- Email: [email protected]
Phylogenetic analysis of internal transcribed spacer regions of the genus Alternaria, and the significance of filament-beaked conidia
Mycol. Res. 106 (2) : 164–169 (February 2002).
# The British Mycological Society
164
DOI : 10.1017\S0953756201005317 Printed in the United Kingdom.
Phylogenetic analysis of internal transcribed spacer regions of the genus Alternaria, and the significance of filament-beaked conidia
Hsin-Hung CHOU and Wen-Shi WU Department of Plant Pathology, National Taiwan University, Taipei, Taiwan. E-mail : hoganwu!ccms.ntu.edu.tw Received 23 November 2000 ; accepted 10 September 2001.
Internal transcribed regions (ITS1 and ITS2) of 11 different fungi, i.e. 8 species of Alternaria, Nimbya gomphrenae, Stemphylium vesicarium, and Ulocladium botrytis, were sequenced. Their phylogenetic relationships with another 36 species in Pleosporaceae in GenBank were analyzed by parsimony and distance methods. These two methods positioned filament-beaked Alternaria as a monophyletic group discrete from the other members in genus Alternaria. A hypothesis proposing that the filament-beaked speices of Alternaria evolved a particular evolutionary route distinguishable from other species based on molecular evidence, the unique traits of morphological adaptation for liberation and their subsistent strategies has been discussed.
INTRODUCTION Many species of Alternaria are serious plant pathogens. They are well known in causing leaf spots, blotches, blights of many agricultural and economic crops, and blemishes or damage in stored products, resulting in billions of dollars of losses annually (Yu 1992). Some species of Alternaria also cause serious and sometimes fatal diseases among mammals. Certain Alternaria species have been proved to be anamorphs of the genus Lewia (Simmons 1986). However, the corresponding telemorphs of most other species have yet to be determined. Previous studies have subdivided the genus into several groups according to catenation (spores in chain) and conidial morphology. Based on catenation, the genus Alternaria was divided into three major sections, i.e. Longicatenatae, Brevicatenatae, and Noncatenatae (Neergard 1945). Unfortunately, catenation and conidial morphology are readily affected by the conditions of growth and thus may be unreliable for both implying phylogenetic relationship and for species discrimination (Rotem 1994). The taxonomic system of this genus thus remains unclear and further studies to clarify their phylogenetic relationship are needed. In this study, the evolutionary relationships among Alternaria spp., and the four other related genera, i.e. Stemphylium, Ulocladium, Exserohilum, and Nimbya (Alexopoulos, Mims & Blackwell 1996, Simmons, 1992) were investigated by analysing their internal transcribed spacers between 18S rRNA and 25S rRNA genes because this region has been proved to be useful for
evaluating the phylogenetic relationships at the generic and species level in many fungal genera (White et al. 1990). MATERIALS AND METHODS Fungal isolates Eleven isolates, including eight species of Alternaria, Nimbya gomphrenae, Stemphylium vesicarium, and Ulocladium botrytis were used in this study (Table 1). These isolates were obtained from the seeds of various crops and their identities confirmed by morphology and pathogenicity by FIRDI (Food Industry Research and Development Institute, Taiwan). The isolates were maintained on V8-juice media, and have been deposited in the Culture Collection and Research Center in Taiwan. DNA extraction Stock cultures of each isolate were grown in 100 ml of potato dextrose broth in 250 ml Erlenmeyer flasks on an orbital shaker (100 rev min−") at 25 mC for 3 d. Total DNA of each isolate was extracted from the mycelia by DNeasyTM Plant Mini Kit (QIAGEN). PCR amplification Primer pairs ITS5-ITS4 were used for amplification of the ribosomal DNA containing the internal transcribed spacer 1, 5n8s rDNA, and internal transcribed spacer 2 by polymerse chain reaction (White et al. 1990). The oligonucleotide sequence of primer ITS5 was 5hGG-
H.-H. Chou and W.-S. Wu
165
Table 1. Source and GenBank accession number of sequences used.
