. This was followed by a Student Newman Keul’s test at 95% level of significance. When the Anova demonstrated unequal variances, pairwise t-test of variances were used to compare the P-value at a significance level. We have used P-values of significant levels at P<0.05 (*), P<0.01 (**) and P<0.001 (***).
133
Developmental Studies Hybridoma Bank (developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA 52242). For immunofluorescence localization of 1 integrin, another antibody from the Developmental Studies Hybridoma Bank, V2E9 (Hayachi et al., 1990), was used. -galactosidase was analysed using an antibody against this protein purchased from SigmaAldrich, Inc. (St Louis, MO, U.S.A.). Secondary antibodies were labelled with either a fluorescent tag (DTAF, a fluorescein derivative, or rhodamine) or with horseradish peroxidase, and were purchased from Jackson Laboratories (West Grove, PA, U.S.A.). Immunofluorescence procedure Cells were grown on matrix-coated or BSAblocked glass slides as described for spreading assays (Doane et al., 1992), then fixed in methanol and acetone at 20C and air dried. Non-specific binding sites were blocked by incubation in 2% normal goat serum, followed by addition of primary antibodies or control sera. Following incubation in fluorescent-labelled secondary antibodies, cells were coverslipped in VectaShield mounting medium (Vector Laboratories). Attachment assays Attachment assays were based on the method of Bourdon and Ruoslahti (1989). Microtitre 96 well plates were coated with 100 l of fibronectin or tenascin at the same concentration as used for spreading assays. BSA-blocked plastic served as a control matrix. Cells were allowed to attach for 4 h in CMEM-0, fixed in 4% buffered formaldehyde and stained with 1% toluidine blue in 1% sodium borate. Cells were solubilized in 1% SDS and optical density (OD 600 nm) read in a multiscan plate reader. CSAT perturbation of 1 integrin function CSAT was added to cells in culture medium (CMEM-0) at a concentration of 20 g/ml and serially diluted 1:1 such that the cell concentration remained constant. CellsCSAT were added to coated wells for use in attachment and spreading assays as outlined above.
Antibodies CSAT, a function-blocking mouse monoclonal antibody against the avian 1 subunit of integrin (Neff et al., 1982), was obtained from the
Cloning of the 1 chicken cDNA Chicken 1 integrin primers were designed using cDNA sequences which spanned the initiation
134
ATG. The 5 primer (5 GATCACTAGTCGC CAGCGCAGCTCCTG3 ) and 3 primer (5 GA TCACTAGTCTGCGTGGATCTGTGTAATG3 ) included SpeI sites to facilitate cloning. PCR using these primers and a chicken 1 cDNA generated a 460 bp product which was digested, gel purified and inserted into the SpeI-compatible, XbaI digested viral vector. PCR using a vector-specific primer and the 3 1 primer was performed to select sense and antisense insert orientations. Replication defective retroviral vectors Retroviral vectors, derived from spleen necrosis virus (SNV; Dougherty and Temin, 1986) were kindly provided by Dr Takashi Mikawa (Cornell University Medical College). As these vectors are replication defective, they must obtain missing protein in trans from packaging cells to be able to produce infectious virus particles (Dougherty et al., 1989; Mikawa et al., 1991). Once assembled into infectious viruses by these packaging cells, the viral particles can infect a wide variety of host cells. Since a packaging cell is required to produce infective virus, horizontal transmission of the virus is not possible in normal cells, and thus only progeny of infected cells will express the proviral transcripts. The pCXL vector contains the SNV promoter as well as sequences required for encapsidation of viral transcripts, reverse transcription and proviral integration (Mima et al., 1995). In addition, this vector contains the bacterial Lac Z gene downstream of the 1 insert. A translation initiation sequence derived from the murine leukemia virus gag gene is present in the 5 flanking sequence, which results in efficient expression of the reporter gene. Production of high titre recombinant virus The generation of infectious viral particles was achieved by co-transfection of packaging cells (NND17.2G) with the recombinant vectors and a selectable marker using Lipofectamine (Life Technologies; Dougherty et al., 1989). Packaging cells at a concentration of 2104 were transfected with a total of 2 g DNA comprised of recombinant vector and a pSV2-neo selection vector (in a 35:1 ratio). Clones that contained the selectable marker were selected by incubation in 400 g/ml geneticin (G418; Life Technologies) for a three to four week period. Cloning cylinders were used to isolate clonal lines; these were expanded initially in the presence of G418, which was discontinued after 2 weeks. For initial screening to determine infection
Cell Biology International, Vol. 26, No. 2, 2002
rates, culture medium from each clone was centrifuged to remove cellular debris, mixed with 10 mg/ ml polybrene (Sigma Chemical Co.) and used to infect corneal cells plated sparsely in 24 well plates for 2 h. Two days following infection, the cells were fixed in 2% paraformaldehyde in PBS and positive cells identified using an assay for -galactosidase activity (Mayne et al., 1993). As the -galactosidase was on the sense/antisense constructs, a high number of positive (blue) cells indicated a clonal line producing high titre retrovirus. To confirm the histochemical staining, immunofluorescence analyses were performed using an antibody against -galactosidase on cells adherent to fibronectin, tenascin and glass. These experiments confirmed that 80–90% of cells were immunopositive for this protein. One sense clone (F7) and one antisense clone (R29), both producing 80–90% X-gal positive cells, were chosen for all subsequent assays. Effects of anti-sense 1 integrin constructs To determine the effect of the antisense 1 integrin construct on levels of endogenous 1 integrin, cells infected with either the sense or the antisense construct were grown to confluency, isolated in 75 mM Tris, 225 mM NaCl, 0.15% SDS, and 1% NP-40, pH 7.4, and assayed for protein content using the BCA protein assay (Pierce Chemical, Rockford, IL). Equivalent levels of protein (10 g/ ml in gel sample buffer) were loaded into wells of a 7.5% SDS-polyacrylamide gel, transferred to nitrocellulose, and detected using the ECL (Enhanced Chemilluminescence; Amersham Life Science, Arlington Heights, IL, U.S.A.) protocol. The resulting data were scanned using a BioQuant Image Analysis system, and relative protein levels determined. To analyse the effect antisense 1 integrin had on attachment and spreading, assays were performed as detailed above, using either sense or antisense infected cells. To determine the effect the presence of the antisense contruct had on focal adhesions, immunofluorescence assays were performed as detailed above, again comparing sense and antisense infected cells.
RESULTS Cells spread and attached better on fibronectin than tenascin or glass To determine whether cells spread equally on the different glycoproteins fibronectin and tenascin,
Cell Biology International, Vol. 26, No. 2, 2002
135
Fig. 1. Cells spread better on fibronectin than tenascin. Phase contrast micrograph of periocular mesenchyme cells (a, c, e) and corneal fibroblasts (b, d, f) grown for 4 h in CMEM-0 on fibronectin (a, b), tenascin (c, d) and glass (e, f). Cells on fibronectin are polarized and well spread, while cells on tenascin are less spread than cells adherent to glass.
cells were allowed to adhere on these matrices for 4 h and their morphology was evaluated (Fig. 1). POM cells and CFs spread to a much greater extent on fibronectin than on tenascin or glass, as evidenced by microscopic analyses and computerassisted area measures. Both cell types exhibited a polarized morphology consisting of lamellipodial extensions when plated on fibronectin. When POM cells or CFs interacted with tenascin, they exhibited a rounded morphology, with few cellular processes evident. Both cell types appeared to spread and polarize better on BSA-blocked glass than on tenascin, indicating that tenascin prevented these functions. To quantitate cellular spreading, a Bio-Quant Image Analysis system was used to analyse the area (m2) covered by cells (Fig. 2). This method con-
firmed that both POM cells and CFs spread to a greater extent on fibronectin than glass (P<0.0001), and that tenascin is anti-adhesive for both POM cells (P<0.05) and CFs (P<0.001) when compared to glass. A quantitative comparison of spreading of both cell types on fibronectin indicated that POM cells spread better than CFs. Cellular adhesion was also evaluated, to determine whether equivalent numbers of cells attached to matrices but exhibited differences in spreading behavior. Attachment assays revealed that both cell types attached better to fibronectin, while no difference was observed in the basal levels of attachment seen when cells interacted with tenascin or BSA-blocked plastic (Fig. 3). As seen in the analysis of spreading assay data, POM cells appear to attach to a greater extent than do CFs.
136
Cell Biology International, Vol. 26, No. 2, 2002
4000 FN TN GL
*** 3000
Area (µm2)
***
2000 *
***
POM CF Cells on matrix proteins
Fig. 2. Cells covered a greater surface area when adherent to fibronectin (FN) than tenascin (TN). Quantitation of spreading assay (4 h in CMEM-0) indicated that both corneal fibroblasts (CF) and periocular mesenchyme cells (POM) covered more area (m2) than cells adherent to glass (GL). Cells on tenascin covered less surface area than cells on glass. ***, P<0.001; *, P<0.05; bars=standard error.
