- Email: [email protected]
Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region
Veterinary Parasitology 132 (2005) 51–55 www.elsevier.com/locate/vetpar
Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region J.W.B. van der Giessen a,*, M. Fonville a, I. Briels a, E. Pozio b a
Microbiological Laboratory for Health Protection, National Institute of Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven, The Netherlands b Department of Infectious, Parasitic and Immunomediated Diseases, Istituto Superiore di Sanita`, viale Regina Elena 299, 00161 Rome, Italy
Abstract The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751 bp fragment, whereas the three non-encapsulated species show a fragment of 800 bp with T. pseudospiralis showing an additional fragment of 522 bp. Although the size of the 800 bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. # 2005 Elsevier B.V. All rights reserved. Keywords: 5S rDNA intergenic spacer region; Trichinella; Non-encapsulated species; Reverse line blot; Phylogeny
1. Introduction Today, eight species and three additional genotypes, morphologically indistinguishable, are recog* Corresponding author. Tel.: +31 30 2743926; fax: +31 30 2744434. E-mail address: [email protected] (J.W.B. van der Giessen).
nized in the genus Trichinella (Murrell et al., 2000; Pozio et al., 2002). Trichinella pseudospiralis has been recently recognized as a human pathogen in an outbreak in France (Ranque et al., 2000). There is an increase of reports of this non-encapsulated species in domestic, synantropic and sylvatic animals (both mammals and birds) around the world (Pozio et al., in press; Gamble et al., 2005). Trichinella papuae has been detected in humans, domestic and sylvatic swine,
0304-4017/$ – see front matter # 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2005.05.065
52
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55
and in farm-raised saltwater crocodiles of Papua New Guinea (Owen et al., 2001; Pozio et al., 1999, 2004), whereas T. zimbabwensis has been detected only in farm-raised Nile crocodiles of Zimbabwe; however, experimental infections have shown its infectivity to swine and laboratory rodents (Pozio et al., 2002). The complexity of the genus Trichinella encompassing domestic, synantropic and sylvatic cycles, stresses the need to develop new tools for molecular, epidemiological and phylogenetic studies. Recently, an easy and useful PCR-derived method, based on the 5S ribosomal DNA intergenic spacer region was described in developing a reverse line blot (RLB) assay, which allows simultaneously identifying single muscle larvae of six Trichinella species, i.e. T. spiralis, T. britovi, T. nativa, T. murrelli, T. nelsoni and T. pseudospiralis, and two genotypes, Trichinella T6 and T8 (Rombout et al., 2001). The aim of the present study was to analyze the 5S rDNA spacer region of T. papuae and T. zimbabwensis and to identify these non-encapsulated Trichinella species by the RLB assay. This method enables us to unequivocally identify single encapsulated and nonencapsulated larvae of Trichinella at the species or genotype level.
These strains originated from the International Trichinella Reference Center of Rome, Italy (Pozio, 2001). 2.2. Preparation of genomic DNA and PCR assay Total genomic DNA was extracted from muscle larvae and the 5S rDNA intergenic spacer region was amplified by PCR as previously described (Rombout et al., 2001). 2.3. Reverse line blot hybridization Specific oligonucleotide probes, with an N-terminal N-(trifluoracetamidohexyl-cyanoethyl,N,N-diisopropyl phophoramidite[TFA])-C6 amino linker (Isogen, the Netherlands), have been designed for T. papuae and T. zimbabwensis (Table 1). The hybridization protocol has been previously described (Rombout et al., 2001). To test the specificity of the nonencapsulated species-specific oligonucleotide probes, the 5S rDNA intergenic regions of the three nonencapsulated and two encapsulated species were amplified as described (Rombout et al., 2001). 2.4. DNA sequence and phylogenetic analysis
2. Materials and methods 2.1. Parasite strains Five reference strains were used in this study: a strain of each non-encapsulated species, T. zimbabwensis (code ISS 1029), T. papuae (code ISS 572) and T. pseudospiralis (code ISS 13) and; two strains of the two encapsulated species, T. spiralis (codes ISS 3 and ISS 14) and T. britovi (codes ISS 324 and ISS 89).
