- Email: [email protected]
Phenotype in a patient with p.D50N mutation in GJB2 gene resemble both KID and Clouston syndromes
International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
Case report
Phenotype in a patient with p.D50N mutation in GJB2 gene resemble both KID and Clouston syndromes T.G. Markova a,1, N.B. Brazhkina b,2, E.A. Bliznech c,3, V.V. Bakhshinyan d,4, A.V. Polyakov c,5, G.A. Tavartkiladze e,* a
Department the Epidemiology and Genetics of Hearing Loss, National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia Out-Patient Clinic, National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia c Laboratory for DNA-Diagnostics, Federal State Budgetary Institution ‘‘Research Centre for Medical Genetics’’, 1, Room 116 Moskvorechie Str, 115478 Moscow, Russia d Cochlear Implants Center, National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia e National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 22 September 2015 Received in revised form 13 November 2015 Accepted 18 November 2015 Available online 9 December 2015
Keratitis–ichthyosis–deafness (KID) syndrome (OMIM 148210) is a rare ectodermal dysplasia syndrome characterized by vascularizing keratitis, congenital profound sensorineural hearing loss, and progressive erythrokeratoderma. We have found a 148G-A transition in the GJB2 gene, resulting in an asp50-to-asn (D50N) substitution in a girl with congenital deafness. This finding allowed us to diagnose a KID syndrome. But clinical features were uncommon because of a mild skin manifestation, lack of keratitis and unusual appearance resembling Clouston syndrome. Molecular genetic tests showed that it was de novo mutation because parents have normal genotype. Several autosomal dominant mutations in the GJB2 gene (Fonnexin 26) now established to underlie many of the affected cases, with the majority of patients harboring the p.D50N mutation. Skin disease-associated mutation of connexin proteins can cause functional disturbances in gap junction intercellular conductance. It is likely that multiple disease mechanisms are involved across the wide spectrum of hereditary diseases relating to connexin proteins. The clinical data may provide additional insights into the dysregulation mechanisms of mutations result in the disease. ß 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Hereditary hearing loss Keratitis–ichthyosis–deafness syndrome Clouston syndrome GJB2 and GJB6 gene mutation Connexin26
1. Introduction Keratitis–ichthyosis–deafness (KID) syndrome (OMIM 148210) is a rare ectodermal dysplasia syndrome characterized by vascularizing keratitis, congenital profound sensorineural hearing loss, and progressive erythrokeratoderma, a clinical trial that indicates a failure in the development and differentiation of multiple stratifying epithelia [1–4]. Clinical descriptions of a KID
* Corresponding author. Tel.: +7 4997496098. E-mail addresses: [email protected] (T.G. Markova), [email protected] (E.A. Bliznech), [email protected] (V.V. Bakhshinyan), [email protected] (A.V. Polyakov), [email protected] (G.A. Tavartkiladze). 1 Tel.: +7 9266331209. 2 Tel.: +7 4997496105. 3 Tel.: +7 9152993670. 4 Tel.: +7 9266777282. 5 Tel.: +7 4959719152. http://dx.doi.org/10.1016/j.ijporl.2015.11.022 0165-5876/ß 2015 Elsevier Ireland Ltd. All rights reserved.
syndrome and molecular-genetic diagnostics have usually been initiated by considerable changes from skin and hair which can be accompanied bilateral sensorineural deafness. Therefore the majority of articles devoted to the syndrome, are published in the dermatological magazines [5–9]. According to the investigations the KID syndrome is more commonly caused by GJB2 mutations [10–14]. One of these mutation D50N (p.Asp50Asn) is leading to substitution of conserved residues in the cytoplasm amino terminus or first extracellular domain of connexin 26 (Cx26), which is crucial for voltage gating and connexon–connexon interactions. Some other dominant mutations in GJB2 gene have been reported predominantly in Caucasians and are responsible for the production of both nonsyndromal and syndromal hearing loss associated with diverse skin disorders [15–18]. MazereeuwHautier [5] performed clinical examination and molecular analysis of GJB2 in a cohort of 14 patients with KID syndrome originating from 11 families. 64% of cases were sporadic. Twelve patients were heterozygous for the p.Asp50Asn mutation and two patients were heterozygous for the p.Ser17Phe mutation. Multiple
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
phenotypesconsist of more than 5 different phenotypes: diffuse palmoplantar keratoderma (PPK) and hyperkeratosis, Vohwinkel syndrome, Keratitis–Ichthyosis–Deafness syndrome (KID), Bart– Pumphrey syndrome and DFNA3 [7,19–22]. The particular phenotype appears to depend both on the type of mutation and its location [21]. Keratitis–ichthyosis–deafness (KID) syndrome is characterized by cutaneous, auditory and ophthalmologic abnormalities. The most frequent clinical features were sensorineural deafness (90%), erythrokeratoderma(89%), vascularizing keratitis (79%), alopecia (79%), and reticulated hyperkeratosis of the palms and soles (41%). The KID acronym does not accurately define this entity since the disorder is not an ichthyosis, because scaling is not the main cutaneous feature and not all patients have keratitis early in the course [23–29]. Griffith [25] conducted correlative clinical, molecular genetic, and postmortem histopathologic analysis. The subject was heterozygous for G45E mutation of GJB2, which previously reported for KID syndrome. The primary inner ear abnormality was dysplasia of the cochlear and saccular neuroepithelium. Tsuzuku [30] revealed cochleosaccular abnormality during temporal bone studies. Additional concomitant phenomena of the KID syndrome are dystrophic nails, dental abnormalities, scarring alopecia, and vascularizing keratitis [31]. Nyquist [32] reported on two young adults with KID syndrome and follicular hyperkeratosis who developed metastatic malignant pillar tumors. Szymko-Bennett [33] concluded that the sensorineural hearing loss in KID syndrome is generally prelingual, bilateral and profound. Todt [34] provided evidence for functionally intact semicircular canals and normal utricular function in subjects with the autosomal dominant D50 N mutation of Cx26, in contrast to saccular function which was generally compromised and hearing loss which was profound. Watanabe [35] described a patient with generalized hyperkeratosis associated with keratitis and hearing defect. Patient’s skin was moderately hyperkeratotic at the birth and the thickness of the skin increased progressively during childhood. Bilateral sensorineural deafness was recognized at the age of 3 years and visual disturbance was noted in later childhood. Kellermayer [36] reported the bigenic connexin inheritance in patient with KID syndrome. Cochlear implantation in children with keratitis–ichthyosis–deafness (KID) syndrome was described in some cases [37,38]. In 2004 Jan [39] indicated genetic heterogeneity of KID syndrome. Mutation in GJB6 (connexin30) was found in a child with KID syndrome and congenital atrichia. Some mutations in the GJB6 are considered to be responsible for the Clouston syndrome. Clouston syndrome (MIM129500) is a rare autosomal dominant hidrotic ectodermal dysplasia syndrome characterized by alopecia or hypotrichosis, palmoplantar hyperkeratosis, and nail dystrophy. Dysplastic nails are the most common feature. Hearing loss and keratitis are not the symptoms of this syndrome. In 2004 van Steensel [40] described a patient who had phenotype resembling the Clouston syndrome with thin hair, deafness, nail dystrophy, and mild erythrokeratoderma. A novel spontaneous missense mutation N14K in heterozygous state of GJB2 gene was found. This mutation is near of two residues mutated in KID syndrome (G12R and S17F). The patient phenotype associated with N14K strongly differed from the KID syndrome. The patient had mild scalp hypotrichosis with lank, blonde hair some sharply demarcated erythematous plaques with some desquamation. Slight frontal bossing with seemingly deep-set eyes and 20-nail dystrophy were seen. In the neck a papular exanthema was present but no other signs of atopic eczema. No other abnormalities were present. The occurrence of nail dystrophy with hypotrichosis suggests the Clouston syndrome, but deafness is not normally part of the Clouston syndrome phenotype. Authors considered the possibility of a novel variant of the Clouston syndrome, but they found out phenotype association with a GJB2 mutation.