0.6 FN TN GL
0.5 Absorbance at 600 nm
MATRIX Fibronectin Tenascin Glass
1000
0
Table 1. CSAT at 20 g/ml caused a reduction in spreading for periocular mesenchyme cells (POM) and corneal fibroblasts (CF). Data are presented as the percent of reduction in spreading determined when spreading levels in the presence of CSAT were compared to spreading levels with CSAT not present. Too few corneal fibroblasts remained spread on tenascin and glass in the presence of CSAT to analyse spreading, so this calculation was not done (N.D.) POM
CF
36% reduction 67% reduction 41% reduction
73% reduction N.D. N.D.
monoclonal antibody known to block the function of 1 (CSAT) was utilized (Neff et al., 1982) in attachment and spreading assays. CSAT (at 20 g/ml) decreased spreading of POM cells on all matrices, and CFs on fibronectin; too few CFs remained spread in the presence of CSAT for analysis (Table 1). Likewise, POM cells required 1 integrin to a greater extent than CFs when adherent to fibronectin (Table 1). Blocking of 1 integrin using CSAT decreased attachment of both cell types on fibronectin; the low levels of attachment seen when cells were allowed to adhere to tenascin and BSA-blocked plastic were relatively unchanged (Fig. 4a,b).
0.4
Disruption of 1 integrin function by CSAT caused a loss of 1-integrin immunopositive focal adhesions from cells on fibronectin
0.3
0.2
0.1
0
POM CF Cells on matrix proteins
Fig. 3. Cells adhered better to fibronectin than to tenascin or glass. Attachment assay (4 h in CMEM-0) results indicated that cells adhered less well to tenascin or glass than to fibronectin.
To determine whether 1 integrin localization was affected by CSAT, cells were allowed to attach to fibronectin and tenascin for 4 h and used in immunofluorescence analyses. In the absence of CSAT, POM cells (Fig. 5) and CFs (Fig. 6) exhibited well-defined, organized 1-containing focal adhesions. When CSAT was used to block 1 integrin function, 1-positive focal adhesions were greatly reduced. On tenascin, few 1-positive focal adhesions were formed by either cell type. Sense and anti-sense retroviral clones infected cells at high levels
Disruption of 1 integrin function by CSAT caused decreased spreading and attachment of cells on fibronectin To analyse the role of 1 integrin in the interaction of corneal cells with fibronectin and tenascin, a
Over 80–90% of POM cells and CFs were infected with retrovirus as determined by histochemistry to identify the reporter gene product using either the X-gal assay histochemical procedure (Fig. 7), or immunofluorescence to identify -galactosidase
Cell Biology International, Vol. 26, No. 2, 2002
137
0.35 (A)
FN TN GL
Absorbance at 600 nm
0.3 0.25 0.2 0.15 0.1 0.05 0
0
2.5
5 10 CSAT (µg/ml)
20
0.2
Absorbance at 600 nm
(B)
FN TN GL
0.15
Antisense 1 integrin causes a decrease in endogenous 1 integrin protein levels
0.1
0.05
0
struct). Vector alone gave no blue reaction product (Fig. 7a). The sense (F7) construct showed similar levels of infectivity (data not shown). To confirm these analyses, cells were grown on fibronectin and analysed using an antibody against -galactosidase and immunofluorescence. Nuclei were stained with DAPI to document cell number (blue fluorescence) and the antibody was localized using a secondary antibody labelled with FITC (green fluorescence). Where nuclei appeared (Fig. 8a), immunopositive material was seen in a similar region (Fig. 8b; corneal fibroblasts infected with the sense construct), indicating the presence of this protein. The antisense construct showed similar levels of -galactosidase immunolocalization in cells grown on fibronectin (data not shown). Again, a high percentage of cells in many fields examined in this way showed positive immunofluorescence for this protein, confirming the X-gal histochemistry data that 80–90% of infected cells contained functional protein generated from the construct.
0
2.5
5 10 CSAT (µg/ml)
20
Fig. 4. CSAT caused a reduction in cellular attachment to fibronectin. At 20 g/ml, CSAT caused a decrease in attachment of periocular mesenchyme cells (a) and corneal fibroblasts (b) to fibronectin. No effect of this antibody on attachment to tenascin or glass was detectable due to low levels of attachment to these matrices.
when cells were plated on fibronectin (Fig. 8). Many clonal lines expressing retrovirus were screened, and one sense (F7) and one antisense (R29) cell line were chosen for further analysis. These cell lines made high titre retrovirus which expressed the reporter gene product, and were used for all subsequent analyses. Using X-gal histochemistry on cells infected with the antisense (R29) construct, many of the densely packed cells exhibited blue reaction product, indicative of the presence of functional -galactosidase protein (Fig. 7b; corneal fibroblasts infected with the antisense con-
To determine the effect of the presence of an antisense 1 integrin retroviral construct on endogenous levels of 1, infected cells were grown to confluence and subjected to Western blot analyses (Fig. 9). The resulting data were scanned using a BioQuant Image Analysis system, and the 1 integrin immunopositive bands quantitated as integrated density (log10 foreground÷ background). Equivalent levels of protein were present in each lane, and thus this analysis yielded numbers corresponding to relative levels of protein. When levels of protein in sense construct-infected cells were compared to antisense construct-infected cells, there was a 28% decrease in endogenous 1 integrin protein levels for POM cells, and a 36% decrease for CFs. Antisense 1 integrin caused a decrease in spreading and attachment of cells on fibronectin To analyse the effect antisense 1 integrin had on spreading and attachment, sense or antisense infected POM cells and CFs were allowed to attach to fibronectin, tenascin, and BSA-blocked glass or plastic, and subjected to spreading (Fig. 10) or attachment (Fig. 11) assay analysis as described in Materials and Methods. Little difference was observed when sense and antisense infected cells were allowed to adhere to tenascin or the control matrices, consistent with results observed in the
138
Cell Biology International, Vol. 26, No. 2, 2002
Fig. 5. CSAT caused a loss of immunodetectable 1 integrin from focal adhesions of periocular mesenchyme cells on fibronectin; cells adherent to tenascin did not localize 1 integrin to focal adhesions. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. POM cells on fibronectin: a, b; POM cells on tenascin: c, d. No CSAT present: a, c; 20 g/ml CSAT present: b, d.
presence of the 1 integrin function-blocking antibody CSAT. Also consistent with these data was an apparent decrease in spreading and attachment of both cell types on fibronectin when 1 integrin function was perturbed in the presence of antisense. This was significant only for spreading of CFs, however (P<0.001). Antisense 1 integrin causes fewer and less well-organized focal adhesions when cells are adherent to fibronectin To analyse the effect of the presence of antisense 1 integrin on the immunolocalization of 1 to focal adhesions, sense and antisense infected cells were subjected to immunofluorescence analyses. Sense infected POM cells (Fig. 12) and CFs (Fig. 13) exhibited prominent, well-organized focal adhesions when adherent to fibronectin; these were
consistent with 1 integrin-positive focal adhesions observed in uninfected cells (see Figs 5 & 6). The presence of antisense caused a reduction in apparent numbers of 1 integrin immunopositive focal adhesions, and a loss of the well-organized pattern of focal adhesions. As observed in uninfected cells, cells adherent on tenascin did not exhibit obvious focal adhesions, and this observation was unchanged whether cells were infected with sense or antisense 1 integrin constructs.
DISCUSSION For proper refraction of light, the cornea must be clear. The neural crest derivatives present within the periocular mesenchyme early in corneal development (Johnston et al., 1979; Noden, 1975, 1978) interact with a variety of extracellular matrices
Cell Biology International, Vol. 26, No. 2, 2002
139
Fig. 6. CSAT caused a loss of immunodetectable 1 integrin from focal adhesions of corneal fibroblasts on fibronectin; cells adherent to tenascin did not localize 1 integrin to focal adhesions. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. CF cells on fibronectin: a, b; CF cells on tenascin: c, d. No CSAT present: a, c; 20 g/ml CSAT present: b, d.
during their migration into the stroma, differentiation into corneal fibroblasts, and deposition of a transparent stroma. The matrix proteins fibronectin and tenascin have been implicated in this developmental process (Doane et al., 1996; Kaplony et al., 1991; Kurkinen et al., 1979), although their role is not understood. This study examined the interaction of the undifferentiated mesenchymal population (E5) and the differentiated cell population (E14) with fibronectin and tenascin. Since 1 integrins interact with both of these matrix proteins (Hynes, 1992; Schnapp et al., 1995), we perturbed the function of 1 using a function-blocking antibody and antisense retroviral construct to determine a potential role for 1-fibronectin or 1tenascin interactions during corneal development. Fibronectin is a major embryonic migratory substrate (Newgreen and Thiery, 1980), and is present throughout the developing corneal stroma and
sclera (Doane et al., 1996; Kurkinen et al., 1979), although in reduced amounts by embryonic day 14 in the chicken (Kurkinen et al., 1979). In vitro, we demonstrated that undifferentiated periocular mesenchyme cells and fully differentiated corneal fibroblasts attached and spread to a much greater extent on fibronectin than on tenascin. Focal adhesions, clustering of matrix receptors caused by binding to a ligand (Fath et al., 1989), were welldefined in cells on fibronectin. These findings are consistent with other reports, as many cells attach and spread well on fibronectin and have 1containing focal adhesions (Hynes and Yamada, 1982). Attachment, followed by extension of lamellipodia resulting in a spindle-shaped cell with a leading and a trailing edge, is involved in migration of fibroblasts (Sheetz, 1994). This polarized phenotype was observed in cells plated on fibronectin. The morphology and behavior of corneal cells
140
Fig. 7. X-gal histochemistry determined that 80–90% of cells were infected with functional retrovirally-derived protein. Corneal fibroblasts stained histochemically for blue reaction product generated by the presence of functional galactosidase. Uninfected corneal fibroblasts (a) did not contain any blue staining, while cells infected with the antisense (b) retroviral construct contained high levels of blue reaction product.