Taxa Alternaria alternaria A. brassicae A. brassicicola A. carotiincultae A. carthami A. cheiranithi A. crassa A. dauci A. dianthi A. dianthicola A. infectoria A. japonica A. linicola A. lini A. longipes A. macrospora A. panax A. petroselini A. photistica A. porri A. protenta A. radicina A. raphani A. selini A. sesami A. smyrnii A. solani A. tagetica A. tenuissima A. zinniae Exserohilum mcginnisii E. pedicellatum Lewia infectoria Nimbya gomphrenae Pleospora tarda P. herbarum Stemphylium alfalfa S. botryosum S. callistephi S. herbarum S. sarcinaeforme S. solani S. vesicarium Ulocladium alternariae U. atrum U. botrytis U. chartarum
Sequences from this studya
Source codea
j
CCRC33657
j
CCRC33651
j
CCRC33653
j
CCRC33708
j j
CCRC33652 CCRC33654
j
CCRC33663
j
CCRC33655
j
CCRC33648
j
CCRC33656
j
CCRC33650
Accession no.b of ITS1
Accession no. of ITS2
AF229461 AF229463 U05198 AF229465 AF265212 AF229457 AF229464 AF267130 D38758 AF267131 AF081456 AF229474 Y17086 Y17071 AF267137 AF229469 D38759 AF229454 AF081455 D38760 AF267132 AF267133 U05200 AF229455 D38761 AF229456 U80204 AF267134 AF229476 AF267135 AF081453 AF081453 AF229480 AF269194 AF229481 U05202 AF071343 Y17068 AF229482 AF071344 AF229483 AF203451 AF267138 AF229485 AF229486 AF267139 AF229488
AF229461 AF229463 U05198 AF229465 AF265212 AF229457 AF229464 AF267130 D38766 AF267131 AF081456 AF229474 Y17086 Y17071 AF267137 AF229469 D38767 AF229454 AF081455 D38770 AF267132 AF267133 U05200 AF229455 D38771 AF229456 U80204 AF267134 AF229476 AF267135 AF081453 AF081453 AF229480 AF269194 AF229481 U05202 AF071343 Y17068 AF229482 AF071344 AF229483 AF203451 AF267138 AF229485 AF229486 AF267139 AF229488
Eleven different species of fungi sequenced in this study were validated by FIRDI. All isolates with its code number were stored at Culture Collection and Research Center (CCRC) in FIRDI. a
AAGTAAAAGTCGTAACAAGG3h which corresponded to the 3h end of the 18s rDNA. The nucleotide sequence of primer ITS4 was 5hTCCTCCGCTTATTGATATGC3h which corresponded to the 5h end of the 28s rDNA. 25 µl PCR mixture for each PCR amplification contained 200 µ dATP, dTTP, dGTP, dCTP, 50 m KCL, 10 m Tris-HCl (pH 9n0 at 25 m), 1n5 m MgCl , 0n1 % Triton2 X-100, 0n5 µ of each primer, 1 # unit Taq DNA Polymerase (Promega), and 50 ng template DNA. The PCR reaction was performed for 35 cycles with an intial 5 min at 94 mC for denaturation
and a final 7 min at 72 m for the extension in a Perkin–Elmer GeneAmp PCR System 2400. Each cycle consisted of 35 s at 94 m, 55 s at 60 m and 1 min at 72 m. Successful amplification was checked by electrophoresis of an aliquot of the reaction mixture in a 1 % agarose gel (BRL). Sequencing of amplified DNA Amplified fragments of about 0n6 kb were cut from the agarose gel and purified with a QIAquick Gel Extraction
Phylogenetic analysis of genus Alternaria
166
Fig. 1. Neighbour-joining tree of Alternaria and related species. The tree was generated by PAUP 4.0 using the JukesCantor one-parameter algorithm to estimate the phylogeny of Alternaria spp. with related genera for sequence data from ITS1 and ITS2 combined regions of the ribosomal genes. Nimbya gomphrenae was rooted as the outgroup in the analysis. Values associated with branches indicate the degree of bootstrap support expressed as percentage of 1000 bootstrapped trees in which the corresponding clades are present. Alignment are deposited in TreeBASE, matrix accession number M951.