11
Connexin 26 (GJB2) and the closely related connexin 30 (GJB6) showed differential expression in epidermal, adnexal, and corneal epithelia but were not significantly altered in lesional skin. Connexin 26 is a component of the gap junction channels in the epidermis and in the stria vascularis of the cochlea. These channels play a role in the coordinated exchange of molecules and ions occurring in a wide spectrum of cellular activities. Connexins are now known to be also capable of forming functional hemichannels in nonjunctional membranes, linking cytoplasm of a cell with its extracellular microenvironment. Hemichannels have an unclear role, but there is some evidence showing that their activity can be altered under certain pathological conditions. Mutant connexin 26 was incapable of inducing intercellular coupling in vitro, which indicates its functional impairment. Decreased host defense and increased carcinogenic potential in KID syndrome illustrate that gap junction communication plays not only a crucial role in epithelial homeostasis and differentiation but also in immune response and epidermal carcinogenesis [41–43]. Previous data reveal striking genotype-phenotype correlations and demonstrate that dominant GJB2 mutations can disturb the gap junction system of one or several ectodermal epithelia [44,45]. Several studies emphasized that skin disease-associated autosomal dominant mutations of connexin protein can cause functional disturbances in gap junction intercellular conductance. Such mutations commonly produce channels with distinctly altered gating and permeability properties. On the contrary, autosomal recessive mutations with loss-of-function mechanism responsible for nonsyndromal deafness without skin abnormalities. Functional consequences of N14Y and N14K was assessed and compared with that of the classical KID mutation D50N. The results of analyses show that these mutations have different effects for protein localization and gap junction permeability. It is likely that multiple disease mechanisms are involved across the wide spectrum of hereditary diseases relating to connexin proteins [46,47]. 2. Methods To perform the connexin 26 and connexin 30 tests, a DNA sample is obtained and gene sequence is compared to that of the regularly occurring sequence to look for changes. DNA samples preparation. Genomic DNA was extracted from airdried buccalepithelium using a DIAtomTM DNA Prep100 kit (Isogene Lab.ltd., Russia) according to the manufacturer’s instruction. DNA-sequencing for GJB2 and GJB6 genes. Sequencing for coding exon 2 in GJB2 gene and coding exon 3 in GJB6 gene was performed after PCR. 50 –30 primer sequences are Cx26 F-GTGATTCCTGTGTTGTGTGCATTC and Cx26R-CCTCATCCCTCTCATGCTGTC; Cx30F1CCTCTTCCACTAATAAACCTTTGC and Cx30R1-GGAAAAAGATGCTGCTGGTGTAC; Cx30F2 GAATGATTTCAAAGACATAGAGGAC and Cx30R2-AGAAGACAGAAGTCTCCTTATGAC. DNA-sequencing for PCR fragments was carried out by using the ABI Dye Terminator, version 1 (Applied Biosystems, USA) and was ran on a 3130 ABI genetic analyzer (Applied Biosystems, USA). Sequences were aligned using Chromas version 2 (Technelysium). The reference cDNA sequences were obtained from NCBI Reference Sequence Database (NM_004004.5 for GJB2 gene and NM_001110221.2 for GJB6 gene). 3. Result and discussion 3.1. Case report The patient is 4-y-old girl with congenital hearing loss and mild features of atopic dermatitis, crumpled dry palms. She has normal
12
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
hearing non-consanguineous parents. There are no other sibs andthe family history was unremarkable. The atopic eczema had appeared at the age of 2 month. There were some erythematous plagues. Parents have paid attention to the absence of the reactions to sounds at the age of 6 months. At the age of 9 months the first audiological examination was performed in the Vladivostok Regional Audiological Center where the bilateral mild-tomoderate sensorineural hearing loss was diagnosed. The speech therapy started at the age of 2 years was not successful and child was sent to the National Research Center for Audiology and hearing Rehabilitation (Moscow) where the severe bilateral sensorineural hearing loss was diagnosed at the age of 2 years and 6 months. After investigation the bilateral amplification (prior to cochlear implantation) was recommended and Widex SV-38 hearing aids were prescribed. Unfortunately after one year of hearing aid use results of hearing and speech development were unsutisfactory and in 2008 at the age of 3 years and 6 months the unilateral cochlear implantation was performed (CI Nucleus Freedom with Contour Advance Electrode (CI24RE (CD)). During the first year of rehabilitation the progress was slow but after 3 years the child has achieved success in speech and hearing development and entered the regular school. At the age of 10 she demonstrated 100% intelligibility of conventional and commonly used words. The intelligibility of the meaningless syllables and sounds was 70%. Upon the first examination the clinical geneticist noticed the slight unusual appearance of the child. The girl had deepset eyes, hypotrichosis of the head with thin blonde hair (Fig. 1A), dryness of the skin, especially on an external surface of shoulders and an internal surface of palms with striation of thenar and hypothenar eminences (Fig. 1B). Appearance of the child was sharply differed from the parents. Considering congenital character of deafness, the diagnostics of CJB2 gene mutations was recommended. DNA analysis identified a 148G-A transition in the GJB2 gene, resulting in an asp50-to-asn substitution. According to the literature the D50N mutation is the main reason for KID syndrome. Parents were unaffected and mutation D50N was not present in their blood samples. After that we repeated clinical examination but did not find any dramatic symptoms of keratitis–ichthyosis–deafness syndrome except for the dry skin, crumpled dry palms, sparse and depigmented hair, hypoplastic nails (Fig. 1C). There were no signs of keratitis. At the photographs of newborn period some cutaneous changes were apparent. There were clearly visible specific, changes of palm skin, a thickening of a skin as an orangepeel. We concluded that it was mild clinical presentation of KID syndrome. Additional DNA analysis excluded CJB6 gene mutations including those detected in cases with Clouston syndrome. 3.2. Discussion Genetic heterogeneity is a major problem in nonsyndromal hearing loss. However the most common cause of congenital hearing impairment is the mutations in the GJB2 gene. Clinical features do not allow to make out syndrome diagnosis and correct genetic counselling. Nowadays molecular genetic tests provide possibility to identify the main cause of congenital hearing loss. Frequent involvement of the connexin 26 gene simplifies the first step of the molecular diagnostics of the hereditary hearing loss. It is important to eliminate GJB2-associated deafness in any children with congenital or prelingual hearing loss. The combination of congenital hearing loss with skin hyperkeratosis is a rare pathology. Only 11 families affected by this disorder were described in the literature during the last 30 years. Nowadays there are no more than 50 cases of this condition known in the world. Modern molecular methods revealed in all such patients a mutation in GJB2 gene as a primary cause of the disease.