interacting with fibronectin is consistent with our hypothesis that cells interact with fibronectin during corneal development. Perturbation of 1 integrin function using CSAT decreased spreading and attachment of cells on fibronectin, and interfered with immunolocalization of 1 integrin in focal adhesions. Cell phenotype-specific responses to CSAT are documented, with some cells exhibiting decreased spreading and others remaining unaffected (Horwitz et al., 1985). Masur et al. (1993) documented an increase in rabbit corneal fibroblast spreading on fibronectin using a different 1integrin function-blocking antibody. We have documented a similar increase in spreading of CSAT-treated cells plated on type VI collagen (Howell and Doane, 1998), implying that the decrease we observed in the present study is due to the type of matrix used and not to the antibody. In
Cell Biology International, Vol. 26, No. 2, 2002
Fig. 8. Immunofluorescence confirmed the X-gal histochemistry. Corneal fibroblasts were stained with the nuclear stain DAPI to identify cells (a; blue fluorescence). In similar regions to DAPI identified cells, immunopositive staining for the presence of -galactosidase is seen (b; same field as in (a); green fluorescence).
Fig. 9. Levels of endogenous 1 integrin protein were decreased in the presence of the anti-sense 1 integrin as shown by Western blot analyses. SDS-PAGE followed by detection of 1 integrin by V2E9. Antisense (AS) infected periocular mesenchyme cells and corneal fibroblasts had a 28% and 36% reduction in integrin levels, respectively, when compared to sense (S) infected cells.
addition, our data suggest another receptor for fibronectin on both mesenchyme cells and corneal fibroblasts, since spreading and attachment were only partially blocked. Tenascin is present throughout the corneal stroma and mesenchyme early in development
Cell Biology International, Vol. 26, No. 2, 2002
141
0.2
2000 (A)
Absorbance at 600 nm
1500
Area (µm2)
(A)
POM/F7 POM/R29
1000
0
FN
TN Cells on matrix proteins
0.1
0
GL
FN
TN Cells on matrix proteins
GL
0.8
2000 (B) ***
(B)
CF/F7 CF/R29
Absorbance at 600 nm
1500
Area (µm2)
0.15
0.05
500
1000
CF/F7 CF/R29
0.6
0.4
0.2
500
0
POM/F7 POM/R29
0 FN
TN Cells on matrix proteins
GL
Fig. 10. Cells infected with antisense 1 integrin spread less well on fibronectin; this was significant only for corneal fibroblasts (b) and not periocular mesenchyme cells (a).
(Doane et al., 1996; Kaplony et al., 1991), but is restricted in its distribution in the fully differentiated eye (Kaplony et al., 1991). Tenascin can be either adhesive or anti-adhesive for cells (Bourdon and Ruoslahti, 1989; Chiquet-Ehrismann et al., 1988). Tenascin added to fibronectin-containing collagen gels disrupts corneal fibroblast migration on fibronectin (Andresen et al., 2000). Mesenchyme cells and corneal fibroblasts plated on tenascin exhibited a rounded morphology, few lamellipodia, and less spreading and attachment. As in other cell types (Fischer et al., 1997), 1 integrin was present in a punctate distribution rather than in elongated focal adhesions. Perturbation of 1 integrin func-
FN
TN Cells on matrix proteins
GL
Fig. 11. Antisense (clone R29) 1 integrin caused a decrease in attachment to fibronectin in periocular mesenchyme cells (a) and corneal fibroblasts (b), when compared to sense clone-infected cells (clone F7). Bars=standard error.
tion with CSAT produced little effect due to the low initial levels of binding. These data are consistent with our hypothesis that neither cell type exhibits strong cell-matrix interactions with tenascin that would allow lamellipodial extensions and a polarized phenotype, implying little functional cell-matrix binding to this protein during corneal development. The use of antisense is an alternative way to perturb function. Galileo et al. (1992) used a different retroviral construct containing a similar region of 1 to block the migration of neuroblasts in the developing brain. Expression of antisense
142
Cell Biology International, Vol. 26, No. 2, 2002
Fig. 12. Antisense 1 integrin caused focal adhesions that were sparse and disorganized in periocular mesechyme cells. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. POM cells on fibronectin: a, b; POM cells on tenascin: c, d. Sense-infected cells: a, c; antisense infected cells: b, d.
against integrin subunits caused a reduction in spreading and proliferation of cells (Davey et al., 1999), and decreased attachment of cranial neural crest cells to fibronectin (Kil et al., 1996). We used antisense 1 integrin in a retroviral construct, which yielded high levels of infection and caused a decrease in endogenous 1 protein. This resulted in decreased spreading and attachment on fibronectin, and caused an abnormal localization of 1. Focal adhesions were qualitatively fewer and more disorganized than when cells were infected with the 1 antisense construct and plated on fibronectin, supporting our hypothesis that both cell types use 1 integrin to interact with this matrix protein during development. In the present study, antisense retroviral construct perturbation of 1 integrin function resulted in decreases in spreading and attachment of cells on fibronectin similar to those seen with function-
blocking using antibody. Little effect of cellular interaction with tenascin was observed, due to the initial low levels of binding. These data are consistent with our hypothesis that corneal fibroblasts and periocular mesenchyme cells bind to a much greater extent to fibronectin than tenascin in vitro, and utilize 1 integrin during this interaction. This implies that cells may interact with these matrix proteins similarly in vivo. Further studies utilizing both of these experimental paradigms, both in vitro and in vivo, will lead to novel information regarding the role of matrix receptors in many developmental processes. ACKNOWLEDGEMENTS The authors thank Jan Stafinsky for excellent technical assistance and Dr Shiva Gautam for his
Cell Biology International, Vol. 26, No. 2, 2002
143
Fig. 13. Antisense 1 integrin caused focal adhesions that were sparse and disorganized in corneal fibroblasts. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. CF cells on fibronectin: a, b; CF cells on tenascin: c, d. Sense-infected cells: a, c; antisense infected cells: b, d.
help with the statistical analyses. This work was supported by NIH grants EY11036 and EY05129.
REFERENCES A JL, L T, H H, J K, E N, 2000. The influence of corneal stromal matrix proteins on the migration of human corneal fibroblasts. Exp Eye Res 71: 33–43. B MA, R E, 1989. Tenascin mediates cell attachment through an RGD-dependent receptor. J Cell Biol 108: 1149–1155. C-E R, K P, P CA, B K, C M, 1988. Tenascin interferes with fibronectin action. Cell 53: 383–390. C LM, F JL, F ML, B GS, P S, C GW, 1996. Molecular cloning and tissue distribution of keratocan. Bovine corneal keratan sulfate 37A. J Biol Chem 271: 9759–9763.
D G, B M, A RK, 1999. Reduced expression of 1 integrin prevents spreading-dependent cell proliferation. J Cell Sci 112: 4663–4672. D KJ, B DE, 1991. Fibroblasts retain their tissue phenotype when grown in three-dimensional collagen gels. Exp Cell Res 195: 432–442. D KJ, B DE, 1994. Differences in integrin expression during avian corneal stromal development. Invest Ophthalmol Vis Sci 35: 2834–2842. D KJ, Y G, B DE, 1992. Corneal cell-matrix interactions: type VI collagen promotes adhesion and spreading of corneal fibroblasts. Exp Cell Res 200: 490–499. D KJ, T W-H, M JS, B DE, 1996. Spatial and temporal variations in extracellular matrix of periocular and corneal regions during corneal stromal development. Exp Eye Res 62: 271–283. D KJ, H SJ, B DE, 1998. Identification and functional characterization of two type VI collagen receptors, 1 integrin and NG2, during avian corneal stromal development. Invest Ophthalmol Vis Sci 39: 263–275. D JP, T HM, 1986. High mutation rate of a spleen necrosis virus-based retrovirus vector. Mol Cell Biol 6: 4387–4395.