Kit (QIAGEN). Purified PCR products were sequenced directly in both directions using the two primers (ITS4 and ITS5) by Mission Biotech (Taipei, Taiwan). Sequence analysis Sequences for analysis were presented in Table 1. Among them, 11 taxa were sequenced in this study, and data on 36 taxa were obtained from GenBank. Sequence boundaries were determined by comparison with published sequences (Kusaba & Tsuge 1995, White et al. 1990) and were aligned using Clustal W, Version 1.7 (Higgins, Bleasby & Fuchs 1991, Thompson, Higgins & Gibson 1994), with some manual gap adjustments. Both ITS spacers were used in all the analyses, with the 5n8S region excluded. Both parsimony and distance methods available in Phylogenetic Analysis Using
Parsimony program (PAUP 4.0 ; Swofford 1998) were used to analyze the data matrix (TreeBase matrix accession number : M951). Nimbya gomphrenae belonging to anamorphic Pyrenophoraceae (Simmons 1989) was rooted as the outgoup in both analyses. Distance-based trees were generated with the neighbour-joining option of PAUP 4.0 using the JukesCantor one-parameter algorithm. The significance of the branches in both the parsimony and neighborjoining trees were tested by bootstrap analysis using 1000 bootstrap replications (Felsenstein 1985). RESULTS PCR experiments carried out on the rDNA ITS1 and ITS2 regions of 11 isolates, including 8 Alternaria spp., Nimbya gomphrenae, Stemphylium vesicarium, and
H.-H. Chou and W.-S. Wu Ulocladium botrytis, reproducibly amplified a single double-stranded product. The amplified DNA was sequenced directly in both strands. The size of ITS1 and ITS2 sequences ranged from 164 to 174 base pairs and from 157 to 171 base pairs, respectively. Although the neighbour-joining tree and the parsimony tree shared similar topology, the neighbourjoining tree offered a better resolution, since the parsimony analysis was limited by fewer numbers of informative sites in the ITS regions. For this reason, only the neighbour-joining tree is shown (Fig. 1). Both methods of phylogenetic analysis divided the 47 taxa into three major clusters. Filament-beaked Alternaria spp. formed a well-supported group. The second group consisted of small-spored Alternaria spp., Ulocladium spp., and the large-spored Alternaria brassicae. Finally, Stemphylium spp. and Exserohilum spp. were placed in the third group. The three groups were well supported, with bootstrap values over 73 % (Fig. 1). DISCUSSION The phylogenetic tree constructed based on the ITS region was highly resolved and consistent with morphological numerical taxonomy (Li, Zhang & Wu 1993) and traditional classification, except for the ambiguity of the Ulocladium spp. placement with obovoid, unbeaked spores (Simmons 1967), and Alternaria brassicae with small-spored Alternaria spp. This result supports the suggestion (Pryor & Gilbertson 2000) to place U. botrytis, U. atrum, and U. chartarum in Alternaria. In this study, Alternaria was further divided into two major groups similar to the conclusions drawn from rDNA RFLP patterns (Kusaba & Tsuge 1994), RAPD–PCR analysis (Cooke et al. 1998, Weir et al. 1998), and ITS and mt SSU rDNA analysis (Kusaba & Tsuge 1995, Pryor & Gilbertson 2000) which did not completely support the classification proposed by Neergaard (1945) based on conidial catenation. In particular, the filament-beaked Alternaria spp. formed a well-supported monophyletic group discrete from other Alternaria spp. Therefore, we propose that the filament-beaked species of Alternaria are placed in a unique group different from other Alternaria spp. due to their morphological adaptation strategies for spore liberation and subsistent strategies in nature. From the standpoint of survival and proliferation, the colour, size, shape, and texture of fungal spores must be looked upon as probably functional adaptations resulting from the interplay of tensions during spore development (Savile 1954). The various characteristics of the fungal spore must be modified during evolution by the requirements of the liberation process, i.e. flotation in air, deposition, and survival. Based on the mechanism of spore release, air-transmitted fungi can be divided into two groups, with active or passive dispersal, the later being of less concern and so little studied. Fungi with a passive dispersal strategy are highly adapted to the use of wind energy for spore
167 liberation. Field studies of several air-transmitted fungi revealed positive correlations between wind speed and spore liberation (Gregory 1973, Langenberg, Sutton & Gillespie 1977, Rotem 1994). The spores are often presented to the wind on an elevated sporophore, any stem or leaf pathogen usually being adequately raised on its host tissue (Gregory 1973). However, this is not the case in Alternaria. In dispersal of Alternaria conidia, the beak plays an important role in liberation where the passive dispersal of the spore is mainly facilitated by increases of wind speed (Langenberg et al. 1977, Meredith 1966, Pearson & Hall 1975, Rotem 1991). To be transmitted by wind, the first requirement for an air-transmitted plant pathogen is exposure to a free air-stream above the boundary layer which covers the surface of leaves and stems. Within the boundary layer, the viscosity of air fluid obviously limits the flow of air current and also the dissemination of air-transmitted microbiota (Vogel 1994). During evolution, the two groups of Alternaria spp. evidently developed different strategies through the boundary layer by the development of the beak, a unique conidiogenous apparatus on conidia. The dispersal of small-spored Alternaria involved the catenate proliferation of conidia emerging from the beak or the secondary conidiophore of the precedent conidium. In contrast, the liberation of filament-beaked Alternaria was facilitated by the elongated filamentous beak. Both strategies result in the elevation of conidia through the boundary layer. To demonstrate this hypothesis, we applied two equations for describing spore liberation in different conditions, in laminar flow or brief gust. The first equation was applied to calculate the average thickness of the boundary layer in laminar flow. The correlation between the wind speed and the thickness of the boundary layer can be expressed as in equation 1, where l(cm) is the length of the leaf in the downwind direction, v(m/s) is the ambient wind speed, and δbl is (µm) the average thickness of the boundary layer (4i10$ is a factor suitable for leaf surface) (Nobel 1991, Vogel 1994). δbl l 4i10$ (µm)
Avl
(cm)
(1)
(m/s)
Equation 2 was applied to estimate the duration of the time before the development of the boundary layer over a certain height from the surface in a brief gust. In this equation : t(ms) is the length of time required for the boundary layer to develop above a certain height, v is the kinematic viscosity of air (ν l 0n15 cm\s#), y(µm) is the developmental height of boundary layer which is the dimensionless distance from the surface (η l 1n4) (Aylor & Parlange 1975, Schlichting 1960). t(ms) l ν−"(y\2η)#i10−&
(2)
To make a comparison with normal condition, we considered Alternaria alternata and A. brassicicola as examples of the catenate situation found in small-
Phylogenetic analysis of genus Alternaria
168
Table 2. The effect of the boundary layer in laminar flow and brief gust on the liberation of small-spored and filament-beaked Alternaria.