Fig. 1. The patient’s phenotype: (A) note the frontal bossing, seemingly deep-set eyes, hypotrichosis and thin blonde hair, (B) dry palms with striation of thenar and hypothenar eminences, (C) the fingernails are dystrophic.
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
The phenotype described in our patient, as well as in the article of van Steensel [12,46] resembled a clinical picture of Clouston syndrome. Interestingly the congenital hearing disorder and infringements in a gene GJB2 are not typical for Clouston syndrome but on the contrary are typical for KID syndrome. We take into account that D50N mutation is the main reason for KID syndrome and the chance of clinical heterogeneity. We considered the possibility of a novel phenotype variant of the KID syndrome. The clinical data may provide additional insights into the dysregulation mechanisms of mutations linked to the disease. Whereas audiologist should first determine the severity and type of hearing loss genetic counseling is especially important for the deaf and those with less hearing loss because of the associated high frequency of genetic and syndromal etiology. Counseling can rule out syndromes and their associated complications, correct erroneous perceptions, and ensure that the consultant receives appropriate medical evaluations [24,29]. There are already at least two cases which demonstrate that genetic counselling of hearing loss should start with connexin 26 gene analyses to exclude any unexpected results or coincidence in hearing loss etiology.
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
Appendix A. Supplementary data [25]
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijporl.2015.11.022.
[26] [27]
References [1] W.A. Nowell, Keratitis, ichthyosis, and deafness (KID) syndrome: suggested. changes in terminology, Arch. Dermatol. 124 (1) (1988) 22. [2] G. Richard, F. Rouan, C.E. Willoughby, N. Brown, P. Chung, M. Ryyna¨nen, et al., Missense mutations in. GJB2 encoding connexin-26 cause the ectodermal dysplasia keratitis–ichthyosis–deafness syndrome, Am. J. Hum. Genet. 70 (5) (2002) 1341–1348. [3] G. Richard, T.W. White, L.E. Smith, R.A. Bailey, J.G. Compton, D.L. Paul, et al., Functional defects of Cx26 resulting from a heterozygous missense mutation in a family with dominant deaf-mutism and palmoplantar keratoderma, Hum. Genet. 103 (4) (1998) 393–399. [4] G.N. Wilson, R.H. Squires Jr., A.G. Weinberg, Keratitis, hepatitis, ichthyosis, and deafness: report and review of KID syndrome, Am. J. Med. Genet. 40 (3) (1991) 255–259. [5] J. Mazereeuw-Hautier, E. Bitoun, J. Chevrant-Breton, S.Y. Man, C. Bodemer, C. Prins, et al., Keratitis–ichthyosis–deafness syndrome: disease expression and spectrum of connexin 26 (GJB2) mutations in 14 patients, Br. J. Dermatol. 156 (5) (2007) 1015–1019. [6] L. Miteva, Keratitis, ichthyosis, and deafness (KID) syndrome, Pediatr. Dermatol. 19 (6) (2002) 513–516. [7] L. Maintz, R.C. Betz, J.P. Allam, J. Wenzel, A. Jaksche, N. Friedrichs, et al., Keratitis– ichthyosis–deafness syndrome in association with follicular occlusion triad, Eur. J. Dermatol. 15 (5) (2005) 347–352. [8] T. Lazic, K.A. Horii, G. Richard, D.I. Wasserman, R.J. Antaya, A report of GJB2 (N14K) Connexin 26 mutation in two patients–a new subtype of KID syndrome? Pediatr. Dermatol. 25 (5) (2008) 535–540. [9] K. Langer, K. Konrad, K. Wolff, Keratitis, ichthyosis and deafness (KID)- syndrome: report of three cases and a review of the literature, Br. J. Dermatol. 122 (5) (1990) 689–697. [10] A. Alvarez, I. del Castillo, A. Pera, M. Villamar, M.A. Moreno-Pelayo, F. Moreno, et al., De novo mutation in the gene encoding connexin-26 (GJB2) in a sporadic case of keratitis–ichthyosis–deafness (KID) syndrome, Am. J. Med. Genet. A 117A (1) (2003) 89–91. [11] S. Arndt, A. Aschendorff, C. Schild, R. Beck, W. Maier, R. Laszig, et al., A novel dominant and a de novo mutation in the GJB2 gene (connexin-26) cause keratitis– ichthyosis–deafness syndrome: implication for cochlear implantation, Otol. Neurotol. 31 (2) (2010) 210–215. [12] A.R. Janecke, H.C. Hennies, B. Gunther, G. Gansl, J. Smolle, E.M. Messmer, et al., GJB2 mutations in keratitis–ichthyosis–deafness syndrome including its fatal form, Am. J. Med. Genet. A 133A (2005) 128–131. [13] S. Yotsumoto, T. Hashiguchi, X. Chen, N. Ohtake, A. Tomitaka, H. Akamatsu, et al., Novel mutations in GJB2 encoding connexin-26 in Japanese patients with keratitis–ichthyosis–deafness syndrome, Br. J. Dermatol. 148 (4) (2003) 649–653. [14] F. Rouan, T.W. White, N. Brown, A.M. Taylor, T.W. Lucke, D.L. Paul, et al., Transdominant inhibition of connexin-43 by mutant connexin-26: implications for dominant connexin disorders affecting epidermal differentiation, J. Cell Sci. 114 (11) (2001) 2105–2113. [15] R. Birkenhager, N. Lublinghoff, E. Prera, C. Schild, A. Aschendorff, S. Arndt, Autosomal dominant prelingual hearing loss with palmoplantar keratoderma
[28]
[29] [30]
[31] [32]
[33]
[34]
[35] [36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
13