PCR-products of T. zimbabwensis, T. papuae and T. pseudospiralis were directly sequenced by a capillary sequencer (Applied Biosystems 3700). DNA sequences were submitted to GenBank (accession numbers will be added) and analyzed together with the DNA sequences of the encapsulated Trichinella species and genotypes (GenBank accession numbers AY009943–AY009950) previously submitted to GenBank (Rombout et al., 2001). Phylogenetic trees were build using the neighbour joining (NJ) and unweighted
Table 1 Oligonucleotide probes used in the reverse line blot assay Oligonucleotide
Probe
Probe location
Tm (8C)
Specificity
RLBT RLBTs RLBTbr RLBTps RLBTpap RLBTzim
CCAATATCATCGGTGCAGTT TCCTTTTAAGACCACAGTGG TGGTGCATTTTTTCCAATTGTC TAGTGTTGTAGAAGGATCATCA GTGTACAAGGTTCATCTTCATCA GTGTTCAAGGTTCATTTTCGT
605–624 641–660 582–603 316–337 310–332 312–332
58.2 58.2 57.7 57.7 57.0 57.0
Trichinella spp.a T. spiralis T. britovi T. pseudospiralis T. papuae T. zimbabwensis
New probes for non-encapsulated species are underlined. a All encapsulated species.
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55
53
pair group method of analysis (UPGMA) and the similarity values of nucleotides were calculated by Kimura two-parameter method using the Bionumerics package version 3.5 (Applied Maths, Belgium).
3. Results The two selected primers amplified a single prominent 5S rDNA intergenic spacer region product of approximately 750 bp for T. spiralis and T. britovi, two products of 522 and 800 bp for T. pseudospiralis and only 1 product of 800 bp for T. papuae and T. zimbabwensis (Fig. 1). Both PCR fragments of T. pseudospiralis were directly sequenced and the 50 -end of both fragments were identical, suggesting that the 800 bp fragment was a repeat of the single interspacer region. For T. zimbabwensis and T. papuae, specific oligonucleotides were designed from the 5S rDNA intergenic region. The DNA sequence and the locations of the probes are shown in Table 1. PCR-products of the tested Trichinella species hybridized with the specific selected oligonucleotides only, without cross-reactivity (Fig. 2). The Trichinella control oligonucleotide probe reacted only with the encapsulated strains and not with the non-encapsulated ones. The UPGMA and Neighbor Joining phylogenetic analyses showed similar results characterized by the presence of two main clusters belonging to nonencapsulated and encapsulated species (Fig. 3).
Fig. 1. Agarose gel electrophoresis of PCR amplicons of 5S rDNA intergenic spacer regions of non-encapsulated and encapsulated Trichinella species. M: marker; (1) T. papuae; (2) T. zimbabwensis; (3) T. pseudospiralis; (4) T. spiralis; (5) T. britovi; (6) blank.
Fig. 2. Reverse line blot hybridization with 5S rDNA intergenic PCR products from Trichinella reference strains. The oligonucleotide probes are applied in the horizontal lanes: (A) Trichinella for all encapsulated species; (B) T. spiralis; (C) T. britovi; (D) T. pseudospiralis; (E) T. papuae; (F) T. zimbabwensis. The PCR products are applied in the vertical lanes: (1) T. spiralis ISS 14; (2) T. spiralis ISS 3; (3) T. britovi ISS 324; (4) T. britovi ISS 89; (5) T. pseudospiralis ISS 13; (6) T. papuae ISS 572; (7) T. zimbabwensis ISS 1029.