Speciesa Small-spored Alternaria alternata A. brassicicola Filament-beaked A. solani A. zinniae
Conditionb
Height (µm)c
In laminar flow, v (m\s)d
In brief gust, t (ms)e
8 conidia in chain Solitary 10 conidia in chain Solitary
346 87 310 94
5n35 84n56 6n66 72n43
1n02 0n06 0n82 0n08
With beak Without beak With beak Without beak
295 194 333 225
7n35 17n00 5n77 12n64
0n74 0n32 0n94 0n43
a A. alternata and A. brassicicola were taken to represent small-spored Alternaria ; A. solani and A. zinniae were taken to represent filamentbeaked Alternaria. b Different conidial arrangements and conidial morphology of small-spored and filament beaked Alternaria, respectively, were assumed to compare with their authentic condition. The number of conidial catenations of small-spored Alternaria’s was assumed in a reasonable range (Ellis 1971, Simmons 1995). c The average lengths of conidiophores, conidia, and filamentous beaks in Ellis (1971, 1976) and Rotem (1994) were applied to calculate the height of the sporulation structure from the leaf surface. d In each case, we used the height of the sporulation structure as the thickness of the boundary layer in laminar flow to calculate the corresponding wind speed by equation 1 when assuming the length of the leaf in the downwind direction (l) was 4 cm. e In each case, we applied the height of sporulation structure as the thickness of the developing boundary layer in brief gust to calculate the corresponding duration of time by equation 2.
spored Alternaria’s with solitary conidia, and took A. solani and A. zinniae as examples to compare the filament-beaked conidia with ones without a beak. According to the equation 1, the wind speed must gust to 12 and 2 times stronger than the initial wind speed for the conidia of small-spored and filament-beaked Alternaria, respectively, to be exposed to a free airstream (Table 2). In the equation 2, the length of time the conidia were protected by a developmental boundary layer was 10 and 2 times longer than that of the original situation to small-spored and filament-beaked Alternaria, respectively. The longer the conidia are exposed to a free air-stream, the more likely is the detaching force needed to liberate the conidia to be achieved. Considering subsistence, small-spored Alternaria spp. develop diverse survival strategies in their ecological niches. Some are cosmopolitan saprophytes, while others are opportunistic plant pathogens, and severely damage their hosts with host-specific toxins (Roberts, Reymond & Andersen 2000, Rotem 1994). In other words, most filament-beaked Alternaria species found so far are plant pathogens and unique for their excretion of non-host-specific toxins, which are less damaging to plants than host-specific toxins and are not a prerequisite for infection (Cotty & Misaghi 1984). The same non-host-specific toxin might be produced by several members of this group and affected several hosts. Cotty & Misaghi suggested that such a broad range of producers and hosts ensured a relative stability of host-pathogen relationship. The possibility that filament-beaked Alternaria’s possess the potential to produce highly selective toxins during the period of coevolution cannot be excluded. If so, they either eliminated the susceptible old genotypes or disappeared
in the absence of susceptible hosts. The presence of non-host-specific toxins in filament-beaked Alternaria species possibly results from a long period of hostpathogen coevolution. The relative stability of the filament-beaked Alternaria species might be strengthened, in part, by their ability to produce non-selective toxins, synthesized (like zinniol) with maximum metabolic economy, and conserved in various Alternaria species (Rotem 1994). In agreement with the evolutionary theory, the abundance and low toxicity of the non-specific toxins hints at an ancient origin, as suggested for the evolution of zinniol in a number of Alternaria spp. (Cotty & Misaghi 1984). In contrast, the dominance of virulent small-spored Alternaria species producing host-specific toxins has probably been due to the strong selection pressure resulting from modern monocrop agriculture and newly developed susceptible genotypes, leading to rapid increases in their population from less virulent small-spored Alternaria spp. The evolution of small-spored Alternaria is producing hostspecific toxins was exemplified by A. alternata f. sp. citri. Scheffer (1983) assumed that this pathogen appeared as mutation of the existing weak pathogenic Alternaria rather than mutations of saprophytes. Based on the molecular evidence, the unique traits of morphological adaptation for liberation and their subsistent strategies, we consider that the filamentbeaked Alternaria’s evolved an evolutionary route different from other members of the genus.
