Phosphoserine aminoacylation of tRNA bearing an unnatural base anticodon

Biochemical and Biophysical Research Communications 372 (2008) 480–485

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Phosphoserine aminoacylation of tRNA bearing an unnatural base anticodon Ryuya Fukunaga a,b,1, Yoko Harada b, Ichiro Hirao b, Shigeyuki Yokoyama a,b,* a b

Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan Systems and Structural Biology Center, Yokohama Institute, RIKEN, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan

a r t i c l e

i n f o

Article history: Received 9 May 2008 Available online 27 May 2008 Keywords: tRNA Unnatural base pair Aminoacylation Synthetase Phosphoserine Engineering

a b s t r a c t An unnatural base pair between 7-(2-thienyl)-imidazo[4,5-b]pyridine (Ds) and pyrrole-2-carbaldehyde (Pa) could expand the genetic alphabet and allow the incorporation of non-standard amino acids into proteins at defined positions. For this purpose, we synthesized tRNAs bearing Pa at the anticodon and tested non-standard amino acid phosphoserine aminoacylation by the wild-type and various engineered phosphoseryl-tRNA synthetases (SepRSs). The D418N D420N T423V triple mutant of SepRS efficiently charged phosphoserine to tRNA containing the PaUA anticodon with a Km = 47.1 lM and a kcat = 0.151 s1, which are comparable to the values of the wild-type SepRS for its cognate substrate, tRNACys with the GCA anticodon (26.9 lM and 0.111 s1). The triple mutant SepRS and the tRNA with the PaUA anticodon represent a specific pair for the site-specific incorporation of phosphoserine into proteins in response to the UADs codon within mRNA. Ó 2008 Elsevier Inc. All rights reserved.

An unnatural, extra base pair that is compatible with the natural A-T and G-C pairs could expand the genetic alphabet and code, enabling the site-specific incorporation of various functional components into nucleic acids and proteins at desired positions [1–6]. We have developed an unnatural base pair, 7(2-thienyl)-imidazo[4,5-b]pyridine (denoted by Ds) and pyrrole2-carbaldehyde (denoted by Pa), which functions in replication and transcription (Fig. 1A) [3]. DNA fragments containing the hydrophobic Ds–Pa pair can be amplified by PCR and used as templates for site-specific Ds or Pa incorporation into RNA by transcription. Another interesting aspect of the unnatural base pair lies in its application to translation, for the site-specific incorporation of non-standard amino acids into proteins. For the expansion of the genetic code, the translation systems require a specific combination of a tRNA molecule containing unnatural bases at its anticodon and the corresponding aminoacyl-tRNA synthetase (aaRS), which specifically aminoacylates the tRNA with a non-standard amino acid. Phosphoseryl-tRNA synthetase (SepRS) is a natural non-standard aaRS, which charges a non-standard amino acid, phosphoserine (Sep), to tRNACys containing a GCA anticodon for tRNA-dependent cysteine biosynthesis in some archaea [7–9]. Our crystal structures of the Archaeoglobus fulgidus Sep-

* Corresponding author. Address: Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan. Fax: +81 3 5841 8057. E-mail address: [email protected] (S. Yokoyama). 1 Present address: Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA. 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.05.078

RStRNACysphosphoserine complex [9] should facilitate the engineering of SepRS for specific recognition between SepRS mutants and the anticodon region of the tRNA. Thus, it should be possible to develop the specific combination of an engineered SepRS and a tRNA variant containing unnatural bases at the anticodon region. In this study, we synthesized tRNAs containing a PaUA or CPaA anticodon by transcription mediated by the Ds–Pa pair, and examined their efficiency and selectivity of aminoacylation with phosphoserine by a series of SepRS mutants. We found that an engineered SepRS with three point mutations (E418N E420N T423V) efficiently charged phosphoserine to tRNA containing the PaUA anticodon. The kinetic parameters and the structural modeling indicated the specific recognition between the SepRS mutant and the PaUA region of the tRNA.