Fig. 3. Dendrogram constructed by unweigthed pair group method of analysis on the basis of the 5S rDNA interspacer sequences of different Trichinella species. Tpap: T. papuae; Tzimb: T. zimbabwensis; Tpseu-H: T. pseudospiralis 800 bp PCR fragment; Tpseu-L: T. pseudospiralis 522 bp PCR fragment; Tmur: T. murelli; Tbri ISS 324: T. britovi ISS 324; Tbri ISS 89: T. britovi ISS 89; Tnat: T. nativa; Tsp: T. spiralis; Tnels: T. nelsoni. Codes refer to GenBank accession numbers.
54
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55
Among the non-encapsulated species, T. papuae and T. zimbabwensis and T. pseudospiralis isolates clustered together, respectively. Among the encapsulated Trichinella species, the five Trichinella species and other genotypes are clearly separated from each other, but more isolates of the same genotype clustered together. The similarity value between the non-encapsulated and the encapsulated species ranged between 63.5% and 68.674%, whereas the similarity value between T. papuae and T. zimbabwensis was 96.8%, and between T. pseudospiralis and T. zimbabwensis was 79.3%. This indicates the more close relatedness between T. zimbabwensis and T. papuae compared to the other non-encapsulated T. pseudospiralis.
4. Discussion Newly isolated Trichinella larvae can be identified by sequencing PCR products from the 5S rDNA intergenic spacer region. After comparing DNA sequences, a species specific oligonucleotide probe can be determined and added to the RLB assay. Because the primer regions in the 5S rDNA genes are highly conserved, genomic DNA from any possible newly identified species can be amplified, sequenced and introduced in the RLB. In this study, we analyzed the two non-encapsulated species T. papuae and T. zimbabwensis infecting both mammals and reptiles. Amplification of genomic DNA from these non-encapsulated species resulted in an amplified fragment of 800 bp. In addition, amplification of DNA from T. pseudospiralis resulted in a second band migrating at 522 bp. After sequencing these PCR products, the 522 bp and the 50 -end of the 800 bp fragment were identical for T. pseudospiralis. This result could be explained by the amplification of two distinct interspacer regions. Phylogenetic analysis showed that the non-encapsulated and encapsulated Trichinella species cluster separately. In addition, T. zimbabwensis and T. papuae were more closely related to each other when compared to T. pseudospiralis confirming the previous results based on the allozyme analysis and the molecular analyses of different genomic regions (La Rosa et al., 2003; Zarlenga et al., 2004). Thus, preliminary evidence suggests that the intergenic spacer region of the 5SrRNA gene provides a stable
genetic marker for delineating among the Trichinella species and genotypes, and its sequence maybe useful for identifying new Trichinella isolates in epidemiological studies. Furthermore, RLB is a simple and rapid method for identifying both encapsulated and non-encapsulated Trichinella species and genotypes, including the newly described non-encapsulated species detected in equatorial regions.
Acknowledgement This study was carried out on behalf of the Inspectorate for Health Protection and Veterinary Public Health, Food and Consumer Product Safety Authority (VWA), The Netherlands.