syndrome: variability in clinical expression from mutations of R75W and R75Q in the GJB2 gene, Am. J. Med. Genet. A 152A (7) (2010) 1798–1802. A. Bygum, R.C. Betz, K. Kragballe, T. Steiniche, N. Peeters, W. Wuyts, et al., KID Syndrome: report of a Scandinavian patient with connexin-26 gene mutation, Acta Derm. Venereol. 85 (2) (2005) 152–155. L. Jonard, D. Feldmann, C. Parsy, S. Freitag, M. Sinico, C. Koval, et al., A familial case of Keratitis–Ichthyosis–Deafness (KID) syndrome with the GJB2 mutation G45E, Eur. J. Med. Genet. 51 (1) (2008) 35–43. U. Koppelhus, L. Tranebjaerg, G. Esberg, M. Ramsing, M. Lodahl, N.D. Rendtorff, et al., A novel mutation in the connexin 26 gene (GJB2) in a child with clinical and histological features of keratitis ichthyosisdeafness (KID) syndrome, Clin. Exp. Dermatol. 36 (2) (2011) 142–148. M.L. Bondeson, A.M. Nystrom, U. Gunnarsson, A. Vahlquist, Connexin 26 (GJB2) mutations in two Swedish patients with atypical Vohwinkel (mutilating keratoderma plus deafness) and KID syndrome both extensively treated with acitretin, Acta Derm. Venereol. 86 (6) (2006) 503–508. C.Y. Neoh, H. Chen, S.K. Ng, E.B. Lane, J.E. Common, A rare connexin 26 mutation in a patient with a form fruste of keratitis–ichthyosis–deafness (KID) syndrome, Int. J. Dermatol. 48 (10) (2009) 1078–1081. G. Richard, N. Brown, A. Ishida-Yamamoto, A. Kro, Expanding the phenotypic spectrum of Cx26 disorders: Bart–Pumphrey syndrome is caused by a novel missense mutation in GJB2, J. Invest. Dermatol. 123 (5) (2004) 856–863. M. van Geel, M.A. van Steensel, W. Kuster, H.C. Hennies, R. Happle, P.M. Steijlen, et al., HID and KID syndromes are associated with the same connexin 26 mutation, Br. J. Dermatol. 146 (6) (2002) 938–942. H. Caceres-Rios, L. Tamayo-Sanchez, C. Duran-Mckinster, O.M. de la Luz, R. RuizMaldonado, Keratitis, ichthyosis, and deafness (KID syndrome): review of the literature and proposal of a new terminology, Pediatr. Dermatol. 13 (2) (1996) 105–113. R.J. Gorlin, H.V. Toriello, M.M. Cohen, Hereditary Hearing Loss and Its Syndromes, Oxford University Press, New York, NY, 1995, pp. 386–397. A.J. Griffith, Y. Yang, S.P. Pryor, H.J. Park, E.W. Jabs, J.B. Nadol, et al., Cochleosaccular dysplasia associated with a connexin 26 mutation in keratitis–ichthyosis– deafness syndrome, Laryngoscope 116 (8) (2006) 1404–1408. R. Hennekam, J. Allason, I. Krantz, Gorlin’s Syndromes of the Head and Neck, Oxford University Press, New York, NY, 2010, pp. 636–711. B. Kelly, A. Lozano, G. Altenberg, T. Makishima, Connexin 26 mutation in keratitis– ichthyosis–deafness (KID) syndrome in mother and daughter with combined conductive and sensorineural hearing loss, Int. J. Dermatol. 47 (5) (2008) 443–447. I. Kone-Paut, S. Hesse, C. Palix, R. Rey, K. Remediani, J.M. Garnier, et al., Keratitis, ichthyosis, and deafness (KID) syndrome in half sibs, Pediatr. Dermatol. 15 (3) (1998) 219–221. H.V. Toriello, W. Reardom, R.J. Gorlin, Hereditary Hearing Loss and Its Syndromes, second ed., Oxford University Press, New York, NY, 2004, pp. 427–429. T. Tsuzuku, K. Kaga, S. Kanematsu, A. Shibata, S. Ohde, Temporal bone findings in keratitis, ichthyosis, and deafness syndrome. Case report, Ann. Otol. Rhinol. Laryngol. 101 (5) (1992) 413–416. M. Mohrenschlager, J. Ring, D. Abeck, Additional aspects of keratitis, ichthyosis, and deafness (KID) syndrome, Pediatr. Dermatol. 21 (4) (2004) 518–519. G.G. Nyquist, C. Mumm, R. Grau, A.N. Crowson, D.L. Shurman, P. Benedetto, et al., Malignant proliferating pilar tumors arising in KID syndrome: a report of two patients, Am. J. Med. Genet. A 143 (7) (2007) 734–741. Y.M. Szymko-Bennett, L.J. Russell, S.J. Bale, A.J. Griffith, Auditory manifestations of Keratitis–Ichthyosis–Deafness (KID) syndrome, Laryngoscope 112 (2) (2002) 272–280. I. Todt, H.C. Hennies, W. Kuster, J. Smolle, G. Rademacher, S. Mutze, et al., Neurotological and neuroanatomical changes in the connexin-26-related HID/ KID syndrome, Audiol. Neurootol. 11 (4) (2006) 242–248. D. Watanabe, M. Zako, Y. Tamada, Y. Matsumoto, A case of keratitisichthyosisdeafness (KID) syndrome, Int. J. Dermatol. 46 (4) (2007) 400–402. R. Kellermayer, M. Keller, P. Ratajczak, E. Richardson, F. Harangi, E. Merei, et al., Bigenic connexin mutations in a patient with hidrotic ectodermal dysplasia, Eur. J. Dermatol. 15 (2) (2005) 75–79. E.J. Barker, R.J. Briggs, Cochlear implantation in children with keratitisichthyosisdeafness (KID) syndrome: outcomes in three cases, Cochlear. Implants Int. 10 (3) (2009) 166–173. Y.H. Choung, Y.R. Shin, H.J. Kim, Y.C. Kim, J.H. Ahn, S.J. Choi, et al., Cochlear implantation and connexin expression in the child with keratitis–ichthyosis– deafness syndrome, Int. J. Pediatr. Otorhinolaryngol. 72 (6) (2008) 911–915. A.Y. Jan, S. Amin, P. Ratajczak, G. Richard, V.P. Sybert, Genetic heterogeneity of KID syndrome: identification of a Cx30 gene (GJB6) mutation in a patient with KID syndrome and congenital atrichia, J. Invest. Dermatol. 122 (5) (2004) 1108–1113. M.A. van Steensel, P.M. Steijlen, R.S. Bladergroen, E.H. Hoefsloot, C.M. Ravenswaaij-Arts, M.A. van Geel, Phenotype resembling the Clouston syndrome with deafness is associated with a novel missense GJB2 mutation, J. Invest. Dermatol. 123 (2) (2004) 291–293. J.R. Lee, A.M. Derosa, T.W. White, Connexin mutations causing skin disease and deafness increase hemichannel activity and cell death when expressed in Xenopus oocytes, J. Invest. Dermatol. 129 (4) (2009) 870–878. D.A. Gerido, A.M. DeRosa, G. Richard, T.W. White, Aberrant hemichannel properties of Cx26 mutations causing skin disease and deafness, Am. J. Physiol. Cell Physiol. 293 (1) (2007) C337–C345. D.L. Shurman, L. Glazewski, A. Gumpert, J.D. Zieske, G. Richard, In vivo and in vitro expression of connexins in the human corneal epithelium, Invest. Ophthalmol. Vis. Sci. 46 (6) (2005) 1957–1965. H.A. Sanchez, G. Mese, M. Srinivas, T.W. White, V.K. Verselis, Differentially altered Ca2+ regulation and Ca2+ permeability in Cx26 hemichannels formed by the
14
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
A40V and G45E mutations that cause keratitis ichthyosis deafness syndrome, J. Gen. Physiol. 136 (1) (2010) 47–62. [45] A. Terrinoni, A. Codispoti, V. Serra, B. Didona, E. Bruno, R. Nistico, et al., Connexin 26 (GJB2) mutations, causing KID Syndrome, are associated with cell death due to calcium gating deregulation, Biochem. Biophys. Res. Commun. 394 (4) (2010) 909–914.
[46] S. Iosa, E. Marciano, A. Franze, GJB2 gene mutation in syndromic skin diseases with sensorineural hearing loss, Curr. Genomics 12 (2011) 475–485. [47] N.A. Levit, G. Mese, M.-G. Basaly, T.W. White, Pathological hemichannels associated with human Cx26 mutation causing keratitis–ichthyosis–deafness syndrome, Biochem. Biophys. Acta 1818 (2012) 2014–2019.