Materials and methods Preparation of tRNA molecules containing an unnatural base. The DNA fragments for the templates were chemically synthesized with a DNA synthesizer, using the phosphoramidites of Ds [3] and the natural bases (Applied Biosystems, CA) and 20 -O-methylribonucleoside amidites (Glen Research, VA). The sequences of the DNA fragments were as follows: 50 -GATAATACGACTCACTATAGCC AGGGTGGCAGAGGGGCTATGCGGCGGACTCTAGATCCGCTTTACCCC GG (50 -non-template DNA, 71-mer), 50 -TmGmGAGCCAGGGCCCGG ATTCGAACCGGGGTAAAGCGGATCTADsAGTCCGCCGCATAGCCC (50 template DNA for tRNAPaUA, 60-mer), and TmGm GAGCCA GGGCCCGGATTCGAACCGGGGTAAAGCGGATCTDsGAGTCCGCCGCA TAGCCC (50 -template DNA for tRNACPaA, 60-mer), where Tm = 20 -O-

R. Fukunaga et al. / Biochemical and Biophysical Research Communications 372 (2008) 480–485

481

Fig. 1. Specific T7 transcription mediated by the Ds–Pa pair for tRNAPaUA and tRNACPaA synthesis. (A) The Ds–Pa pair. (B) The sequence of the tRNAs used in this study. N34N35N36 is GCA in tRNACys, UCA in tRNAOpal, CUA in tRNAAmber, PaUA in tRNAPaUA, and CPaA in tRNACPaA. (C) Schemes of the specific transcription for tRNAPaUA and tRNACPaA synthesis and the nucleotide composition analysis. (D) 2D-TLC of labeled nucleotides after RNase T2 treatment of the transcripts.

methylthymidine and Gm = 20 -O-methylguanosine. The double stranded DNA templates (94-mer) were prepared by annealing with the 50 -non-template and 50 -template DNA fragments, followed by primer extension by the Klenow fragment (Takara, Kyoto). The tRNA transcripts containing Pa were synthesized by T7 RNA polymerase (2.5 U/ll)(Takara), using 0.5 lM template, in a solution containing 40 mM Tris–HCl (pH 8.1), 24 mM MgCl2, 0.01% Triton, 2 mM spermidine, 5 mM dithiothreitol, 3 mM PaTP, 1 mM natural NTPs, and 10 mM GMP, for 6 h at 37 °C. The transcripts were purified by polyacrylamide gel electrophoresis. Nucleotide-composition analysis of T7 transcripts. For this analysis, transcription was performed in the presence of [c-32P] ATP (2 lCi) or [c-32P] UTP (2 lCi) [10]. The transcripts were digested by RNase T2 (0.75–1.5 U/ll), in a solution (10 ll) containing 15 mM sodium acetate buffer (pH 4.5), at 37 °C for 1–2 h. The digestion products were analyzed by 2D-TLC, using a Merck HPTLC plate (100  100 mm) (Merck, Darmstadt, Germany) with the following developing solvents: isobutyric acid–ammonia–water (66:1:33 v/v/v) for the first dimension, and isopropyl alcohol– HCl–water (70:15:15 v/v/v) for the second dimension. The products on the TLC plates were analyzed with an imaging analyzer (BAS2500, Fuji Film). The quantification of each spot was averaged from 3–9 data sets. Enzymatic assays. The SepRS proteins, tRNACys, tRNAOpal, and tRNAAmber were prepared as described [9]. The phosphoserine aminoacylation reaction was performed, and the Sep-RNA thus produced was quantitated as described [9]. Kinetic analyses of the phosphoserine aminoacylation were performed at 50 °C, in 15 lL of 100 mM HEPES–NaOH buffer (pH 7.6), containing 20 mM MgCl2, 150 mM NaCl, 5 mM ATP, 100 lM [14C]phosphoserine, 1, 2, 5, 10, 20, 40, 80, 120, or 160 lM tRNA (tRNACys, tRNAOpal, tRNAAmber, tRNAPaUA, or tRNACPaA), and SepRS enzymes. To determine the kinetic parameters, for tRNACys, 1 lM wild-type SepRS or 2 lM SepRS(E418N E420N T423V) was used; for tRNAOpal,