References Gamble, R.H., Pozio, E., Lichtenfels, J.R., Zarlenga, D.S., 2005. Trichinella pseudospiralis from a wild pig in Texas. USA. Vet. Parasitol. 132, 147–150. La Rosa, G., Marucci, G., Pozio, E., 2003. Biochemical analysis of encapsulated and non-encapsulated species of Trichinella (Nematoda Trichinellidae) from cold- and warm-blooded animals reveals a high genetic divergence in the genus. Parasitol. Res. 91, 462–466. Murrell, K.D., Lichtenfels, J.R., Zarlenga, D.S., Pozio, E., 2000. The systematics of Trichinella with a key to species. Vet. Parasitol. 93, 293–307. Owen, I.L., Pozio, E., Tamburrini, A., Danaya, R.T., Bruschi, F., Gomez Morales, M.A., 2001. Focus of human trichinellosis in Papua New Guinea. Am. J. Trop. Med. Hyg. 65, 553–557. Pozio, E., 2001. New patterns of Trichinella infections. Vet. Parasitol. 98, 133–148. Pozio, E., Christensson, D., Ste´ en, M., Marucci, G., La Rosa, G., ˚ gren, E., Hall, M., in press. Bro¨ jer, C., Mo¨ rner, T., Uhlhorn, H., A Trichinella pseudospiralis foci in Sweden. Vet. Parasitol. Pozio, E., Foggin, C.M., Marucci, G., La Rosa, G., Sacchi, L., Corona, S., Rossi, P., Mukaratirwa, S., 2002. Trichinella zimbabwensis n.sp. (Nematoda), a new non-encapsulated species from crocodiles (Crocodylus niloticus) in Zimbabwe also infecting mammals. Int. J. Parasitol. 32, 1787–1799. Pozio, E., Owen, I.L., La Rosa, G., Sacchi, L., Rossi, P., Corona, S., 1999. Trichinella papuae n.sp. (Nematoda), a new non-encapsulated species from domestic and sylvatic swine of Papua New Guinea. Int. J. Parasitol. 29, 1825–1839. Pozio, E., Owen, I.L., Marucci, G., La Rosa, G., 2004. Trichinella papuae in saltwater crocodiles (Crocodylus porosus) of Papua New Guinea: a potential source of human infection. Emerg. Infect. Dis. 10, 1507–1509.
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55 Ranque, S., Faugere, B., Pozio, E., et al., 2000. Trichinella pseudospiralis outbreak in France. Emerg. Infect. Dis. 6, 543–547. Rombout, Y.B., Bosch, S., van der Giessen, J.W., 2001. Detection and identification of eight Trichinella genotypes by reverse line blot hybridization. J. Clin. Microbiol. 39, 642–646.
55
Zarlenga, D.S., La Rosa, G., Pozio, E., Rosenthal, B., 2004. Identification and classification within the genus Trichinella, with special emphasis on non-encapsulated species. Vet. Parasitol. 125, 75–78.
Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region J.W.B. van der Giessen a,*, M. Fonville a, I. Briels a, E. Pozio b a
Microbiological Laboratory for Health Protection, National Institute of Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven, The Netherlands b Department of Infectious, Parasitic and Immunomediated Diseases, Istituto Superiore di Sanita`, viale Regina Elena 299, 00161 Rome, Italy
Abstract The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751 bp fragment, whereas the three non-encapsulated species show a fragment of 800 bp with T. pseudospiralis showing an additional fragment of 522 bp. Although the size of the 800 bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. # 2005 Elsevier B.V. All rights reserved. Keywords: 5S rDNA intergenic spacer region; Trichinella; Non-encapsulated species; Reverse line blot; Phylogeny
1. Introduction Today, eight species and three additional genotypes, morphologically indistinguishable, are recog* Corresponding author. Tel.: +31 30 2743926; fax: +31 30 2744434. E-mail address: [email protected] (J.W.B. van der Giessen).
nized in the genus Trichinella (Murrell et al., 2000; Pozio et al., 2002). Trichinella pseudospiralis has been recently recognized as a human pathogen in an outbreak in France (Ranque et al., 2000). There is an increase of reports of this non-encapsulated species in domestic, synantropic and sylvatic animals (both mammals and birds) around the world (Pozio et al., in press; Gamble et al., 2005). Trichinella papuae has been detected in humans, domestic and sylvatic swine,
0304-4017/$ – see front matter # 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2005.05.065
52
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55
and in farm-raised saltwater crocodiles of Papua New Guinea (Owen et al., 2001; Pozio et al., 1999, 2004), whereas T. zimbabwensis has been detected only in farm-raised Nile crocodiles of Zimbabwe; however, experimental infections have shown its infectivity to swine and laboratory rodents (Pozio et al., 2002). The complexity of the genus Trichinella encompassing domestic, synantropic and sylvatic cycles, stresses the need to develop new tools for molecular, epidemiological and phylogenetic studies. Recently, an easy and useful PCR-derived method, based on the 5S ribosomal DNA intergenic spacer region was described in developing a reverse line blot (RLB) assay, which allows simultaneously identifying single muscle larvae of six Trichinella species, i.e. T. spiralis, T. britovi, T. nativa, T. murrelli, T. nelsoni and T. pseudospiralis, and two genotypes, Trichinella T6 and T8 (Rombout et al., 2001). The aim of the present study was to analyze the 5S rDNA spacer region of T. papuae and T. zimbabwensis and to identify these non-encapsulated Trichinella species by the RLB assay. This method enables us to unequivocally identify single encapsulated and nonencapsulated larvae of Trichinella at the species or genotype level.