144
D JP, W R, Y SL, R BW, T HM, 1989. New retrovirus helper cells with almost no nucleotide sequence homology to retrovirus vectors. J Virol 63: 3209–3212. D S, D JL, K AR, T JP, 1988. The role of fibronectins in embryonic cell migrations. Trends Genet 4: 198–203. F KR, E C-JS, B K, 1989. The distribution of distinct integrins in focal contacts is determined by the substratum composition. J Cell Sci 92: 67–75. F D, T RP, C-E R, A JC, 1997. Cell-adhesive responses to tenascin-C splice variants involve formation of fascin microspikes. Mol Biol Cell 8: 2055–2075. F JL, C B, C GW, 1986. Keratan sulfate proteoglycan during embryonic development of the chicken cornea. Dev Biol 116: 267–277. G DS, M J, H AF, S JR, 1992. Retrovirally introduced antisense integrin RNA inhibits neuroblast migration in vivo. Neuron 9: 1117–1131. G MK, F JW, L TF, F JM, 1996. Temporal expression of types XII and XIV collagen mRNA and protein during avian corneal development. Dev Dyn 206: 49–58. H V, H H, 1951. A series of normal stages in the chick embryo. J Morph 88: 49–92. H GW, 1976. Biosynthesis of glycosaminoglycans during corneal development. J Biol Chem 251: 6513–6521. H ED, 1980. Development of the vertebrate cornea. Int Rev Cytol 63: 263–322. H Y, H B, R A, B D, H A, 1990. Expression and function of chicken integrin 1 subunit and its cytoplasmic domain mutants in mouse NIH 3T3 cells. J Cell Biol 110: 175–184. H A, D K, G R, D C, B C, 1985. The cell substrate attachment (CSAT) antigen has properties of a receptor for laminin and fibronectin. J Cell Biol 101: 2134–2144. H SJ, D KJ, 1998. Type VI collagen increases cell survival and prevents anti-1 integrin-mediated apoptosis. Exp Cell Res 241: 230–241. H RO, 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69: 11–25. H RO, Y KM, 1982. Fibronectins: multifunctional modular glycoproteins. J Cell Biol 95: 369–377. J MC, N DM, H RD, C JL, C AJ, 1979. Origins of avian ocular and periocular tissues. Exp Eye Res 29: 27–43. K A, Z DR, F RW, I BA, O BF, W KH, V L, 1991. Tenascin Mr 220 000 isoform expression correlates with corneal cell migration. Development 112: 605–614.
Cell Biology International, Vol. 26, No. 2, 2002
K SH, L T, B-F M, 1996. Inhibition of cranial neural crest adhesion in vitro and migration in vivo using integrin antisense oligonucleotides. Dev Biol 179: 91–101. K M, A K, V A, S S, S L, 1979. Fibronectin in the development of embryonic chick eye. Dev Biol 69: 589–600. L TF, B RR, M A, M R, 1986. Type VI collagen: immunohistochemical identification as a filamentous component of the extracellular matrix of the developing avian corneal stroma. Dev Biol 118: 425– 431. L TF, F JM, B DE, 1990. Heterotypic collagen fibrils and stabilizing collagens: controlling elements in corneal morphogenesis? Ann NY Acad Sci 580: 143–160. M SK, C JK, A S, 1993. Identification of integrins in cultured corneal fibroblasts and in isolated keratocytes. Invest Ophthalmol Vis Sci 34: 2690–2698. M R, B RG, M PM, B JR, 1993. Isolation and characterization of the chains of type V/type XI collagen present in bovine vitreous. J Biol Chem 268: 9381–9386. M T, F DA, D JP, B AMC, 1991. In vivo analysis of a new lacZ retrovirus vector suitable for cell lineage marking in avian and other species. Exp Cell Res 195: 516–523. M T, U H, F DA, W LT, M T, 1995. Fibroblast growth factor receptor is required for in vivo cardiac myocyte proliferation at early embryonic stages of heart development. Proc Natl Acad Sci (U.S.A.) 92: 467–471. N NT, L C, T A, D C, D C, B C, H A, 1982. A monoclonal antibody detaches embryonic skeletal muscle from extracellular matrices. J Cell Biol 95: 654–666. N D, T JP, 1980. Fibronectin in avian early embryos: synthesis and distribution along migration pathways of neural crest cells. Cell Tissue Res 211: 269– 291. N DM, 1975. An analysis of the migratory behavior of avian cephalic neural crest cells. Dev Biol 42: 106–130. N DM, 1978. The control of avian cephalic neural crest cytodifferentiation. I. Skeletal and connective tissues. Dev Biol 67: 296–312. S LM, H N, R DM, K IV, S D, P R, 1995. The human integrin betasign1 functions as a receptor for tenascin, fibronectin, and vitronectin. J Biol Chem 270: 23196–23202. S MP, 1994. Cell migration by graded attachment to substrates and contraction. Semin Cell Biol 5: 149–155.
PERTURBATION OF 1 INTEGRIN FUNCTION USING ANTI-SENSE OR FUNCTION-BLOCKING ANTIBODIES ON CORNEAL CELLS GROWN ON FIBRONECTIN AND TENASCIN KATHLEEN J. DOANE1*, RAKA BHATTACHARYA1† and JEFF MARCHANT2 1
Department of Anatomy, Northeastern Ohio Universities College of Medicine, 4209 State Route 44, P.O. Box 95, Rootstown, OH 44272-0095, U.S.A.; 2Department of Anatomy and Cellular Biology, Tufts University School of Medicine, U.S.A. Received 15 August 2000; accepted 24 July 2001; published electronically 28 November 2001
During corneal development, neural crest derivatives from the periocular mesenchyme migrate into the cornea and differentiate into corneal fibroblasts. During this time, these cells interact with a variety of extracellular matrices for proper orientation and development. In the present studies, we have examined the interaction of 1 integrins on periocular mesenchyme cells (POM) and corneal fibroblasts (CF) with fibronectin and tenascin by perturbing the function of this integrin. POM and CF attached and spread to a much greater extent on fibronectin than on tenascin. An antibody against 1 integrin, CSAT, decreased spreading and attachment, and resulted in a lack of immuno-detectable 1 integrin in focal adhesions on fibronectin; few 1 positive focal adhesions were observed in cells grown on tenascin. An anti-sense retroviral construct decreased endogenous levels of 1 integrin protein, and caused decreased attachment and spreading as well as sparse, disorganized focal adhesions. These data indicate that in vitro, both POM and CF have 1 integrins that interact with fibronectin and allow them to attach and spread, while tenascin is anti-adhesive. Further studies using both of these experimental 2001 Elsevier Science Ltd. paradigms will clarify whether these interactions also occur in vivo. K: cornea; fibronectin; tenascin; integrin; CSAT; anti-sense retroviral construct. A: E5, embryonic day 5; E14, embryonic day 14; POM, periocular mesenchyme cells; CF, corneal fibroblasts.
INTRODUCTION Interaction of embryonic cells with various extracellular matrices using cellular receptors is an essential component of development, causing a variety of cellular behaviors such as migration, proliferation, spreading and differentiation. Avian corneal stromal development requires that neural crest derivatives (Johnston et al., 1979; Noden, 1975, 1978) stationary within the juxtacorneal region at embryonic day 5 (E5), initiate migration into the cornea at E5.5 (Hay, 1980) along a spatially varied extracellular matrix containing *To whom correspondence and reprint requests should be addressed: Dr Kathleen J. Doane, Fax: (330) 325-5913. E-mail: [email protected] †Currently at University of South Florida/Veterans Administration Hospital. 1065–6995/02/020131+14 $35.00/0
the glycoproteins fibronectin and tenascin (Doane et al., 1996; Kaplony et al., 1991; Kurkinen et al., 1979). Once the cells encounter the primary stroma, comprised of collagens I, II, IX, XII, XIV and other glycoproteins and proteoglycans (Corpuz et al., 1996; Funderburgh et al., 1986; Gordon et al., 1996; Hart, 1976; Hay, 1980; Linsenmayer et al., 1986; Linsenmayer et al., 1990), they differentiate into corneal fibroblasts and begin synthesizing a specialized matrix, the secondary stroma (Hay, 1980). Establishment of proper optical function requires that the corneal fibroblasts deposit orthogonally-arranged collagen lamellae in a precise pattern for proper light refraction to occur (Hay, 1980). For normal development of the cornea, the migrating cells interact with a variety of 2001 Elsevier Science Ltd.