tRNAAmber, and tRNAPaUA, 2 lM SepRS(E418N E420N T423V) was used; and for tRNACPaA, 5 lM SepRS(E418N E420N T423V) was used. Aliquots (6 lL) were removed at 30 and 60 s, and the [14C]Sep-tRNA thus produced was quantitated [9]. Kinetic parameters were calculated from Eadie–Hofstee plots. Results and discussion Syntheses of tRNAPaUA and tRNACPaA We synthesized two tRNA molecules, tRNAPaUA and tRNACPaA, containing a PaUA and a CPaA sequence in the anticodon, respectively, by transcription mediated by the unnatural Ds–Pa pair (Fig. 1). The first or second nucleotide in the anticodon of the tRNAs was replaced with Pa, to compare their aminoacylation reactions with those of tRNAAmber containing a CUA anticodon and tRNACys containing a GCA anticodon (the natural substrate of the wild-type SepRS). tRNAPaUA and tRNACPaA (75-mer) were prepared by T7 RNA polymerase, using Pa (PaTP) and DNA templates containing Ds [3]. The last two nucleosides (G and T) at the 50 -termini of the DNA template strand were replaced with their 20 -O-methylribonucleosides (Gm and Tm), to reduce the addition of one or more nontemplated nucleotides at the 30 -terminus of the nascent transcript [11]. Since the incorporation of PaTP is slightly less efficient, as compared to those of the natural NTPs [3], we increased the concentration (3 mM) of PaTP. The high selectivity of the Pa incorporation into tRNA transcripts opposite Ds in the DNA templates was confirmed by a nucleotide-composition analysis [3]. For the analysis, the tRNA transcripts were internally labeled during transcription using [a-32P]ATP or [a-32P]UTP, and then were digested to nucleoside 30 -phosphates by RNase T2. The labeled nucleoside 30 -phosphates were analyzed by 2D-TLC (Fig. 1D and Table 1). In the analysis of

482

R. Fukunaga et al. / Biochemical and Biophysical Research Communications 372 (2008) 480–485

Table 1 Nucleotide composition analysis of T7 transcripts Entry

tRNA

[a-32P] NTP

Composition of nucleotides incorporated as 50 neighbor of U or Aa Ap

Gp

1 2 3 4

tRNAPaUA tRNAPaUA tRNACPaA tRNACPaA

ATP UTP ATP UTP

1.021b [1] c (0.035)d 2.901 [3] (0.023) 1.042 [1] (0.029) 2.977 [3] (0.098)

4.046 1.996 3.937 1.969

Cp [4] [2] [4] [2]

(0.042) (0.038) (0.059) (0.035)

2.889 4.936 2.962 4.994

Up [3] [5] [3] [5]

(0.044) (0.030) (0.059) (0.048)

3.032 3.183 2.081 3.049

Pap [3] [3] [2] [3]

(0.021) (0.021) (0.052) (0.109)

0.012 0.984 0.978 0.011

[0] [1] [1] [0]

(0.002) (0.006) (0.010) (0.001)

a

Composition of nucleotides incorporated as 50 neighbor of A (Entries 1 and 3) or U (Entries 2 and 4), as shown in Fig. 2. The values were determined using the following formula: (radioactivity of each nucleotide)/[total radioactivity of all nucleotides (30 -monophosphates)]  (total number of nucleotides at 50 neighbor of [a-32P]NTP). c The theoretical number of each nucleotide is shown in brackets. d Standard deviations are shown in parentheses. b