These strains originated from the International Trichinella Reference Center of Rome, Italy (Pozio, 2001). 2.2. Preparation of genomic DNA and PCR assay Total genomic DNA was extracted from muscle larvae and the 5S rDNA intergenic spacer region was amplified by PCR as previously described (Rombout et al., 2001). 2.3. Reverse line blot hybridization Specific oligonucleotide probes, with an N-terminal N-(trifluoracetamidohexyl-cyanoethyl,N,N-diisopropyl phophoramidite[TFA])-C6 amino linker (Isogen, the Netherlands), have been designed for T. papuae and T. zimbabwensis (Table 1). The hybridization protocol has been previously described (Rombout et al., 2001). To test the specificity of the nonencapsulated species-specific oligonucleotide probes, the 5S rDNA intergenic regions of the three nonencapsulated and two encapsulated species were amplified as described (Rombout et al., 2001). 2.4. DNA sequence and phylogenetic analysis
2. Materials and methods 2.1. Parasite strains Five reference strains were used in this study: a strain of each non-encapsulated species, T. zimbabwensis (code ISS 1029), T. papuae (code ISS 572) and T. pseudospiralis (code ISS 13) and; two strains of the two encapsulated species, T. spiralis (codes ISS 3 and ISS 14) and T. britovi (codes ISS 324 and ISS 89).
PCR-products of T. zimbabwensis, T. papuae and T. pseudospiralis were directly sequenced by a capillary sequencer (Applied Biosystems 3700). DNA sequences were submitted to GenBank (accession numbers will be added) and analyzed together with the DNA sequences of the encapsulated Trichinella species and genotypes (GenBank accession numbers AY009943–AY009950) previously submitted to GenBank (Rombout et al., 2001). Phylogenetic trees were build using the neighbour joining (NJ) and unweighted
Table 1 Oligonucleotide probes used in the reverse line blot assay Oligonucleotide
Probe
Probe location
Tm (8C)
Specificity
RLBT RLBTs RLBTbr RLBTps RLBTpap RLBTzim
CCAATATCATCGGTGCAGTT TCCTTTTAAGACCACAGTGG TGGTGCATTTTTTCCAATTGTC TAGTGTTGTAGAAGGATCATCA GTGTACAAGGTTCATCTTCATCA GTGTTCAAGGTTCATTTTCGT
605–624 641–660 582–603 316–337 310–332 312–332
58.2 58.2 57.7 57.7 57.0 57.0
Trichinella spp.a T. spiralis T. britovi T. pseudospiralis T. papuae T. zimbabwensis
New probes for non-encapsulated species are underlined. a All encapsulated species.
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55
53
pair group method of analysis (UPGMA) and the similarity values of nucleotides were calculated by Kimura two-parameter method using the Bionumerics package version 3.5 (Applied Maths, Belgium).