132
extracellular matrices by using multiple matrix receptors. Integrins are a major matrix receptor family responsible for cell-matrix interactions (Hynes, 1992), particularly during developmental stages. A variety of integrins are present in the avian cornea during development, and several of these receptors are known to interact with many of the matrix components present during this time (Doane and Birk, 1994; Doane et al., 1998). To understand the function of these receptors, it is useful to block their function. We have used two paradigms to block the function of 1 integrin in vitro: using a function blocking antibody, and using an antisense retroviral vector to deliver antisense to the cell and cause decreased levels of protein to be present. By blocking the function of matrix receptors while allowing cells to interact with specific extracellular matrix components in vitro, it is possible to characterize potential cellmatrix interactions that could occur in vivo. Two important extracellular matrix components present during corneal development are fibronectin and tenascin. Fibronectin is a major embryonic migratory substrate found in many embryonic migratory pathways (Dufour et al., 1988; Newgreen and Thiery, 1980). This glycoprotein is present in the cornea and periocular mesenchyme in abundance at E5 (Doane et al., 1996; Kurkinen et al., 1979), and is present only in the anterior stroma and Decemet’s membrane by E14, when the cornea is fully differentiated (Kurkinen et al., 1979). Fibronectin is present only in Decemet’s membrane in newborn chicken corneas (Kurkinen et al., 1979). Tenascin is a large, multidomain, multifunction glycoprotein present throughout the corneal stroma and periocular mesenchyme during early corneal stromal development (Doane et al., 1996; Kaplony et al., 1991), but much more restricted in its distribution by E14 (Kaplony et al., 1991). These findings suggest differentiation of function of these two matrix proteins during development. In contrast, other components which the cells encounter along the migratory pathway, such as decorin and collagens I and VI, are present early in development and are increased in amount by E14 (Doane et al., 1996; Linsenmayer et al., 1990). To analyse the functional role of fibronectin, tenascin, and 1 integrin heterodimers in corneal development, we have investigated the interaction of the undifferentiated periocular mesenchyme cell population, which contains the corneal fibroblast and scleral precursors, and fully differentiated corneal fibroblasts with fibronectin and tenascin. Using cell culture techniques, we asked whether both cell types adhere and spread on fibronectin
Cell Biology International, Vol. 26, No. 2, 2002
and tenascin and whether they use 1 in this adherence. To characterize the interaction of 1containing integrins, we perturbed 1 integrin function using the monoclonal antibody CSAT, which has been shown to bind 1 integrin and prevent its interaction with matrix (Neff et al., 1982). Additionally, we perturbed the function of 1 integrin using an antisense retroviral construct. These studies demonstrate the importance of 1 integrin interaction with fibronectin in development and indicate that tenascin is functioning as an anti-adhesive substrate for both cell types. These data also demonstrate that both function blocking antibodies and antisense retroviral vectors are useful methods for characterizing matrix receptor function.
MATERIALS AND METHODS Tissue Fertilized White Leghorn chicken eggs were purchased from Truslow Farms, Inc. (Chestertown, MD, U.S.A.), and were maintained at 37C in a humidified atmosphere. Embryos were harvested and staged according to Hamburger and Hamilton (1951). The following developmental stages were utilized: E5 (stage 26) and E14 (stage 40). These stages represent an undifferentiated, heterogeneous cell population containing both corneal fibroblast and scleral precursors (E5) and fully differentiated corneal fibroblasts (E14).
Cell culture POM cells were isolated from E5 avian eyes as previously described (Doane and Birk, 1994). Eyes were trimmed to approximately 3 mm around the cornea, the pigment epithelium and presumptive retina removed manually, and the remainder of the epithelium and endothelium removed by treatment with Versene (Life Technologies, Gaithersburg, MD, U.S.A.). The tissue was dissociated in 200 units/ml collagenase (Sigma Chemical Co., St Louis, MO, U.S.A.; type IV collagenase) in Complete Minimal Essential Medium (CMEM; Life Technologies, Gaithersburg, MD, U.S.A.) with antibiotics (50 g/ml gentamicin, 2.5 g/ml fungizone) and 2 mM glutamine. CFs were isolated from E14 embryonic corneas as previously described (Doane and Birk, 1991). Cells were grown in CMEM with 20% fetal bovine serum (CMEM-20) or CMEM-10 with 50 g/ml ascorbate
Cell Biology International, Vol. 26, No. 2, 2002
added. Cells from passages 1 to 3 were used in these studies. Matrix components Bovine plasma fibronectin was purchased from Sigma Chemical Co. (St Louis, MO, U.S.A.). Human tenascin, isolated from a glioblastoma cell line, was purchased from Life Technologies (Gaithersburg, MD, U.S.A.) or Sigma Chemical Co. (St Louis, MO, U.S.A.). Matrix coating of slides Fibronectin or tenascin, at a concentration of 20 g/ml in 20 mM carbonate, pH 9.6, were allowed to coat 5 mm2 well slides (CelLine, Newfield, NJ, U.S.A.) overnight at 4C. Matrixcoated and uncoated wells (for use as controls) were blocked in 2% bovine serum albumin in PBS, rinsed, and cells were applied at appropriate concentrations. Spreading assays Spreading assays were similar to published protocols (Doane et al., 1992). Wells (5 mm2) on Tefloncoated well slides (CelLine, Newfield, NJ, U.S.A.) were coated with 50 l of a 20 g/ml solution of matrix protein in 20 mM carbonate, pH 9.6. Slides were blocked in 2% bovine serum albumin in PBS, pH 7.5, and cells were added at a concentration of 5000 cells per well in CMEM with no serum present (CMEM-0). Cells were allowed to spread for 4 h, fixed in methanol/acetone, and air dried. BSAblocked glass served as a control matrix. The total area covered by cells was measured using a BioQuant Image Analysis System. A total of 5 cells per well, and 3 wells per experiment were quantified, with each experiment replicated 3 times. To analyse the data obtained from spreading assays, the analysis of variance (Anova) table for means test was used. This was followed by a Student Newman Keul’s test at 95% level of significance. When the Anova demonstrated unequal variances, pairwise t-test of variances were used to compare the P-value at a significance level. We have used P-values of significant levels at P<0.05 (*), P<0.01 (**) and P<0.001 (***).
133
Developmental Studies Hybridoma Bank (developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA 52242). For immunofluorescence localization of 1 integrin, another antibody from the Developmental Studies Hybridoma Bank, V2E9 (Hayachi et al., 1990), was used. -galactosidase was analysed using an antibody against this protein purchased from SigmaAldrich, Inc. (St Louis, MO, U.S.A.). Secondary antibodies were labelled with either a fluorescent tag (DTAF, a fluorescein derivative, or rhodamine) or with horseradish peroxidase, and were purchased from Jackson Laboratories (West Grove, PA, U.S.A.). Immunofluorescence procedure Cells were grown on matrix-coated or BSAblocked glass slides as described for spreading assays (Doane et al., 1992), then fixed in methanol and acetone at 20C and air dried. Non-specific binding sites were blocked by incubation in 2% normal goat serum, followed by addition of primary antibodies or control sera. Following incubation in fluorescent-labelled secondary antibodies, cells were coverslipped in VectaShield mounting medium (Vector Laboratories). Attachment assays Attachment assays were based on the method of Bourdon and Ruoslahti (1989). Microtitre 96 well plates were coated with 100 l of fibronectin or tenascin at the same concentration as used for spreading assays. BSA-blocked plastic served as a control matrix. Cells were allowed to attach for 4 h in CMEM-0, fixed in 4% buffered formaldehyde and stained with 1% toluidine blue in 1% sodium borate. Cells were solubilized in 1% SDS and optical density (OD 600 nm) read in a multiscan plate reader. CSAT perturbation of 1 integrin function CSAT was added to cells in culture medium (CMEM-0) at a concentration of 20 g/ml and serially diluted 1:1 such that the cell concentration remained constant. CellsCSAT were added to coated wells for use in attachment and spreading assays as outlined above.
Antibodies CSAT, a function-blocking mouse monoclonal antibody against the avian 1 subunit of integrin (Neff et al., 1982), was obtained from the
Cloning of the 1 chicken cDNA Chicken 1 integrin primers were designed using cDNA sequences which spanned the initiation
134
ATG. The 5 primer (5 GATCACTAGTCGC CAGCGCAGCTCCTG3 ) and 3 primer (5 GA TCACTAGTCTGCGTGGATCTGTGTAATG3 ) included SpeI sites to facilitate cloning. PCR using these primers and a chicken 1 cDNA generated a 460 bp product which was digested, gel purified and inserted into the SpeI-compatible, XbaI digested viral vector. PCR using a vector-specific primer and the 3 1 primer was performed to select sense and antisense insert orientations. Replication defective retroviral vectors Retroviral vectors, derived from spleen necrosis virus (SNV; Dougherty and Temin, 1986) were kindly provided by Dr Takashi Mikawa (Cornell University Medical College). As these vectors are replication defective, they must obtain missing protein in trans from packaging cells to be able to produce infectious virus particles (Dougherty et al., 1989; Mikawa et al., 1991). Once assembled into infectious viruses by these packaging cells, the viral particles can infect a wide variety of host cells. Since a packaging cell is required to produce infective virus, horizontal transmission of the virus is not possible in normal cells, and thus only progeny of infected cells will express the proviral transcripts. The pCXL vector contains the SNV promoter as well as sequences required for encapsidation of viral transcripts, reverse transcription and proviral integration (Mima et al., 1995). In addition, this vector contains the bacterial Lac Z gene downstream of the 1 insert. A translation initiation sequence derived from the murine leukemia virus gag gene is present in the 5 flanking sequence, which results in efficient expression of the reporter gene. Production of high titre recombinant virus The generation of infectious viral particles was achieved by co-transfection of packaging cells (NND17.2G) with the recombinant vectors and a selectable marker using Lipofectamine (Life Technologies; Dougherty et al., 1989). Packaging cells at a concentration of 2104 were transfected with a total of 2 g DNA comprised of recombinant vector and a pSV2-neo selection vector (in a 35:1 ratio). Clones that contained the selectable marker were selected by incubation in 400 g/ml geneticin (G418; Life Technologies) for a three to four week period. Cloning cylinders were used to isolate clonal lines; these were expanded initially in the presence of G418, which was discontinued after 2 weeks. For initial screening to determine infection
Cell Biology International, Vol. 26, No. 2, 2002
rates, culture medium from each clone was centrifuged to remove cellular debris, mixed with 10 mg/ ml polybrene (Sigma Chemical Co.) and used to infect corneal cells plated sparsely in 24 well plates for 2 h. Two days following infection, the cells were fixed in 2% paraformaldehyde in PBS and positive cells identified using an assay for -galactosidase activity (Mayne et al., 1993). As the -galactosidase was on the sense/antisense constructs, a high number of positive (blue) cells indicated a clonal line producing high titre retrovirus. To confirm the histochemical staining, immunofluorescence analyses were performed using an antibody against -galactosidase on cells adherent to fibronectin, tenascin and glass. These experiments confirmed that 80–90% of cells were immunopositive for this protein. One sense clone (F7) and one antisense clone (R29), both producing 80–90% X-gal positive cells, were chosen for all subsequent assays. Effects of anti-sense 1 integrin constructs To determine the effect of the antisense 1 integrin construct on levels of endogenous 1 integrin, cells infected with either the sense or the antisense construct were grown to confluency, isolated in 75 mM Tris, 225 mM NaCl, 0.15% SDS, and 1% NP-40, pH 7.4, and assayed for protein content using the BCA protein assay (Pierce Chemical, Rockford, IL). Equivalent levels of protein (10 g/ ml in gel sample buffer) were loaded into wells of a 7.5% SDS-polyacrylamide gel, transferred to nitrocellulose, and detected using the ECL (Enhanced Chemilluminescence; Amersham Life Science, Arlington Heights, IL, U.S.A.) protocol. The resulting data were scanned using a BioQuant Image Analysis system, and relative protein levels determined. To analyse the effect antisense 1 integrin had on attachment and spreading, assays were performed as detailed above, using either sense or antisense infected cells. To determine the effect the presence of the antisense contruct had on focal adhesions, immunofluorescence assays were performed as detailed above, again comparing sense and antisense infected cells.