Contents lists available at ScienceDirect
International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl
Case report
Phenotype in a patient with p.D50N mutation in GJB2 gene resemble both KID and Clouston syndromes T.G. Markova a,1, N.B. Brazhkina b,2, E.A. Bliznech c,3, V.V. Bakhshinyan d,4, A.V. Polyakov c,5, G.A. Tavartkiladze e,* a
Department the Epidemiology and Genetics of Hearing Loss, National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia Out-Patient Clinic, National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia c Laboratory for DNA-Diagnostics, Federal State Budgetary Institution ‘‘Research Centre for Medical Genetics’’, 1, Room 116 Moskvorechie Str, 115478 Moscow, Russia d Cochlear Implants Center, National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia e National Research Center for Audiology and Hearing Rehabilitation, 123 Leninsky Ave, 117513 Moscow, Russia b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 22 September 2015 Received in revised form 13 November 2015 Accepted 18 November 2015 Available online 9 December 2015
Keratitis–ichthyosis–deafness (KID) syndrome (OMIM 148210) is a rare ectodermal dysplasia syndrome characterized by vascularizing keratitis, congenital profound sensorineural hearing loss, and progressive erythrokeratoderma. We have found a 148G-A transition in the GJB2 gene, resulting in an asp50-to-asn (D50N) substitution in a girl with congenital deafness. This finding allowed us to diagnose a KID syndrome. But clinical features were uncommon because of a mild skin manifestation, lack of keratitis and unusual appearance resembling Clouston syndrome. Molecular genetic tests showed that it was de novo mutation because parents have normal genotype. Several autosomal dominant mutations in the GJB2 gene (Fonnexin 26) now established to underlie many of the affected cases, with the majority of patients harboring the p.D50N mutation. Skin disease-associated mutation of connexin proteins can cause functional disturbances in gap junction intercellular conductance. It is likely that multiple disease mechanisms are involved across the wide spectrum of hereditary diseases relating to connexin proteins. The clinical data may provide additional insights into the dysregulation mechanisms of mutations result in the disease. ß 2015 Elsevier Ireland Ltd. All rights reserved.
Keywords: Hereditary hearing loss Keratitis–ichthyosis–deafness syndrome Clouston syndrome GJB2 and GJB6 gene mutation Connexin26
1. Introduction Keratitis–ichthyosis–deafness (KID) syndrome (OMIM 148210) is a rare ectodermal dysplasia syndrome characterized by vascularizing keratitis, congenital profound sensorineural hearing loss, and progressive erythrokeratoderma, a clinical trial that indicates a failure in the development and differentiation of multiple stratifying epithelia [1–4]. Clinical descriptions of a KID
* Corresponding author. Tel.: +7 4997496098. E-mail addresses: [email protected] (T.G. Markova), [email protected] (E.A. Bliznech), [email protected] (V.V. Bakhshinyan), [email protected] (A.V. Polyakov), [email protected] (G.A. Tavartkiladze). 1 Tel.: +7 9266331209. 2 Tel.: +7 4997496105. 3 Tel.: +7 9152993670. 4 Tel.: +7 9266777282. 5 Tel.: +7 4959719152. http://dx.doi.org/10.1016/j.ijporl.2015.11.022 0165-5876/ß 2015 Elsevier Ireland Ltd. All rights reserved.
syndrome and molecular-genetic diagnostics have usually been initiated by considerable changes from skin and hair which can be accompanied bilateral sensorineural deafness. Therefore the majority of articles devoted to the syndrome, are published in the dermatological magazines [5–9]. According to the investigations the KID syndrome is more commonly caused by GJB2 mutations [10–14]. One of these mutation D50N (p.Asp50Asn) is leading to substitution of conserved residues in the cytoplasm amino terminus or first extracellular domain of connexin 26 (Cx26), which is crucial for voltage gating and connexon–connexon interactions. Some other dominant mutations in GJB2 gene have been reported predominantly in Caucasians and are responsible for the production of both nonsyndromal and syndromal hearing loss associated with diverse skin disorders [15–18]. MazereeuwHautier [5] performed clinical examination and molecular analysis of GJB2 in a cohort of 14 patients with KID syndrome originating from 11 families. 64% of cases were sporadic. Twelve patients were heterozygous for the p.Asp50Asn mutation and two patients were heterozygous for the p.Ser17Phe mutation. Multiple
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
phenotypesconsist of more than 5 different phenotypes: diffuse palmoplantar keratoderma (PPK) and hyperkeratosis, Vohwinkel syndrome, Keratitis–Ichthyosis–Deafness syndrome (KID), Bart– Pumphrey syndrome and DFNA3 [7,19–22]. The particular phenotype appears to depend both on the type of mutation and its location [21]. Keratitis–ichthyosis–deafness (KID) syndrome is characterized by cutaneous, auditory and ophthalmologic abnormalities. The most frequent clinical features were sensorineural deafness (90%), erythrokeratoderma(89%), vascularizing keratitis (79%), alopecia (79%), and reticulated hyperkeratosis of the palms and soles (41%). The KID acronym does not accurately define this entity since the disorder is not an ichthyosis, because scaling is not the main cutaneous feature and not all patients have keratitis early in the course [23–29]. Griffith [25] conducted correlative clinical, molecular genetic, and postmortem histopathologic analysis. The subject was heterozygous for G45E mutation of GJB2, which previously reported for KID syndrome. The primary inner ear abnormality was dysplasia of the cochlear and saccular neuroepithelium. Tsuzuku [30] revealed cochleosaccular abnormality during temporal bone studies. Additional concomitant phenomena of the KID syndrome are dystrophic nails, dental abnormalities, scarring alopecia, and vascularizing keratitis [31]. Nyquist [32] reported on two young adults with KID syndrome and follicular hyperkeratosis who developed metastatic malignant pillar tumors. Szymko-Bennett [33] concluded that the sensorineural hearing loss in KID syndrome is generally prelingual, bilateral and profound. Todt [34] provided evidence for functionally intact semicircular canals and normal utricular function in subjects with the autosomal dominant D50 N mutation of Cx26, in contrast to saccular function which was generally compromised and hearing loss which was profound. Watanabe [35] described a patient with generalized hyperkeratosis associated with keratitis and hearing defect. Patient’s skin was moderately hyperkeratotic at the birth and the thickness of the skin increased progressively during childhood. Bilateral sensorineural deafness was recognized at the age of 3 years and visual disturbance was noted in later childhood. Kellermayer [36] reported the bigenic connexin inheritance in patient with KID syndrome. Cochlear implantation in children with keratitis–ichthyosis–deafness (KID) syndrome was described in some cases [37,38]. In 2004 Jan [39] indicated genetic heterogeneity of KID syndrome. Mutation in GJB6 (connexin30) was found in a child with KID syndrome and congenital atrichia. Some mutations in the GJB6 are considered to be responsible for the Clouston syndrome. Clouston syndrome (MIM129500) is a rare autosomal dominant hidrotic ectodermal dysplasia syndrome characterized by alopecia or hypotrichosis, palmoplantar hyperkeratosis, and nail dystrophy. Dysplastic nails are the most common feature. Hearing loss and keratitis are not the symptoms of this syndrome. In 2004 van Steensel [40] described a patient who had phenotype resembling the Clouston syndrome with thin hair, deafness, nail dystrophy, and mild erythrokeratoderma. A novel spontaneous missense mutation N14K in heterozygous state of GJB2 gene was found. This mutation is near of two residues mutated in KID syndrome (G12R and S17F). The patient phenotype associated with N14K strongly differed from the KID syndrome. The patient had mild scalp hypotrichosis with lank, blonde hair some sharply demarcated erythematous plaques with some desquamation. Slight frontal bossing with seemingly deep-set eyes and 20-nail dystrophy were seen. In the neck a papular exanthema was present but no other signs of atopic eczema. No other abnormalities were present. The occurrence of nail dystrophy with hypotrichosis suggests the Clouston syndrome, but deafness is not normally part of the Clouston syndrome phenotype. Authors considered the possibility of a novel variant of the Clouston syndrome, but they found out phenotype association with a GJB2 mutation.