3. Results The two selected primers amplified a single prominent 5S rDNA intergenic spacer region product of approximately 750 bp for T. spiralis and T. britovi, two products of 522 and 800 bp for T. pseudospiralis and only 1 product of 800 bp for T. papuae and T. zimbabwensis (Fig. 1). Both PCR fragments of T. pseudospiralis were directly sequenced and the 50 -end of both fragments were identical, suggesting that the 800 bp fragment was a repeat of the single interspacer region. For T. zimbabwensis and T. papuae, specific oligonucleotides were designed from the 5S rDNA intergenic region. The DNA sequence and the locations of the probes are shown in Table 1. PCR-products of the tested Trichinella species hybridized with the specific selected oligonucleotides only, without cross-reactivity (Fig. 2). The Trichinella control oligonucleotide probe reacted only with the encapsulated strains and not with the non-encapsulated ones. The UPGMA and Neighbor Joining phylogenetic analyses showed similar results characterized by the presence of two main clusters belonging to nonencapsulated and encapsulated species (Fig. 3).
Fig. 1. Agarose gel electrophoresis of PCR amplicons of 5S rDNA intergenic spacer regions of non-encapsulated and encapsulated Trichinella species. M: marker; (1) T. papuae; (2) T. zimbabwensis; (3) T. pseudospiralis; (4) T. spiralis; (5) T. britovi; (6) blank.
Fig. 2. Reverse line blot hybridization with 5S rDNA intergenic PCR products from Trichinella reference strains. The oligonucleotide probes are applied in the horizontal lanes: (A) Trichinella for all encapsulated species; (B) T. spiralis; (C) T. britovi; (D) T. pseudospiralis; (E) T. papuae; (F) T. zimbabwensis. The PCR products are applied in the vertical lanes: (1) T. spiralis ISS 14; (2) T. spiralis ISS 3; (3) T. britovi ISS 324; (4) T. britovi ISS 89; (5) T. pseudospiralis ISS 13; (6) T. papuae ISS 572; (7) T. zimbabwensis ISS 1029.
Fig. 3. Dendrogram constructed by unweigthed pair group method of analysis on the basis of the 5S rDNA interspacer sequences of different Trichinella species. Tpap: T. papuae; Tzimb: T. zimbabwensis; Tpseu-H: T. pseudospiralis 800 bp PCR fragment; Tpseu-L: T. pseudospiralis 522 bp PCR fragment; Tmur: T. murelli; Tbri ISS 324: T. britovi ISS 324; Tbri ISS 89: T. britovi ISS 89; Tnat: T. nativa; Tsp: T. spiralis; Tnels: T. nelsoni. Codes refer to GenBank accession numbers.
54
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55
Among the non-encapsulated species, T. papuae and T. zimbabwensis and T. pseudospiralis isolates clustered together, respectively. Among the encapsulated Trichinella species, the five Trichinella species and other genotypes are clearly separated from each other, but more isolates of the same genotype clustered together. The similarity value between the non-encapsulated and the encapsulated species ranged between 63.5% and 68.674%, whereas the similarity value between T. papuae and T. zimbabwensis was 96.8%, and between T. pseudospiralis and T. zimbabwensis was 79.3%. This indicates the more close relatedness between T. zimbabwensis and T. papuae compared to the other non-encapsulated T. pseudospiralis.
4. Discussion Newly isolated Trichinella larvae can be identified by sequencing PCR products from the 5S rDNA intergenic spacer region. After comparing DNA sequences, a species specific oligonucleotide probe can be determined and added to the RLB assay. Because the primer regions in the 5S rDNA genes are highly conserved, genomic DNA from any possible newly identified species can be amplified, sequenced and introduced in the RLB. In this study, we analyzed the two non-encapsulated species T. papuae and T. zimbabwensis infecting both mammals and reptiles. Amplification of genomic DNA from these non-encapsulated species resulted in an amplified fragment of 800 bp. In addition, amplification of DNA from T. pseudospiralis resulted in a second band migrating at 522 bp. After sequencing these PCR products, the 522 bp and the 50 -end of the 800 bp fragment were identical for T. pseudospiralis. This result could be explained by the amplification of two distinct interspacer regions. Phylogenetic analysis showed that the non-encapsulated and encapsulated Trichinella species cluster separately. In addition, T. zimbabwensis and T. papuae were more closely related to each other when compared to T. pseudospiralis confirming the previous results based on the allozyme analysis and the molecular analyses of different genomic regions (La Rosa et al., 2003; Zarlenga et al., 2004). Thus, preliminary evidence suggests that the intergenic spacer region of the 5SrRNA gene provides a stable
genetic marker for delineating among the Trichinella species and genotypes, and its sequence maybe useful for identifying new Trichinella isolates in epidemiological studies. Furthermore, RLB is a simple and rapid method for identifying both encapsulated and non-encapsulated Trichinella species and genotypes, including the newly described non-encapsulated species detected in equatorial regions.