A C K N O W L E D G E M E N TS We thank H. T. Yu for interpretation and assistance in sequence analysis, C. P. Lin for technical assistance with the PCR, and Y. Y. Chen, H. Chang, and C. H. Chung for helpful comments.
H.-H. Chou and W.-S. Wu REFERENCES Alexopoulos, C. J., Mims, C. W. & Blackwell, M. (1996) Introductory Mycology. 4th edn. John Wiley & Sons, New York. Aylor, D. E. & Parlange, J. Y. (1975) Ventilation required to entrain small particles from leaves. Plant Physiology 56 : 97–99. Cooke, D. E. L., Forster, J. W., Jenkins, P. D., Jones, D. G. & Lewis, D. M. (1998) Analysis of intraspecific and interspecific variation in the genus Alternaria by the use of RAPD–PCR. Annals of Applied Biology 132 : 197–209. Cotty, P. J. & Misaghi, I. J. (1984) Zinniol production by Alternaria species. Phytopathology 74 : 785–788. Ellis, M. B. (1971) Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew. Ellis, M. B. (1976) More Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew. Felsenstein, J. (1985) Confidence limits on phylogenies : An approach using the bootstrap. Evolution 39 : 782–791. Gregory, P. H. (1973) Microbiology of the Atmosphere. 2nd edn. Leonard Hill, Amersham. Higgins, D. G., Bleasby, A. J. & Fuchs, R. (1991) Clustal V : Improved software for multiple sequence alignment. Computer Applications in the Biosciences 8 : 189–191. Kusaba, M. & Tsuge, T. (1994) Nuclear ribosomal DNA variation and pathogenic specialization in Alternaria fungi known to produce host-specific toxins. Applied and Environmental Microbiology 60 : 3055–3062. Kusaba, M. & Tsuge, T. (1995) Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA. Current Genetics 28 : 491–498. Langenberg, W. J., Sutton, J. C. & Gillespie, T. J. (1977) Relation of weather variables and periodicities of airborne spores of Alternaria dauci. Phytopathology 67 : 879–883. Li, D.-C., Zhang, T.-Y. & Wu, J.-S. (1993) A preliminary study of numerical taxonomy of the genus Alternaria (Hyphomycetes). Acta Mycologica Sinica 12 : 232–239. [In Chinese]. Meredith, D. S. (1966) Spore dispersal in Alternaria porri (Ellis) Neerg. on onions in Nebraska. Annals of Applied Biology 57 : 67–73. Neergaard, P. (1975) Danish Species of Alternaria and Stemphylium. Munksgaard, Copenhagen. Nobel, P. S. (1991) Physicochemical and Environmental Plant Physiology. Academic Press, San Diego. Pearson, R. C. & Hall, D. H. (1975) Factors affecting the occurrence and severity of blackmold of ripe tomato fruit caused by Alternaria alternata. Phytopathology 65 : 1352–1359. Pryor, B. M. & Gilbertson, R. L. (2000) Molecular phylogenetic relationships amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mt SSU rDNA sequences. Mycological Research 104 : 1312–1321. Roberts, R. G., Reymond, S. T. & Andersen, B. (2000) RAPD fragment pattern analysis and morphological segregation of smallspored Alternaria species and species groups. Mycological Research 104 : 151–160. Rotem, J. (1991) Assessment of production and dispersal of Alternaria mcarospora in various parts of the cotton canopy. Phytoparasitica 19 : 121–132.