tRNAPaUA, the spot corresponding to the labeled ribonucleoside 30 phosphate of Pa (Pap) appeared on the 2D-TLC analysis of the transcript labeled with [a-32P]UTP, but not with [a-32P]ATP. This result indicates the faithful incorporation of Pa opposite Ds, because the 30 neighbor of Pa is U in the tRNA sequence, and thus Pa was labeled at the 30 phosphate with only [a-32P]UTP in transcription. In contrast, no Pa spot was observed on the TLC of the tRNAPaUA transcript when it was labeled with [a-32P]ATP, indicating that misincorporation of Pa opposite the natural bases rarely occurred in transcription using 3 mM PaTP and 1 mM natural NTPs. In the analysis of tRNACPaA, the Pap spot appeared on the TLC obtained from the transcript labeled with [a-32P]ATP, but not with [a-32P]UTP, because the 30 neighbor of Pa in tRNACPaA is A. The quantification of these spots on the TLC revealed that the incorporation selectivity of Pa opposite Ds was 98% in both tRNAPaUA and tRNACPaA (Table 1, Entries 2 and 3). The total misincorporation values of PaTP in the tRNA transcripts were 1.1–1.2% (Table 1, Entries 1 and 4). These values suggest that the Pa misincorporations correspond to only 0.08–0.11% per position in the transcripts. Thus, increasing the concentration (3 mM) of PaTP, relative to those (1 mM) of the natural NTPs, facilitated the highly selective and effi-

cient incorporation of Pa into the anticodon of the tRNAs opposite Ds in the templates, without significant Pa misincorporation at other positions within the transcripts. Enzyme screening for phosphoserine aminoacylation of tRNAPaUA and tRNACPaA On the basis of the A. fulgidus SepRStRNACysphosphoserine structure, we designed various SepRS mutants with one or more

Table 2 Kinetic analysis of Sep-tRNA formation

SepRS(WT):tRNACys SepRS(E418N E420N SepRS(E418N E420N SepRS(E418N E420N SepRS(E418N E420N SepRS(E418N E420N

T423V):tRNACys T423V):tRNAOpal T423V):tRNAAmber T423V):tRNAPaUA T423V):tRNACPaA

Km (lM)

kcat (s1)

kcat/ Km

kcat/Km (relative)

26.9 37.2 73.3 116.6 47.1 48.0

0.115 0.008 0.067 0.123 0.151 0.013

0.0043 0.0002 0.0009 0.0011 0.0020 0.0002

1 0.053 0.215 0.247 0.476 0.038

70

tRNAPaUA

60

Sep-tRNA formed (pmol)

50

40

30

20

tRNACPaA 10

E 42 0Q E 41 8D E 420 D E 41 8D E 420 N E 41 8D E 420 Q E 41 8N E 420 D E 41 8N E 420 N E 41 8N E 420 Q E 42 0K E 42 0R E 41 8Q E 41 8Q E 42 0D E 41 8Q E 42 0N E 41 8Q E 42 E 41 0Q 8N E 420 N T4 23V no e nzym e

E 42 0N

E 41 8N E 42 0D

WT E 41 8D

0

Fig. 2. Phosphoserine aminoacylation activity of SepRS enzymes with tRNAPaUA and tRNACPaA. Phosphoserine aminoacylation activities of the wild-type and mutant SepRSs with tRNAPaUA and tRNACPaA are shown in red and blue, respectively.

483

R. Fukunaga et al. / Biochemical and Biophysical Research Communications 372 (2008) 480–485

A36

A36

A

Pro524 Ile493

Pro428

Pro524 Ile493

Pro428

Phe526

Phe526

C35

C35 U33

U33

SepRS (WT) : tRNACys

G34

Gly427

G34

Gly427

Thr423

Thr423 Glu420

Glu420 Arg492

Glu418

Arg492

Glu418

A36

A36

B Pro428

Pro428

Pro524 Ile493 Phe526

C35

Pro524 Ile493 Phe526

C35

SepRS (E418N E420N T423V) : tRNACys

U33

U33 G34 Gly427

G34 Gly427

Val423

Val423 Asn420

Asn420

Arg492

Arg492 Asn418

Asn418

A36

A36

C Pro524

Pro428

SepRS (E418N E420N T423V) :