RESULTS Cells spread and attached better on fibronectin than tenascin or glass To determine whether cells spread equally on the different glycoproteins fibronectin and tenascin,
Cell Biology International, Vol. 26, No. 2, 2002
135
Fig. 1. Cells spread better on fibronectin than tenascin. Phase contrast micrograph of periocular mesenchyme cells (a, c, e) and corneal fibroblasts (b, d, f) grown for 4 h in CMEM-0 on fibronectin (a, b), tenascin (c, d) and glass (e, f). Cells on fibronectin are polarized and well spread, while cells on tenascin are less spread than cells adherent to glass.
cells were allowed to adhere on these matrices for 4 h and their morphology was evaluated (Fig. 1). POM cells and CFs spread to a much greater extent on fibronectin than on tenascin or glass, as evidenced by microscopic analyses and computerassisted area measures. Both cell types exhibited a polarized morphology consisting of lamellipodial extensions when plated on fibronectin. When POM cells or CFs interacted with tenascin, they exhibited a rounded morphology, with few cellular processes evident. Both cell types appeared to spread and polarize better on BSA-blocked glass than on tenascin, indicating that tenascin prevented these functions. To quantitate cellular spreading, a Bio-Quant Image Analysis system was used to analyse the area (m2) covered by cells (Fig. 2). This method con-
firmed that both POM cells and CFs spread to a greater extent on fibronectin than glass (P<0.0001), and that tenascin is anti-adhesive for both POM cells (P<0.05) and CFs (P<0.001) when compared to glass. A quantitative comparison of spreading of both cell types on fibronectin indicated that POM cells spread better than CFs. Cellular adhesion was also evaluated, to determine whether equivalent numbers of cells attached to matrices but exhibited differences in spreading behavior. Attachment assays revealed that both cell types attached better to fibronectin, while no difference was observed in the basal levels of attachment seen when cells interacted with tenascin or BSA-blocked plastic (Fig. 3). As seen in the analysis of spreading assay data, POM cells appear to attach to a greater extent than do CFs.
136
Cell Biology International, Vol. 26, No. 2, 2002
4000 FN TN GL
*** 3000
Area (µm2)
***
2000 *
***
POM CF Cells on matrix proteins
Fig. 2. Cells covered a greater surface area when adherent to fibronectin (FN) than tenascin (TN). Quantitation of spreading assay (4 h in CMEM-0) indicated that both corneal fibroblasts (CF) and periocular mesenchyme cells (POM) covered more area (m2) than cells adherent to glass (GL). Cells on tenascin covered less surface area than cells on glass. ***, P<0.001; *, P<0.05; bars=standard error.
0.6 FN TN GL
0.5 Absorbance at 600 nm
MATRIX Fibronectin Tenascin Glass
1000
0
Table 1. CSAT at 20 g/ml caused a reduction in spreading for periocular mesenchyme cells (POM) and corneal fibroblasts (CF). Data are presented as the percent of reduction in spreading determined when spreading levels in the presence of CSAT were compared to spreading levels with CSAT not present. Too few corneal fibroblasts remained spread on tenascin and glass in the presence of CSAT to analyse spreading, so this calculation was not done (N.D.) POM
CF
36% reduction 67% reduction 41% reduction
73% reduction N.D. N.D.
monoclonal antibody known to block the function of 1 (CSAT) was utilized (Neff et al., 1982) in attachment and spreading assays. CSAT (at 20 g/ml) decreased spreading of POM cells on all matrices, and CFs on fibronectin; too few CFs remained spread in the presence of CSAT for analysis (Table 1). Likewise, POM cells required 1 integrin to a greater extent than CFs when adherent to fibronectin (Table 1). Blocking of 1 integrin using CSAT decreased attachment of both cell types on fibronectin; the low levels of attachment seen when cells were allowed to adhere to tenascin and BSA-blocked plastic were relatively unchanged (Fig. 4a,b).
0.4
Disruption of 1 integrin function by CSAT caused a loss of 1-integrin immunopositive focal adhesions from cells on fibronectin
0.3
0.2
0.1
0
POM CF Cells on matrix proteins
Fig. 3. Cells adhered better to fibronectin than to tenascin or glass. Attachment assay (4 h in CMEM-0) results indicated that cells adhered less well to tenascin or glass than to fibronectin.
To determine whether 1 integrin localization was affected by CSAT, cells were allowed to attach to fibronectin and tenascin for 4 h and used in immunofluorescence analyses. In the absence of CSAT, POM cells (Fig. 5) and CFs (Fig. 6) exhibited well-defined, organized 1-containing focal adhesions. When CSAT was used to block 1 integrin function, 1-positive focal adhesions were greatly reduced. On tenascin, few 1-positive focal adhesions were formed by either cell type. Sense and anti-sense retroviral clones infected cells at high levels
Disruption of 1 integrin function by CSAT caused decreased spreading and attachment of cells on fibronectin To analyse the role of 1 integrin in the interaction of corneal cells with fibronectin and tenascin, a
Over 80–90% of POM cells and CFs were infected with retrovirus as determined by histochemistry to identify the reporter gene product using either the X-gal assay histochemical procedure (Fig. 7), or immunofluorescence to identify -galactosidase
Cell Biology International, Vol. 26, No. 2, 2002
137
0.35 (A)
FN TN GL
Absorbance at 600 nm
0.3 0.25 0.2 0.15 0.1 0.05 0
0
2.5
5 10 CSAT (µg/ml)
20
0.2
Absorbance at 600 nm
(B)
FN TN GL
0.15
Antisense 1 integrin causes a decrease in endogenous 1 integrin protein levels
0.1
0.05
0
struct). Vector alone gave no blue reaction product (Fig. 7a). The sense (F7) construct showed similar levels of infectivity (data not shown). To confirm these analyses, cells were grown on fibronectin and analysed using an antibody against -galactosidase and immunofluorescence. Nuclei were stained with DAPI to document cell number (blue fluorescence) and the antibody was localized using a secondary antibody labelled with FITC (green fluorescence). Where nuclei appeared (Fig. 8a), immunopositive material was seen in a similar region (Fig. 8b; corneal fibroblasts infected with the sense construct), indicating the presence of this protein. The antisense construct showed similar levels of -galactosidase immunolocalization in cells grown on fibronectin (data not shown). Again, a high percentage of cells in many fields examined in this way showed positive immunofluorescence for this protein, confirming the X-gal histochemistry data that 80–90% of infected cells contained functional protein generated from the construct.