169 Rotem, J. (1994) The Genus Alternaria : biology, epidemiology, and pathology. American Phytopathological Society Press, St Paul, MN. Savile, D. B. O. (1954) Cellular mechanics, taxonomy and evolution in the Uredinales and Ustilaginales. Mycologia 46 : 736–761. Scheffer, R. P. (1983) Toxins as chemical determinants of plant disease. In Toxins and Plant Pathogenesis ( J. M. Daly & B. J. Deverall, eds) : 1–40. Academic Press, Sydney. Scheffer, R. P. (1992) Ecological and evolutionary roles of toxins from Alternaria species pathogenic to plants. In Alternaria : biology, plant diseases and metabolites ( J. Chelkowski & A. Visconti, eds) : 101–122. Elsevier, Amsterdam, Netherlands. Schlichting, H. (1960) Boundary Layer Theory. 6th edn. McGrawHill, New York. Schlichting, H. (1960) Boundary Layer Theory. 6th edn. McGrawHill, New York. Simmons, E. G. (1967) Typification of Alternaria, Stemphylium and Ulocladium. Mycologia 59 : 67–92. Simmons, E. G. (1986) Alternaria themes and variations (22–26). Mycotaxon 25 : 287–308. Simmons, E. G. (1989) Macrospora Fuckel (Pleosporales) and related anamorphs. Sydowia 41 : 314–329. Simmons, E. G. (1992) Alternaria taxonomy : current status, viewpoint, challenge. In Alternaria : biology, plant diseases and metabolites ( J. Chelkowski & A. Visconti, eds) : 1–35. Elsevier, Amsterdam. Simmons, E. G. (1995) Alternaria themes and variations (112–144). Mycotaxon 55 : 55–163. Swofford, D. L. (1998) PAUP * : Phylogenetic Analysis Using Parsimony ( *and other methods). Version 4. Sinauer Associates, Sunderland, MA. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) CLUSTAL W : Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22 : 4673–4680. Vogel, S. (1994) Life in Moving Fluid : the physical biology of flow. Princeton University Press, Princeton, NJ. Weir, T. L., Huff, D. R., Christ, B. J. & Romaine, C. P. (1998) RAPD–PCR analysis of genetic variation among isolates of Alternaria solani and Alternaria alternata from potato and tomato. Mycologia 90 : 813–821. White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenies. In PCR Protocols : a guide to methods and applications (M. A. Innis, D. H. Gelford, J. J. Sninsky & T. J. White, eds) : 315–322. Academic Press, New York. Yu, S. H. (1992) Occurrence of Alternaria species in countries of Far East and their taxonomy. In Alternaria : biology, plant diseases and metabolites (J. Chelkowski & A. Visconti, eds) : 37–62. Elsevier, Amsterdam. Zhang, T. Y. & David, J. C. (1996) Notes on Alternaria species on Euphorbiaceae in IMI and K : I. Taxa on Euphorbia, Acalypha and Sauropus. Mycosystema 8–9 : 109–121. Corresponding Editor : Z.-C. Chen
# The British Mycological Society
164
DOI : 10.1017\S0953756201005317 Printed in the United Kingdom.
Phylogenetic analysis of internal transcribed spacer regions of the genus Alternaria, and the significance of filament-beaked conidia
Hsin-Hung CHOU and Wen-Shi WU Department of Plant Pathology, National Taiwan University, Taipei, Taiwan. E-mail : hoganwu!ccms.ntu.edu.tw Received 23 November 2000 ; accepted 10 September 2001.
Internal transcribed regions (ITS1 and ITS2) of 11 different fungi, i.e. 8 species of Alternaria, Nimbya gomphrenae, Stemphylium vesicarium, and Ulocladium botrytis, were sequenced. Their phylogenetic relationships with another 36 species in Pleosporaceae in GenBank were analyzed by parsimony and distance methods. These two methods positioned filament-beaked Alternaria as a monophyletic group discrete from the other members in genus Alternaria. A hypothesis proposing that the filament-beaked speices of Alternaria evolved a particular evolutionary route distinguishable from other species based on molecular evidence, the unique traits of morphological adaptation for liberation and their subsistent strategies has been discussed.
INTRODUCTION Many species of Alternaria are serious plant pathogens. They are well known in causing leaf spots, blotches, blights of many agricultural and economic crops, and blemishes or damage in stored products, resulting in billions of dollars of losses annually (Yu 1992). Some species of Alternaria also cause serious and sometimes fatal diseases among mammals. Certain Alternaria species have been proved to be anamorphs of the genus Lewia (Simmons 1986). However, the corresponding telemorphs of most other species have yet to be determined. Previous studies have subdivided the genus into several groups according to catenation (spores in chain) and conidial morphology. Based on catenation, the genus Alternaria was divided into three major sections, i.e. Longicatenatae, Brevicatenatae, and Noncatenatae (Neergard 1945). Unfortunately, catenation and conidial morphology are readily affected by the conditions of growth and thus may be unreliable for both implying phylogenetic relationship and for species discrimination (Rotem 1994). The taxonomic system of this genus thus remains unclear and further studies to clarify their phylogenetic relationship are needed. In this study, the evolutionary relationships among Alternaria spp., and the four other related genera, i.e. Stemphylium, Ulocladium, Exserohilum, and Nimbya (Alexopoulos, Mims & Blackwell 1996, Simmons, 1992) were investigated by analysing their internal transcribed spacers between 18S rRNA and 25S rRNA genes because this region has been proved to be useful for
evaluating the phylogenetic relationships at the generic and species level in many fungal genera (White et al. 1990). MATERIALS AND METHODS Fungal isolates Eleven isolates, including eight species of Alternaria, Nimbya gomphrenae, Stemphylium vesicarium, and Ulocladium botrytis were used in this study (Table 1). These isolates were obtained from the seeds of various crops and their identities confirmed by morphology and pathogenicity by FIRDI (Food Industry Research and Development Institute, Taiwan). The isolates were maintained on V8-juice media, and have been deposited in the Culture Collection and Research Center in Taiwan. DNA extraction Stock cultures of each isolate were grown in 100 ml of potato dextrose broth in 250 ml Erlenmeyer flasks on an orbital shaker (100 rev min−") at 25 mC for 3 d. Total DNA of each isolate was extracted from the mycelia by DNeasyTM Plant Mini Kit (QIAGEN). PCR amplification Primer pairs ITS5-ITS4 were used for amplification of the ribosomal DNA containing the internal transcribed spacer 1, 5n8s rDNA, and internal transcribed spacer 2 by polymerse chain reaction (White et al. 1990). The oligonucleotide sequence of primer ITS5 was 5hGG-
H.-H. Chou and W.-S. Wu
165
Table 1. Source and GenBank accession number of sequences used.