11
Connexin 26 (GJB2) and the closely related connexin 30 (GJB6) showed differential expression in epidermal, adnexal, and corneal epithelia but were not significantly altered in lesional skin. Connexin 26 is a component of the gap junction channels in the epidermis and in the stria vascularis of the cochlea. These channels play a role in the coordinated exchange of molecules and ions occurring in a wide spectrum of cellular activities. Connexins are now known to be also capable of forming functional hemichannels in nonjunctional membranes, linking cytoplasm of a cell with its extracellular microenvironment. Hemichannels have an unclear role, but there is some evidence showing that their activity can be altered under certain pathological conditions. Mutant connexin 26 was incapable of inducing intercellular coupling in vitro, which indicates its functional impairment. Decreased host defense and increased carcinogenic potential in KID syndrome illustrate that gap junction communication plays not only a crucial role in epithelial homeostasis and differentiation but also in immune response and epidermal carcinogenesis [41–43]. Previous data reveal striking genotype-phenotype correlations and demonstrate that dominant GJB2 mutations can disturb the gap junction system of one or several ectodermal epithelia [44,45]. Several studies emphasized that skin disease-associated autosomal dominant mutations of connexin protein can cause functional disturbances in gap junction intercellular conductance. Such mutations commonly produce channels with distinctly altered gating and permeability properties. On the contrary, autosomal recessive mutations with loss-of-function mechanism responsible for nonsyndromal deafness without skin abnormalities. Functional consequences of N14Y and N14K was assessed and compared with that of the classical KID mutation D50N. The results of analyses show that these mutations have different effects for protein localization and gap junction permeability. It is likely that multiple disease mechanisms are involved across the wide spectrum of hereditary diseases relating to connexin proteins [46,47]. 2. Methods To perform the connexin 26 and connexin 30 tests, a DNA sample is obtained and gene sequence is compared to that of the regularly occurring sequence to look for changes. DNA samples preparation. Genomic DNA was extracted from airdried buccalepithelium using a DIAtomTM DNA Prep100 kit (Isogene Lab.ltd., Russia) according to the manufacturer’s instruction. DNA-sequencing for GJB2 and GJB6 genes. Sequencing for coding exon 2 in GJB2 gene and coding exon 3 in GJB6 gene was performed after PCR. 50 –30 primer sequences are Cx26 F-GTGATTCCTGTGTTGTGTGCATTC and Cx26R-CCTCATCCCTCTCATGCTGTC; Cx30F1CCTCTTCCACTAATAAACCTTTGC and Cx30R1-GGAAAAAGATGCTGCTGGTGTAC; Cx30F2 GAATGATTTCAAAGACATAGAGGAC and Cx30R2-AGAAGACAGAAGTCTCCTTATGAC. DNA-sequencing for PCR fragments was carried out by using the ABI Dye Terminator, version 1 (Applied Biosystems, USA) and was ran on a 3130 ABI genetic analyzer (Applied Biosystems, USA). Sequences were aligned using Chromas version 2 (Technelysium). The reference cDNA sequences were obtained from NCBI Reference Sequence Database (NM_004004.5 for GJB2 gene and NM_001110221.2 for GJB6 gene). 3. Result and discussion 3.1. Case report The patient is 4-y-old girl with congenital hearing loss and mild features of atopic dermatitis, crumpled dry palms. She has normal
12
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
hearing non-consanguineous parents. There are no other sibs andthe family history was unremarkable. The atopic eczema had appeared at the age of 2 month. There were some erythematous plagues. Parents have paid attention to the absence of the reactions to sounds at the age of 6 months. At the age of 9 months the first audiological examination was performed in the Vladivostok Regional Audiological Center where the bilateral mild-tomoderate sensorineural hearing loss was diagnosed. The speech therapy started at the age of 2 years was not successful and child was sent to the National Research Center for Audiology and hearing Rehabilitation (Moscow) where the severe bilateral sensorineural hearing loss was diagnosed at the age of 2 years and 6 months. After investigation the bilateral amplification (prior to cochlear implantation) was recommended and Widex SV-38 hearing aids were prescribed. Unfortunately after one year of hearing aid use results of hearing and speech development were unsutisfactory and in 2008 at the age of 3 years and 6 months the unilateral cochlear implantation was performed (CI Nucleus Freedom with Contour Advance Electrode (CI24RE (CD)). During the first year of rehabilitation the progress was slow but after 3 years the child has achieved success in speech and hearing development and entered the regular school. At the age of 10 she demonstrated 100% intelligibility of conventional and commonly used words. The intelligibility of the meaningless syllables and sounds was 70%. Upon the first examination the clinical geneticist noticed the slight unusual appearance of the child. The girl had deepset eyes, hypotrichosis of the head with thin blonde hair (Fig. 1A), dryness of the skin, especially on an external surface of shoulders and an internal surface of palms with striation of thenar and hypothenar eminences (Fig. 1B). Appearance of the child was sharply differed from the parents. Considering congenital character of deafness, the diagnostics of CJB2 gene mutations was recommended. DNA analysis identified a 148G-A transition in the GJB2 gene, resulting in an asp50-to-asn substitution. According to the literature the D50N mutation is the main reason for KID syndrome. Parents were unaffected and mutation D50N was not present in their blood samples. After that we repeated clinical examination but did not find any dramatic symptoms of keratitis–ichthyosis–deafness syndrome except for the dry skin, crumpled dry palms, sparse and depigmented hair, hypoplastic nails (Fig. 1C). There were no signs of keratitis. At the photographs of newborn period some cutaneous changes were apparent. There were clearly visible specific, changes of palm skin, a thickening of a skin as an orangepeel. We concluded that it was mild clinical presentation of KID syndrome. Additional DNA analysis excluded CJB6 gene mutations including those detected in cases with Clouston syndrome. 3.2. Discussion Genetic heterogeneity is a major problem in nonsyndromal hearing loss. However the most common cause of congenital hearing impairment is the mutations in the GJB2 gene. Clinical features do not allow to make out syndrome diagnosis and correct genetic counselling. Nowadays molecular genetic tests provide possibility to identify the main cause of congenital hearing loss. Frequent involvement of the connexin 26 gene simplifies the first step of the molecular diagnostics of the hereditary hearing loss. It is important to eliminate GJB2-associated deafness in any children with congenital or prelingual hearing loss. The combination of congenital hearing loss with skin hyperkeratosis is a rare pathology. Only 11 families affected by this disorder were described in the literature during the last 30 years. Nowadays there are no more than 50 cases of this condition known in the world. Modern molecular methods revealed in all such patients a mutation in GJB2 gene as a primary cause of the disease.