Acknowledgement This study was carried out on behalf of the Inspectorate for Health Protection and Veterinary Public Health, Food and Consumer Product Safety Authority (VWA), The Netherlands.
References Gamble, R.H., Pozio, E., Lichtenfels, J.R., Zarlenga, D.S., 2005. Trichinella pseudospiralis from a wild pig in Texas. USA. Vet. Parasitol. 132, 147–150. La Rosa, G., Marucci, G., Pozio, E., 2003. Biochemical analysis of encapsulated and non-encapsulated species of Trichinella (Nematoda Trichinellidae) from cold- and warm-blooded animals reveals a high genetic divergence in the genus. Parasitol. Res. 91, 462–466. Murrell, K.D., Lichtenfels, J.R., Zarlenga, D.S., Pozio, E., 2000. The systematics of Trichinella with a key to species. Vet. Parasitol. 93, 293–307. Owen, I.L., Pozio, E., Tamburrini, A., Danaya, R.T., Bruschi, F., Gomez Morales, M.A., 2001. Focus of human trichinellosis in Papua New Guinea. Am. J. Trop. Med. Hyg. 65, 553–557. Pozio, E., 2001. New patterns of Trichinella infections. Vet. Parasitol. 98, 133–148. Pozio, E., Christensson, D., Ste´ en, M., Marucci, G., La Rosa, G., ˚ gren, E., Hall, M., in press. Bro¨ jer, C., Mo¨ rner, T., Uhlhorn, H., A Trichinella pseudospiralis foci in Sweden. Vet. Parasitol. Pozio, E., Foggin, C.M., Marucci, G., La Rosa, G., Sacchi, L., Corona, S., Rossi, P., Mukaratirwa, S., 2002. Trichinella zimbabwensis n.sp. (Nematoda), a new non-encapsulated species from crocodiles (Crocodylus niloticus) in Zimbabwe also infecting mammals. Int. J. Parasitol. 32, 1787–1799. Pozio, E., Owen, I.L., La Rosa, G., Sacchi, L., Rossi, P., Corona, S., 1999. Trichinella papuae n.sp. (Nematoda), a new non-encapsulated species from domestic and sylvatic swine of Papua New Guinea. Int. J. Parasitol. 29, 1825–1839. Pozio, E., Owen, I.L., Marucci, G., La Rosa, G., 2004. Trichinella papuae in saltwater crocodiles (Crocodylus porosus) of Papua New Guinea: a potential source of human infection. Emerg. Infect. Dis. 10, 1507–1509.
J.W.B. van der Giessen et al. / Veterinary Parasitology 132 (2005) 51–55 Ranque, S., Faugere, B., Pozio, E., et al., 2000. Trichinella pseudospiralis outbreak in France. Emerg. Infect. Dis. 6, 543–547. Rombout, Y.B., Bosch, S., van der Giessen, J.W., 2001. Detection and identification of eight Trichinella genotypes by reverse line blot hybridization. J. Clin. Microbiol. 39, 642–646.
55
Zarlenga, D.S., La Rosa, G., Pozio, E., Rosenthal, B., 2004. Identification and classification within the genus Trichinella, with special emphasis on non-encapsulated species. Vet. Parasitol. 125, 75–78.