tRNAOpal

Pro524

Pro428

Ile493 C35

Ile493 C35

U33

U33

U34 Gly427

U34

Val423

Gly427

Phe526

Val423 Phe526 Asn420

Asn420

Arg492

Arg492 Asn418

Asn418

A36

A36

D

Pro524 Ile493

Pro428

Pro524 Ile493

Pro428

SepRS (E418N E420N T423V) : tRNAAmber

U33 U35 Gly427

U33

C34

Phe526

U35 Gly427

Val423

Phe526

C34

Val423

Asn420

Asn420 Arg492

Arg492

Asn418

Asn418

A36

A36

E Pro524 Ile493

Pro428

Pa34 U35 Gly427

Pro524 Ile493

Pro428

SepRS (E418N E420N T423V) : tRNAPaUA

U33

Pa34 Phe526

U35

Phe526 Gly427

Val423

Val423 Asn420

Asn420

Arg492

Arg492 Asn418

Asn418

F

A36

A36

Pro524 Ile493

Pro428

Pro524 Ile493

Pro428

SepRS (E418N E420N T423V) : tRNACPaA

U33

Pa35

U33

Pa35

C34 Gly427

U33

Val423

C34

Phe526 Gly427

Val423

Asn420

Asn420 Arg492

Arg492 Asn418

Phe526

Asn418

Fig. 3. Structural models for tRNA anticodon recognition by SepRS(E418N E420N T423V). (A) Structure of the wild-type SepRStRNACysphosphoserine complex determined by X-ray crystallography. (B–F) Structural models of (B) SepRS(E418N E420N T423V)tRNACysphosphoserine, (C) SepRS(E418N E420N T423V)tRNAOpalphosphoserine, (D) SepRS(E418N E420N T423V)tRNAAmberphosphoserine, (E) SepRS(E418N E420N T423V)tRNAPaUAphosphoserine, and (F) SepRS(E418N E420N T423V)tRNACPaAphosphoserine.

484

R. Fukunaga et al. / Biochemical and Biophysical Research Communications 372 (2008) 480–485

mutations in the residue(s) involved in the interactions with the first and second anticodon bases [9]. We tested whether they could charge phosphoserine to tRNAPaUA and tRNACPaA (Fig. 2). The wildtype SepRS did not exhibit detectable activity with either tRNAPaUA or tRNACPaA, indicating that engineering of the SepRS residues recognizing the anticodon bases would be required for efficient phosphoserine aminoacylation to these tRNAs. Most of the mutant SepRS enzymes with one or two point mutations did not show appreciable activity with either tRNAPaUA or tRNACPaA. In contrast, a three-point mutant, SepRS(E418N E420N T423V), displayed substantial activity with tRNAPaUA, and also showed detectable activity with tRNACPaA. This mutant was previously found to aminoacylate phosphoserine to tRNAOpal and tRNAAmber [9]. About 60 pmol of Sep-tRNACys were produced by the wild-type SepRS, and about 15 pmol of Sep-tRNACys, 30 pmol of Sep-tRNAOpal, 25 pmol of Sep-tRNAAmber, 60 pmol of Sep-tRNAPaUA, and 7 pmol of Sep-tRNACPaA were produced by SepRS(E418N E420N T423V). Thus, the activity of SepRS(E418N E420N T423V) is higher with tRNAPaUA, but is lower with tRNACPaA, relative to tRNAOpal and tRNAAmber. SepRS(E418N E420N T423V) exhibited no detectable activity with endogenous tRNA mixtures from Escherichia coli, wheat germ, and Saccharomyces cerevisiae, and thus, the aminoacylation to tRNAPaUA by the aaRS mutant is highly specific [9]. Kinetic analysis The kinetic parameters for the aminoacylation confirmed the high efficiency of the SepRS(E418N E420N T423V)-tRNAPaUA pair. We determined the kinetic parameters of the phosphoserine aminoacylation of the wild-type SepRS for its cognate substrate, tRNACys, and those of the triple mutant SepRS(E418N E420N T423V) for tRNACys, tRNAOpal, tRNAAmber, tRNAPaUA, and tRNACPaA (Table 2). The kcat/Km value of SepRS(E418N E420N T423V) for tRNAPaUA was reduced by only half relative to that of the wild-type SepRS for tRNACys, and was about 2-fold higher than those of SepRS(E418N E420N T423V) for tRNAOpal and tRNAAmber. The activity of the SepRS(E418N E420N T423V)tRNAPaUA pair was higher than expected, since the primary purpose of this study was to obtain a pair of a SepRS and a tRNA bearing the unnatural base anticodon that has detectable activity for genetic code expansion, but not necessarily higher activity as compared to the previous SepRSsuppressor tRNA pairs. Structural modeling We examined the structural models of the complex of the SepRS mutant and the tRNAs containing Pa. On the basis of the crystal structures of the wild-type SepRStRNACysphosphoserine, the double mutant SepRS(E418N E420N)tRNAOpalphosphoserine, and SepRS(E418N E420N)tRNAAmberphosphoserine complexes [9], we constructed structural models of the triple mutant SepRS(E418N E420N T423V) in complex with either tRNACys, tRNAOpal, tRNAAmber, tRNAPaUA, or tRNACPaA (Fig. 3). In the wild-type SepRStRNACysphosphoserine complex (Fig. 3A), the first anticodon base, G34, interacts with the sidechain of Phe526. The second anticodon base, C35, stacks on the side-chain of Phe526, and the NH2 group of C35 hydrogen-bonds with the side-chain of Glu420. The N1 and the NH2 group of the third anticodon base, A36, hydrogen-bond with the side-chain of Asn432. Since A36 is common among tRNACys, tRNAOpal, tRNAAmber, tRNAPaUA, tRNACPaA, we will discuss the recognition patterns for the first and second anticodon bases (positions 34 and 35, respectively). In the model of the triple mutant SepRS(E418N E420N T423V)tRNACysphosphoserine (Fig. 3B), the side-chain of Asn420 hydrogen-bonds with the NH2 group of C35. In contrast,