Fig. 1. The patient’s phenotype: (A) note the frontal bossing, seemingly deep-set eyes, hypotrichosis and thin blonde hair, (B) dry palms with striation of thenar and hypothenar eminences, (C) the fingernails are dystrophic.
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
The phenotype described in our patient, as well as in the article of van Steensel [12,46] resembled a clinical picture of Clouston syndrome. Interestingly the congenital hearing disorder and infringements in a gene GJB2 are not typical for Clouston syndrome but on the contrary are typical for KID syndrome. We take into account that D50N mutation is the main reason for KID syndrome and the chance of clinical heterogeneity. We considered the possibility of a novel phenotype variant of the KID syndrome. The clinical data may provide additional insights into the dysregulation mechanisms of mutations linked to the disease. Whereas audiologist should first determine the severity and type of hearing loss genetic counseling is especially important for the deaf and those with less hearing loss because of the associated high frequency of genetic and syndromal etiology. Counseling can rule out syndromes and their associated complications, correct erroneous perceptions, and ensure that the consultant receives appropriate medical evaluations [24,29]. There are already at least two cases which demonstrate that genetic counselling of hearing loss should start with connexin 26 gene analyses to exclude any unexpected results or coincidence in hearing loss etiology.
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
Appendix A. Supplementary data [25]
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijporl.2015.11.022.
[26] [27]
References [1] W.A. Nowell, Keratitis, ichthyosis, and deafness (KID) syndrome: suggested. changes in terminology, Arch. Dermatol. 124 (1) (1988) 22. [2] G. Richard, F. Rouan, C.E. Willoughby, N. Brown, P. Chung, M. Ryyna¨nen, et al., Missense mutations in. GJB2 encoding connexin-26 cause the ectodermal dysplasia keratitis–ichthyosis–deafness syndrome, Am. J. Hum. Genet. 70 (5) (2002) 1341–1348. [3] G. Richard, T.W. White, L.E. Smith, R.A. Bailey, J.G. Compton, D.L. Paul, et al., Functional defects of Cx26 resulting from a heterozygous missense mutation in a family with dominant deaf-mutism and palmoplantar keratoderma, Hum. Genet. 103 (4) (1998) 393–399. [4] G.N. Wilson, R.H. Squires Jr., A.G. Weinberg, Keratitis, hepatitis, ichthyosis, and deafness: report and review of KID syndrome, Am. J. Med. Genet. 40 (3) (1991) 255–259. [5] J. Mazereeuw-Hautier, E. Bitoun, J. Chevrant-Breton, S.Y. Man, C. Bodemer, C. Prins, et al., Keratitis–ichthyosis–deafness syndrome: disease expression and spectrum of connexin 26 (GJB2) mutations in 14 patients, Br. J. Dermatol. 156 (5) (2007) 1015–1019. [6] L. Miteva, Keratitis, ichthyosis, and deafness (KID) syndrome, Pediatr. Dermatol. 19 (6) (2002) 513–516. [7] L. Maintz, R.C. Betz, J.P. Allam, J. Wenzel, A. Jaksche, N. Friedrichs, et al., Keratitis– ichthyosis–deafness syndrome in association with follicular occlusion triad, Eur. J. Dermatol. 15 (5) (2005) 347–352. [8] T. Lazic, K.A. Horii, G. Richard, D.I. Wasserman, R.J. Antaya, A report of GJB2 (N14K) Connexin 26 mutation in two patients–a new subtype of KID syndrome? Pediatr. Dermatol. 25 (5) (2008) 535–540. [9] K. Langer, K. Konrad, K. Wolff, Keratitis, ichthyosis and deafness (KID)- syndrome: report of three cases and a review of the literature, Br. J. Dermatol. 122 (5) (1990) 689–697. [10] A. Alvarez, I. del Castillo, A. Pera, M. Villamar, M.A. Moreno-Pelayo, F. Moreno, et al., De novo mutation in the gene encoding connexin-26 (GJB2) in a sporadic case of keratitis–ichthyosis–deafness (KID) syndrome, Am. J. Med. Genet. A 117A (1) (2003) 89–91. [11] S. Arndt, A. Aschendorff, C. Schild, R. Beck, W. Maier, R. Laszig, et al., A novel dominant and a de novo mutation in the GJB2 gene (connexin-26) cause keratitis– ichthyosis–deafness syndrome: implication for cochlear implantation, Otol. Neurotol. 31 (2) (2010) 210–215. [12] A.R. Janecke, H.C. Hennies, B. Gunther, G. Gansl, J. Smolle, E.M. Messmer, et al., GJB2 mutations in keratitis–ichthyosis–deafness syndrome including its fatal form, Am. J. Med. Genet. A 133A (2005) 128–131. [13] S. Yotsumoto, T. Hashiguchi, X. Chen, N. Ohtake, A. Tomitaka, H. Akamatsu, et al., Novel mutations in GJB2 encoding connexin-26 in Japanese patients with keratitis–ichthyosis–deafness syndrome, Br. J. Dermatol. 148 (4) (2003) 649–653. [14] F. Rouan, T.W. White, N. Brown, A.M. Taylor, T.W. Lucke, D.L. Paul, et al., Transdominant inhibition of connexin-43 by mutant connexin-26: implications for dominant connexin disorders affecting epidermal differentiation, J. Cell Sci. 114 (11) (2001) 2105–2113. [15] R. Birkenhager, N. Lublinghoff, E. Prera, C. Schild, A. Aschendorff, S. Arndt, Autosomal dominant prelingual hearing loss with palmoplantar keratoderma
[28]
[29] [30]
[31] [32]
[33]
[34]
[35] [36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
13
syndrome: variability in clinical expression from mutations of R75W and R75Q in the GJB2 gene, Am. J. Med. Genet. A 152A (7) (2010) 1798–1802. A. Bygum, R.C. Betz, K. Kragballe, T. Steiniche, N. Peeters, W. Wuyts, et al., KID Syndrome: report of a Scandinavian patient with connexin-26 gene mutation, Acta Derm. Venereol. 85 (2) (2005) 152–155. L. Jonard, D. Feldmann, C. Parsy, S. Freitag, M. Sinico, C. Koval, et al., A familial case of Keratitis–Ichthyosis–Deafness (KID) syndrome with the GJB2 mutation G45E, Eur. J. Med. Genet. 51 (1) (2008) 35–43. U. Koppelhus, L. Tranebjaerg, G. Esberg, M. Ramsing, M. Lodahl, N.D. Rendtorff, et al., A novel mutation in the connexin 26 gene (GJB2) in a child with clinical and histological features of keratitis ichthyosisdeafness (KID) syndrome, Clin. Exp. Dermatol. 