Taxa Alternaria alternaria A. brassicae A. brassicicola A. carotiincultae A. carthami A. cheiranithi A. crassa A. dauci A. dianthi A. dianthicola A. infectoria A. japonica A. linicola A. lini A. longipes A. macrospora A. panax A. petroselini A. photistica A. porri A. protenta A. radicina A. raphani A. selini A. sesami A. smyrnii A. solani A. tagetica A. tenuissima A. zinniae Exserohilum mcginnisii E. pedicellatum Lewia infectoria Nimbya gomphrenae Pleospora tarda P. herbarum Stemphylium alfalfa S. botryosum S. callistephi S. herbarum S. sarcinaeforme S. solani S. vesicarium Ulocladium alternariae U. atrum U. botrytis U. chartarum
Sequences from this studya
Source codea
j
CCRC33657
j
CCRC33651
j
CCRC33653
j
CCRC33708
j j
CCRC33652 CCRC33654
j
CCRC33663
j
CCRC33655
j
CCRC33648
j
CCRC33656
j
CCRC33650
Accession no.b of ITS1
Accession no. of ITS2
AF229461 AF229463 U05198 AF229465 AF265212 AF229457 AF229464 AF267130 D38758 AF267131 AF081456 AF229474 Y17086 Y17071 AF267137 AF229469 D38759 AF229454 AF081455 D38760 AF267132 AF267133 U05200 AF229455 D38761 AF229456 U80204 AF267134 AF229476 AF267135 AF081453 AF081453 AF229480 AF269194 AF229481 U05202 AF071343 Y17068 AF229482 AF071344 AF229483 AF203451 AF267138 AF229485 AF229486 AF267139 AF229488
AF229461 AF229463 U05198 AF229465 AF265212 AF229457 AF229464 AF267130 D38766 AF267131 AF081456 AF229474 Y17086 Y17071 AF267137 AF229469 D38767 AF229454 AF081455 D38770 AF267132 AF267133 U05200 AF229455 D38771 AF229456 U80204 AF267134 AF229476 AF267135 AF081453 AF081453 AF229480 AF269194 AF229481 U05202 AF071343 Y17068 AF229482 AF071344 AF229483 AF203451 AF267138 AF229485 AF229486 AF267139 AF229488
Eleven different species of fungi sequenced in this study were validated by FIRDI. All isolates with its code number were stored at Culture Collection and Research Center (CCRC) in FIRDI. a
AAGTAAAAGTCGTAACAAGG3h which corresponded to the 3h end of the 18s rDNA. The nucleotide sequence of primer ITS4 was 5hTCCTCCGCTTATTGATATGC3h which corresponded to the 5h end of the 28s rDNA. 25 µl PCR mixture for each PCR amplification contained 200 µ dATP, dTTP, dGTP, dCTP, 50 m KCL, 10 m Tris-HCl (pH 9n0 at 25 m), 1n5 m MgCl , 0n1 % Triton2 X-100, 0n5 µ of each primer, 1 # unit Taq DNA Polymerase (Promega), and 50 ng template DNA. The PCR reaction was performed for 35 cycles with an intial 5 min at 94 mC for denaturation
and a final 7 min at 72 m for the extension in a Perkin–Elmer GeneAmp PCR System 2400. Each cycle consisted of 35 s at 94 m, 55 s at 60 m and 1 min at 72 m. Successful amplification was checked by electrophoresis of an aliquot of the reaction mixture in a 1 % agarose gel (BRL). Sequencing of amplified DNA Amplified fragments of about 0n6 kb were cut from the agarose gel and purified with a QIAquick Gel Extraction
Phylogenetic analysis of genus Alternaria
166
Fig. 1. Neighbour-joining tree of Alternaria and related species. The tree was generated by PAUP 4.0 using the JukesCantor one-parameter algorithm to estimate the phylogeny of Alternaria spp. with related genera for sequence data from ITS1 and ITS2 combined regions of the ribosomal genes. Nimbya gomphrenae was rooted as the outgroup in the analysis. Values associated with branches indicate the degree of bootstrap support expressed as percentage of 1000 bootstrapped trees in which the corresponding clades are present. Alignment are deposited in TreeBASE, matrix accession number M951.