in the model of SepRS(E418N E420N T423V)tRNAOpalphosphoserine (Fig. 3C), the side-chain of Phe526 stacks on the C35 base, and the side-chain of Asn420 hydrogen-bonds with the NH2 group of C35. The aromatic ring of U34 is vertically stacked by the side-chain of Phe526, and interacts with the side-chains of Arg492 and Ile493. In the model of SepRS(E418N E420N T423V)tRNAAmberphosphoserine (Fig. 3D), the side-chain of Phe526 stacks on the U35 base, and the side-chain of Asn420 hydrogen bonds with the O4 of U35. The U35 base is stacked by the side-chain of Phe526. The aromatic ring of C34 is vertically stacked by the side-chain of Phe526, and interacts with the sidechains of Arg492 and Ile493. Although no hydrogen-bonded interactions between the Pa base in the anticodon and SepRS were observed, some specific features of the interaction between the SepRS mutant and tRNAPaUA were revealed. In the model of SepRS(E418N E4240N T423V)tRNAPaUA fphosphoserine (Fig. 3E), the recognition manner of the U35 base is similar to that in SepRS(E418N E4240N T423V)tRNAAmberphosphoserine. The pyrrole ring of Pa34 was located close to the sidechains of Arg492, Ile493, and Phe526, suggesting that CH–p interactions occur between them. This abundance of CH–p interactions with the Pa34 base might contribute to the high activity of SepRS(E418N E4240N T423V) with tRNAPaUA. In addition, a hydrophobic pocket, which is formed by the 5 and 6 positions of U35, Phe525, the alkyl chains of Arg492 and Ile 493, and the sugar moiety of U33, might preferably accommodate the hydrophobic Pa base, rather than the natural bases. The residues at the mutated sites in SepRS(E418N E4240N T423V) could assist in the formation of the hydrophobic pocket by fixing the orientation of the U35 base. In contrast, in the model of SepRS(E418N E4240N T423V)tRNACPaAphosphoserine (Fig. 3F), the side-chain of Phe526 stacks on the Pa35 base. However, Asn420 cannot hydrogen bond with the Pa35 base in the same manner as with the carbonyl group of C35, and the aldehyde group of Pa35 might clash with Gly427, causing the lower activity of SepRS(E418N E4240N T423V) with tRNACPaA than those with tRNAPaUA and tRNACys. Implications We have described the specific recognition between the PaUA anticodon and the triple mutant SepRS(E418N E420N T423V) for the expansion of the genetic alphabet. The SepRS(E418N E420N T423V)tRNAPaUA pair could be employed for expanding the genetic code system using mRNA containing the UADs codon, which enables the site-specific incorporation of phosphoserine at desired positions within target proteins. This method would facilitate studies of serine phosphorylation events within proteins. Furthermore, we showed that the hydrophobicity of Pa is useful for creating new types of recognition between a tRNA and an aaRS. Novel, specific aaRS-tRNA pairs could be coevolutionarily developed by combining the incorporation of unnatural base pairs into the tRNA and amino acid mutations in the aaRS. Acknowledgments This work was supported by Grants-in-Aid for Scientific Research in Priority Areas from the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan, and the RIKEN Structural Genomics/Proteomics Initiative (RSGI) of the National Project on Protein Structural and Functional Analyses, MEXT. R.F. was supported by Research Fellowships from the Japan Society for the Promotion of Science. We thank Akira Sato and Tsuneo Mitsui for synthesizing the nucleoside derivatives. I.H. was supported by a Grant-in-Aid for Scientific Research (KAKENHI 19201046) from the Ministry of Education, Culture, Sports, Science, and Technology.