0
2.5
5 10 CSAT (µg/ml)
20
Fig. 4. CSAT caused a reduction in cellular attachment to fibronectin. At 20 g/ml, CSAT caused a decrease in attachment of periocular mesenchyme cells (a) and corneal fibroblasts (b) to fibronectin. No effect of this antibody on attachment to tenascin or glass was detectable due to low levels of attachment to these matrices.
when cells were plated on fibronectin (Fig. 8). Many clonal lines expressing retrovirus were screened, and one sense (F7) and one antisense (R29) cell line were chosen for further analysis. These cell lines made high titre retrovirus which expressed the reporter gene product, and were used for all subsequent analyses. Using X-gal histochemistry on cells infected with the antisense (R29) construct, many of the densely packed cells exhibited blue reaction product, indicative of the presence of functional -galactosidase protein (Fig. 7b; corneal fibroblasts infected with the antisense con-
To determine the effect of the presence of an antisense 1 integrin retroviral construct on endogenous levels of 1, infected cells were grown to confluence and subjected to Western blot analyses (Fig. 9). The resulting data were scanned using a BioQuant Image Analysis system, and the 1 integrin immunopositive bands quantitated as integrated density (log10 foreground÷ background). Equivalent levels of protein were present in each lane, and thus this analysis yielded numbers corresponding to relative levels of protein. When levels of protein in sense construct-infected cells were compared to antisense construct-infected cells, there was a 28% decrease in endogenous 1 integrin protein levels for POM cells, and a 36% decrease for CFs. Antisense 1 integrin caused a decrease in spreading and attachment of cells on fibronectin To analyse the effect antisense 1 integrin had on spreading and attachment, sense or antisense infected POM cells and CFs were allowed to attach to fibronectin, tenascin, and BSA-blocked glass or plastic, and subjected to spreading (Fig. 10) or attachment (Fig. 11) assay analysis as described in Materials and Methods. Little difference was observed when sense and antisense infected cells were allowed to adhere to tenascin or the control matrices, consistent with results observed in the
138
Cell Biology International, Vol. 26, No. 2, 2002
Fig. 5. CSAT caused a loss of immunodetectable 1 integrin from focal adhesions of periocular mesenchyme cells on fibronectin; cells adherent to tenascin did not localize 1 integrin to focal adhesions. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. POM cells on fibronectin: a, b; POM cells on tenascin: c, d. No CSAT present: a, c; 20 g/ml CSAT present: b, d.
presence of the 1 integrin function-blocking antibody CSAT. Also consistent with these data was an apparent decrease in spreading and attachment of both cell types on fibronectin when 1 integrin function was perturbed in the presence of antisense. This was significant only for spreading of CFs, however (P<0.001). Antisense 1 integrin causes fewer and less well-organized focal adhesions when cells are adherent to fibronectin To analyse the effect of the presence of antisense 1 integrin on the immunolocalization of 1 to focal adhesions, sense and antisense infected cells were subjected to immunofluorescence analyses. Sense infected POM cells (Fig. 12) and CFs (Fig. 13) exhibited prominent, well-organized focal adhesions when adherent to fibronectin; these were
consistent with 1 integrin-positive focal adhesions observed in uninfected cells (see Figs 5 & 6). The presence of antisense caused a reduction in apparent numbers of 1 integrin immunopositive focal adhesions, and a loss of the well-organized pattern of focal adhesions. As observed in uninfected cells, cells adherent on tenascin did not exhibit obvious focal adhesions, and this observation was unchanged whether cells were infected with sense or antisense 1 integrin constructs.
DISCUSSION For proper refraction of light, the cornea must be clear. The neural crest derivatives present within the periocular mesenchyme early in corneal development (Johnston et al., 1979; Noden, 1975, 1978) interact with a variety of extracellular matrices
Cell Biology International, Vol. 26, No. 2, 2002
139
Fig. 6. CSAT caused a loss of immunodetectable 1 integrin from focal adhesions of corneal fibroblasts on fibronectin; cells adherent to tenascin did not localize 1 integrin to focal adhesions. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. CF cells on fibronectin: a, b; CF cells on tenascin: c, d. No CSAT present: a, c; 20 g/ml CSAT present: b, d.
during their migration into the stroma, differentiation into corneal fibroblasts, and deposition of a transparent stroma. The matrix proteins fibronectin and tenascin have been implicated in this developmental process (Doane et al., 1996; Kaplony et al., 1991; Kurkinen et al., 1979), although their role is not understood. This study examined the interaction of the undifferentiated mesenchymal population (E5) and the differentiated cell population (E14) with fibronectin and tenascin. Since 1 integrins interact with both of these matrix proteins (Hynes, 1992; Schnapp et al., 1995), we perturbed the function of 1 using a function-blocking antibody and antisense retroviral construct to determine a potential role for 1-fibronectin or 1tenascin interactions during corneal development. Fibronectin is a major embryonic migratory substrate (Newgreen and Thiery, 1980), and is present throughout the developing corneal stroma and
sclera (Doane et al., 1996; Kurkinen et al., 1979), although in reduced amounts by embryonic day 14 in the chicken (Kurkinen et al., 1979). In vitro, we demonstrated that undifferentiated periocular mesenchyme cells and fully differentiated corneal fibroblasts attached and spread to a much greater extent on fibronectin than on tenascin. Focal adhesions, clustering of matrix receptors caused by binding to a ligand (Fath et al., 1989), were welldefined in cells on fibronectin. These findings are consistent with other reports, as many cells attach and spread well on fibronectin and have 1containing focal adhesions (Hynes and Yamada, 1982). Attachment, followed by extension of lamellipodia resulting in a spindle-shaped cell with a leading and a trailing edge, is involved in migration of fibroblasts (Sheetz, 1994). This polarized phenotype was observed in cells plated on fibronectin. The morphology and behavior of corneal cells
140
Fig. 7. X-gal histochemistry determined that 80–90% of cells were infected with functional retrovirally-derived protein. Corneal fibroblasts stained histochemically for blue reaction product generated by the presence of functional galactosidase. Uninfected corneal fibroblasts (a) did not contain any blue staining, while cells infected with the antisense (b) retroviral construct contained high levels of blue reaction product.
interacting with fibronectin is consistent with our hypothesis that cells interact with fibronectin during corneal development. Perturbation of 1 integrin function using CSAT decreased spreading and attachment of cells on fibronectin, and interfered with immunolocalization of 1 integrin in focal adhesions. Cell phenotype-specific responses to CSAT are documented, with some cells exhibiting decreased spreading and others remaining unaffected (Horwitz et al., 1985). Masur et al. (1993) documented an increase in rabbit corneal fibroblast spreading on fibronectin using a different 1integrin function-blocking antibody. We have documented a similar increase in spreading of CSAT-treated cells plated on type VI collagen (Howell and Doane, 1998), implying that the decrease we observed in the present study is due to the type of matrix used and not to the antibody. In
Cell Biology International, Vol. 26, No. 2, 2002
Fig. 8. Immunofluorescence confirmed the X-gal histochemistry. Corneal fibroblasts were stained with the nuclear stain DAPI to identify cells (a; blue fluorescence). In similar regions to DAPI identified cells, immunopositive staining for the presence of -galactosidase is seen (b; same field as in (a); green fluorescence).
Fig. 9. Levels of endogenous 1 integrin protein were decreased in the presence of the anti-sense 1 integrin as shown by Western blot analyses. SDS-PAGE followed by detection of 1 integrin by V2E9. Antisense (AS) infected periocular mesenchyme cells and corneal fibroblasts had a 28% and 36% reduction in integrin levels, respectively, when compared to sense (S) infected cells.
addition, our data suggest another receptor for fibronectin on both mesenchyme cells and corneal fibroblasts, since spreading and attachment were only partially blocked. Tenascin is present throughout the corneal stroma and mesenchyme early in development
Cell Biology International, Vol. 26, No. 2, 2002
141
0.2
2000 (A)
Absorbance at 600 nm
1500
Area (µm2)
(A)
POM/F7 POM/R29
1000
0
FN
TN Cells on matrix proteins
0.1
0
GL
FN
TN Cells on matrix proteins
GL
0.8
2000 (B) ***
(B)
CF/F7 CF/R29
Absorbance at 600 nm
1500
Area (µm2)
0.15
0.05
500
1000
CF/F7 CF/R29
0.6
0.4
0.2
500
0
POM/F7 POM/R29
0 FN
TN Cells on matrix proteins
GL
Fig. 10. Cells infected with antisense 1 integrin spread less well on fibronectin; this was significant only for corneal fibroblasts (b) and not periocular mesenchyme cells (a).