36 (2) (2011) 142–148. M.L. Bondeson, A.M. Nystrom, U. Gunnarsson, A. Vahlquist, Connexin 26 (GJB2) mutations in two Swedish patients with atypical Vohwinkel (mutilating keratoderma plus deafness) and KID syndrome both extensively treated with acitretin, Acta Derm. Venereol. 86 (6) (2006) 503–508. C.Y. Neoh, H. Chen, S.K. Ng, E.B. Lane, J.E. Common, A rare connexin 26 mutation in a patient with a form fruste of keratitis–ichthyosis–deafness (KID) syndrome, Int. J. Dermatol. 48 (10) (2009) 1078–1081. G. Richard, N. Brown, A. Ishida-Yamamoto, A. Kro, Expanding the phenotypic spectrum of Cx26 disorders: Bart–Pumphrey syndrome is caused by a novel missense mutation in GJB2, J. Invest. Dermatol. 123 (5) (2004) 856–863. M. van Geel, M.A. van Steensel, W. Kuster, H.C. Hennies, R. Happle, P.M. Steijlen, et al., HID and KID syndromes are associated with the same connexin 26 mutation, Br. J. Dermatol. 146 (6) (2002) 938–942. H. Caceres-Rios, L. Tamayo-Sanchez, C. Duran-Mckinster, O.M. de la Luz, R. RuizMaldonado, Keratitis, ichthyosis, and deafness (KID syndrome): review of the literature and proposal of a new terminology, Pediatr. Dermatol. 13 (2) (1996) 105–113. R.J. Gorlin, H.V. Toriello, M.M. Cohen, Hereditary Hearing Loss and Its Syndromes, Oxford University Press, New York, NY, 1995, pp. 386–397. A.J. Griffith, Y. Yang, S.P. Pryor, H.J. Park, E.W. Jabs, J.B. Nadol, et al., Cochleosaccular dysplasia associated with a connexin 26 mutation in keratitis–ichthyosis– deafness syndrome, Laryngoscope 116 (8) (2006) 1404–1408. R. Hennekam, J. Allason, I. Krantz, Gorlin’s Syndromes of the Head and Neck, Oxford University Press, New York, NY, 2010, pp. 636–711. B. Kelly, A. Lozano, G. Altenberg, T. Makishima, Connexin 26 mutation in keratitis– ichthyosis–deafness (KID) syndrome in mother and daughter with combined conductive and sensorineural hearing loss, Int. J. Dermatol. 47 (5) (2008) 443–447. I. Kone-Paut, S. Hesse, C. Palix, R. Rey, K. Remediani, J.M. Garnier, et al., Keratitis, ichthyosis, and deafness (KID) syndrome in half sibs, Pediatr. Dermatol. 15 (3) (1998) 219–221. H.V. Toriello, W. Reardom, R.J. Gorlin, Hereditary Hearing Loss and Its Syndromes, second ed., Oxford University Press, New York, NY, 2004, pp. 427–429. T. Tsuzuku, K. Kaga, S. Kanematsu, A. Shibata, S. Ohde, Temporal bone findings in keratitis, ichthyosis, and deafness syndrome. Case report, Ann. Otol. Rhinol. Laryngol. 101 (5) (1992) 413–416. M. Mohrenschlager, J. Ring, D. Abeck, Additional aspects of keratitis, ichthyosis, and deafness (KID) syndrome, Pediatr. Dermatol. 21 (4) (2004) 518–519. G.G. Nyquist, C. Mumm, R. Grau, A.N. Crowson, D.L. Shurman, P. Benedetto, et al., Malignant proliferating pilar tumors arising in KID syndrome: a report of two patients, Am. J. Med. Genet. A 143 (7) (2007) 734–741. Y.M. Szymko-Bennett, L.J. Russell, S.J. Bale, A.J. Griffith, Auditory manifestations of Keratitis–Ichthyosis–Deafness (KID) syndrome, Laryngoscope 112 (2) (2002) 272–280. I. Todt, H.C. Hennies, W. Kuster, J. Smolle, G. Rademacher, S. Mutze, et al., Neurotological and neuroanatomical changes in the connexin-26-related HID/ KID syndrome, Audiol. Neurootol. 11 (4) (2006) 242–248. D. Watanabe, M. Zako, Y. Tamada, Y. Matsumoto, A case of keratitisichthyosisdeafness (KID) syndrome, Int. J. Dermatol. 46 (4) (2007) 400–402. R. Kellermayer, M. Keller, P. Ratajczak, E. Richardson, F. Harangi, E. Merei, et al., Bigenic connexin mutations in a patient with hidrotic ectodermal dysplasia, Eur. J. Dermatol. 15 (2) (2005) 75–79. E.J. Barker, R.J. Briggs, Cochlear implantation in children with keratitisichthyosisdeafness (KID) syndrome: outcomes in three cases, Cochlear. Implants Int. 10 (3) (2009) 166–173. Y.H. Choung, Y.R. Shin, H.J. Kim, Y.C. Kim, J.H. Ahn, S.J. Choi, et al., Cochlear implantation and connexin expression in the child with keratitis–ichthyosis– deafness syndrome, Int. J. Pediatr. Otorhinolaryngol. 72 (6) (2008) 911–915. A.Y. Jan, S. Amin, P. Ratajczak, G. Richard, V.P. Sybert, Genetic heterogeneity of KID syndrome: identification of a Cx30 gene (GJB6) mutation in a patient with KID syndrome and congenital atrichia, J. Invest. Dermatol. 122 (5) (2004) 1108–1113. M.A. van Steensel, P.M. Steijlen, R.S. Bladergroen, E.H. Hoefsloot, C.M. Ravenswaaij-Arts, M.A. van Geel, Phenotype resembling the Clouston syndrome with deafness is associated with a novel missense GJB2 mutation, J. Invest. Dermatol. 123 (2) (2004) 291–293. J.R. Lee, A.M. Derosa, T.W. White, Connexin mutations causing skin disease and deafness increase hemichannel activity and cell death when expressed in Xenopus oocytes, J. Invest. Dermatol. 129 (4) (2009) 870–878. D.A. Gerido, A.M. DeRosa, G. Richard, T.W. White, Aberrant hemichannel properties of Cx26 mutations causing skin disease and deafness, Am. J. Physiol. Cell Physiol. 293 (1) (2007) C337–C345. D.L. Shurman, L. Glazewski, A. Gumpert, J.D. Zieske, G. Richard, In vivo and in vitro expression of connexins in the human corneal epithelium, Invest. Ophthalmol. Vis. Sci. 46 (6) (2005) 1957–1965. H.A. Sanchez, G. Mese, M. Srinivas, T.W. White, V.K. Verselis, Differentially altered Ca2+ regulation and Ca2+ permeability in Cx26 hemichannels formed by the
14
T.G. Markova et al. / International Journal of Pediatric Otorhinolaryngology 81 (2016) 10–14
A40V and G45E mutations that cause keratitis ichthyosis deafness syndrome, J. Gen. Physiol. 136 (1) (2010) 47–62. [45] A. Terrinoni, A. Codispoti, V. Serra, B. Didona, E. Bruno, R. Nistico, et al., Connexin 26 (GJB2) mutations, causing KID Syndrome, are associated with cell death due to calcium gating deregulation, Biochem. Biophys. Res. Commun. 394 (4) (2010) 909–914.
[46] S. Iosa, E. Marciano, A. Franze, GJB2 gene mutation in syndromic skin diseases with sensorineural hearing loss, Curr. Genomics 12 (2011) 475–485. [47] N.A. Levit, G. Mese, M.-G. Basaly, T.W. White, Pathological hemichannels associated with human Cx26 mutation causing keratitis–ichthyosis–deafness syndrome, Biochem. Biophys. Acta 1818 (2012) 2014–2019.