R. Fukunaga et al. / Biochemical and Biophysical Research Communications 372 (2008) 480–485

References [1] A.A. Henry, F.E. Romesberg, Beyond A, C, G and T: augmenting nature’s alphabet, Curr. Opin. Chem. Biol. 7 (2003) 727–733. [2] M.J. Moser, J.R. Prudent, Enzymatic repair of an expanded genetic information system, Nucleic Acids Res. 31 (2003) 5048–5053. [3] I. Hirao, M. Kimoto, T. Mitsui, T. Fujiwara, R. Kawai, A. Sato, Y. Harada, S. Yokoyama, An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA, Nat. Methods 3 (2006) 729–735. [4] I. Hirao, Unnatural base pair systems for DNA/RNA-based biotechnology, Curr. Opin. Chem. Biol. 10 (2006) 622–627. [5] I. Hirao, T. Ohtsuki, T. Fujiwara, T. Mitsui, T. Yokogawa, T. Okuni, H. Nakayama, K. Takio, T. Yabuki, T. Kigawa, K. Kodama, K. Nishikawa, S. Yokoyama, An unnatural base pair for incorporating amino acid analogs into proteins, Nat. Biotechnol. 20 (2002) 177–182.

485

[6] J.D. Bain, C. Switzer, A.R. Chamberlin, S.A. Benner, Ribosome-mediated incorporation of a non-standard amino acid into a peptide through expansion of the genetic code, Nature 356 (1992) 537–539. [7] A. Sauerwald, W. Zhu, T.A. Major, H. Roy, S. Palioura, D. Jahn, W.B. Whitman, J.R. Yates, M. Ibba, D. Soll, RNA-dependent cysteine biosynthesis in archaea, Science 307 (2005) 1969–1972. [8] R. Fukunaga, S. Yokoyama, Structural insights into the second step of RNAdependent cysteine biosynthesis in archaea: crystal structure of Sep-tRNA: Cys-tRNA synthase from Archaeoglobus fulgidus, J. Mol. Biol. (2007). [9] R. Fukunaga, S. Yokoyama, Structural insights into the first step of RNAdependent cysteine biosynthesis in archaea, Nat. Struct. Mol. Biol. 14 (2007) 272–279. [10] I. Hirao, Y. Harada, M. Kimoto, T. Mitsui, T. Fujiwara, S. Yokoyama, A twounnatural-base-pair system toward the expansion of the genetic code, J. Am. Chem. Soc. 126 (2004) 13298–13305. [11] C. Kao, S. Rudisser, M. Zheng, A simple and efficient method to transcribe RNAs with reduced 30 heterogeneity, Methods 23 (2001) 201–205.