(Doane et al., 1996; Kaplony et al., 1991), but is restricted in its distribution in the fully differentiated eye (Kaplony et al., 1991). Tenascin can be either adhesive or anti-adhesive for cells (Bourdon and Ruoslahti, 1989; Chiquet-Ehrismann et al., 1988). Tenascin added to fibronectin-containing collagen gels disrupts corneal fibroblast migration on fibronectin (Andresen et al., 2000). Mesenchyme cells and corneal fibroblasts plated on tenascin exhibited a rounded morphology, few lamellipodia, and less spreading and attachment. As in other cell types (Fischer et al., 1997), 1 integrin was present in a punctate distribution rather than in elongated focal adhesions. Perturbation of 1 integrin func-
FN
TN Cells on matrix proteins
GL
Fig. 11. Antisense (clone R29) 1 integrin caused a decrease in attachment to fibronectin in periocular mesenchyme cells (a) and corneal fibroblasts (b), when compared to sense clone-infected cells (clone F7). Bars=standard error.
tion with CSAT produced little effect due to the low initial levels of binding. These data are consistent with our hypothesis that neither cell type exhibits strong cell-matrix interactions with tenascin that would allow lamellipodial extensions and a polarized phenotype, implying little functional cell-matrix binding to this protein during corneal development. The use of antisense is an alternative way to perturb function. Galileo et al. (1992) used a different retroviral construct containing a similar region of 1 to block the migration of neuroblasts in the developing brain. Expression of antisense
142
Cell Biology International, Vol. 26, No. 2, 2002
Fig. 12. Antisense 1 integrin caused focal adhesions that were sparse and disorganized in periocular mesechyme cells. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. POM cells on fibronectin: a, b; POM cells on tenascin: c, d. Sense-infected cells: a, c; antisense infected cells: b, d.
against integrin subunits caused a reduction in spreading and proliferation of cells (Davey et al., 1999), and decreased attachment of cranial neural crest cells to fibronectin (Kil et al., 1996). We used antisense 1 integrin in a retroviral construct, which yielded high levels of infection and caused a decrease in endogenous 1 protein. This resulted in decreased spreading and attachment on fibronectin, and caused an abnormal localization of 1. Focal adhesions were qualitatively fewer and more disorganized than when cells were infected with the 1 antisense construct and plated on fibronectin, supporting our hypothesis that both cell types use 1 integrin to interact with this matrix protein during development. In the present study, antisense retroviral construct perturbation of 1 integrin function resulted in decreases in spreading and attachment of cells on fibronectin similar to those seen with function-
blocking using antibody. Little effect of cellular interaction with tenascin was observed, due to the initial low levels of binding. These data are consistent with our hypothesis that corneal fibroblasts and periocular mesenchyme cells bind to a much greater extent to fibronectin than tenascin in vitro, and utilize 1 integrin during this interaction. This implies that cells may interact with these matrix proteins similarly in vivo. Further studies utilizing both of these experimental paradigms, both in vitro and in vivo, will lead to novel information regarding the role of matrix receptors in many developmental processes. ACKNOWLEDGEMENTS The authors thank Jan Stafinsky for excellent technical assistance and Dr Shiva Gautam for his
Cell Biology International, Vol. 26, No. 2, 2002
143
Fig. 13. Antisense 1 integrin caused focal adhesions that were sparse and disorganized in corneal fibroblasts. Immunofluorescence assay using V2E9, a monoclonal antibody against chicken 1 integrin, followed by a fluorescently labelled secondary antibody. CF cells on fibronectin: a, b; CF cells on tenascin: c, d. Sense-infected cells: a, c; antisense infected cells: b, d.
help with the statistical analyses. This work was supported by NIH grants EY11036 and EY05129.
REFERENCES A JL, L T, H H, J K, E N, 2000. The influence of corneal stromal matrix proteins on the migration of human corneal fibroblasts. Exp Eye Res 71: 33–43. B MA, R E, 1989. Tenascin mediates cell attachment through an RGD-dependent receptor. J Cell Biol 108: 1149–1155. C-E R, K P, P CA, B K, C M, 1988. Tenascin interferes with fibronectin action. Cell 53: 383–390. C LM, F JL, F ML, B GS, P S, C GW, 1996. Molecular cloning and tissue distribution of keratocan. Bovine corneal keratan sulfate 37A. J Biol Chem 271: 9759–9763.
D G, B M, A RK, 1999. Reduced expression of 1 integrin prevents spreading-dependent cell proliferation. J Cell Sci 112: 4663–4672. D KJ, B DE, 1991. Fibroblasts retain their tissue phenotype when grown in three-dimensional collagen gels. Exp Cell Res 195: 432–442. D KJ, B DE, 1994. Differences in integrin expression during avian corneal stromal development. Invest Ophthalmol Vis Sci 35: 2834–2842. D KJ, Y G, B DE, 1992. Corneal cell-matrix interactions: type VI collagen promotes adhesion and spreading of corneal fibroblasts. Exp Cell Res 200: 490–499. D KJ, T W-H, M JS, B DE, 1996. Spatial and temporal variations in extracellular matrix of periocular and corneal regions during corneal stromal development. Exp Eye Res 62: 271–283. D KJ, H SJ, B DE, 1998. Identification and functional characterization of two type VI collagen receptors, 1 integrin and NG2, during avian corneal stromal development. Invest Ophthalmol Vis Sci 39: 263–275. D JP, T HM, 1986. High mutation rate of a spleen necrosis virus-based retrovirus vector. Mol Cell Biol 6: 4387–4395.
144
D JP, W R, Y SL, R BW, T HM, 1989. New retrovirus helper cells with almost no nucleotide sequence homology to retrovirus vectors. J Virol 63: 3209–3212. D S, D JL, K AR, T JP, 1988. The role of fibronectins in embryonic cell migrations. Trends Genet 4: 198–203. F KR, E C-JS, B K, 1989. The distribution of distinct integrins in focal contacts is determined by the substratum composition. J Cell Sci 92: 67–75. F D, T RP, C-E R, A JC, 1997. Cell-adhesive responses to tenascin-C splice variants involve formation of fascin microspikes. Mol Biol Cell 8: 2055–2075. F JL, C B, C GW, 1986. Keratan sulfate proteoglycan during embryonic development of the chicken cornea. Dev Biol 116: 267–277. G DS, M J, H AF, S JR, 1992. Retrovirally introduced antisense integrin RNA inhibits neuroblast migration in vivo. Neuron 9: 1117–1131. G MK, F JW, L TF, F JM, 1996. Temporal expression of types XII and XIV collagen mRNA and protein during avian corneal development. Dev Dyn 206: 49–58. H V, H H, 1951. A series of normal stages in the chick embryo. J Morph 88: 49–92. H GW, 1976. Biosynthesis of glycosaminoglycans during corneal development. J Biol Chem 251: 6513–6521. H ED, 1980. Development of the vertebrate cornea. Int Rev Cytol 63: 263–322. H Y, H B, R A, B D, H A, 1990. Expression and function of chicken integrin 1 subunit and its cytoplasmic domain mutants in mouse NIH 3T3 cells. J Cell Biol 110: 175–184. H A, D K, G R, D C, B C, 1985. The cell substrate attachment (CSAT) antigen has properties of a receptor for laminin and fibronectin. J Cell Biol 101: 2134–2144. H SJ, D KJ, 1998. Type VI collagen increases cell survival and prevents anti-1 integrin-mediated apoptosis. Exp Cell Res 241: 230–241. H RO, 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69: 11–25. H RO, Y KM, 1982. Fibronectins: multifunctional modular glycoproteins. J Cell Biol 95: 369–377. J MC, N DM, H RD, C JL, C AJ, 1979. Origins of avian ocular and periocular tissues. Exp Eye Res 29: 27–43. K A, Z DR, F RW, I BA, O BF, W KH, V L, 1991. Tenascin Mr 220 000 isoform expression correlates with corneal cell migration. Development 112: 605–614.
Cell Biology International, Vol. 26, No. 2, 2002
K SH, L T, B-F M, 1996. Inhibition of cranial neural crest adhesion in vitro and migration in vivo using integrin antisense oligonucleotides. Dev Biol 179: 91–101. K M, A K, V A, S S, S L, 1979. Fibronectin in the development of embryonic chick eye. Dev Biol 69: 589–600. L TF, B RR, M A, M R, 1986. Type VI collagen: immunohistochemical identification as a filamentous component of the extracellular matrix of the developing avian corneal stroma. Dev Biol 118: 425– 431. L TF, F JM, B DE, 1990. Heterotypic collagen fibrils and stabilizing collagens: controlling elements in corneal morphogenesis? Ann NY Acad Sci 580: 143–160. M SK, C JK, A S, 1993. Identification of integrins in cultured corneal fibroblasts and in isolated keratocytes. Invest Ophthalmol Vis Sci 34: 2690–2698. M R, B RG, M PM, B JR, 1993. Isolation and characterization of the chains of type V/type XI collagen present in bovine vitreous. J Biol Chem 268: 9381–9386. M T, F DA, D JP, B AMC, 1991. In vivo analysis of a new lacZ retrovirus vector suitable for cell lineage marking in avian and other species. Exp Cell Res 195: 516–523. M T, U H, F DA, W LT, M T, 1995. Fibroblast growth factor receptor is required for in vivo cardiac myocyte proliferation at early embryonic stages of heart development. Proc Natl Acad Sci (U.S.A.) 92: 467–471. N NT, L C, T A, D C, D C, B C, H A, 1982. A monoclonal antibody detaches embryonic skeletal muscle from extracellular matrices. J Cell Biol 95: 654–666. N D, T JP, 1980. Fibronectin in avian early embryos: synthesis and distribution along migration pathways of neural crest cells. Cell Tissue Res 211: 269– 291. N DM, 1975. An analysis of the migratory behavior of avian cephalic neural crest cells. Dev Biol 42: 106–130. N DM, 1978. The control of avian cephalic neural crest cytodifferentiation. I. Skeletal and connective tissues. Dev Biol 67: 296–312. S LM, H N, R DM, K IV, S D, P R, 1995. The human integrin betasign1 functions as a receptor for tenascin, fibronectin, and vitronectin. J Biol Chem 270: 23196–23202. S MP, 1994. Cell migration by graded attachment to substrates and contraction. Semin Cell Biol 5: 149–155.