Kit (QIAGEN). Purified PCR products were sequenced directly in both directions using the two primers (ITS4 and ITS5) by Mission Biotech (Taipei, Taiwan). Sequence analysis Sequences for analysis were presented in Table 1. Among them, 11 taxa were sequenced in this study, and data on 36 taxa were obtained from GenBank. Sequence boundaries were determined by comparison with published sequences (Kusaba & Tsuge 1995, White et al. 1990) and were aligned using Clustal W, Version 1.7 (Higgins, Bleasby & Fuchs 1991, Thompson, Higgins & Gibson 1994), with some manual gap adjustments. Both ITS spacers were used in all the analyses, with the 5n8S region excluded. Both parsimony and distance methods available in Phylogenetic Analysis Using
Parsimony program (PAUP 4.0 ; Swofford 1998) were used to analyze the data matrix (TreeBase matrix accession number : M951). Nimbya gomphrenae belonging to anamorphic Pyrenophoraceae (Simmons 1989) was rooted as the outgoup in both analyses. Distance-based trees were generated with the neighbour-joining option of PAUP 4.0 using the JukesCantor one-parameter algorithm. The significance of the branches in both the parsimony and neighborjoining trees were tested by bootstrap analysis using 1000 bootstrap replications (Felsenstein 1985). RESULTS PCR experiments carried out on the rDNA ITS1 and ITS2 regions of 11 isolates, including 8 Alternaria spp., Nimbya gomphrenae, Stemphylium vesicarium, and
H.-H. Chou and W.-S. Wu Ulocladium botrytis, reproducibly amplified a single double-stranded product. The amplified DNA was sequenced directly in both strands. The size of ITS1 and ITS2 sequences ranged from 164 to 174 base pairs and from 157 to 171 base pairs, respectively. Although the neighbour-joining tree and the parsimony tree shared similar topology, the neighbourjoining tree offered a better resolution, since the parsimony analysis was limited by fewer numbers of informative sites in the ITS regions. For this reason, only the neighbour-joining tree is shown (Fig. 1). Both methods of phylogenetic analysis divided the 47 taxa into three major clusters. Filament-beaked Alternaria spp. formed a well-supported group. The second group consisted of small-spored Alternaria spp., Ulocladium spp., and the large-spored Alternaria brassicae. Finally, Stemphylium spp. and Exserohilum spp. were placed in the third group. The three groups were well supported, with bootstrap values over 73 % (Fig. 1). DISCUSSION The phylogenetic tree constructed based on the ITS region was highly resolved and consistent with morphological numerical taxonomy (Li, Zhang & Wu 1993) and traditional classification, except for the ambiguity of the Ulocladium spp. placement with obovoid, unbeaked spores (Simmons 1967), and Alternaria brassicae with small-spored Alternaria spp. This result supports the suggestion (Pryor & Gilbertson 2000) to place U. botrytis, U. atrum, and U. chartarum in Alternaria. In this study, Alternaria was further divided into two major groups similar to the conclusions drawn from rDNA RFLP patterns (Kusaba & Tsuge 1994), RAPD–PCR analysis (Cooke et al. 1998, Weir et al. 1998), and ITS and mt SSU rDNA analysis (Kusaba & Tsuge 1995, Pryor & Gilbertson 2000) which did not completely support the classification proposed by Neergaard (1945) based on conidial catenation. In particular, the filament-beaked Alternaria spp. formed a well-supported monophyletic group discrete from other Alternaria spp. Therefore, we propose that the filament-beaked species of Alternaria are placed in a unique group different from other Alternaria spp. due to their morphological adaptation strategies for spore liberation and subsistent strategies in nature. From the standpoint of survival and proliferation, the colour, size, shape, and texture of fungal spores must be looked upon as probably functional adaptations resulting from the interplay of tensions during spore development (Savile 1954). The various characteristics of the fungal spore must be modified during evolution by the requirements of the liberation process, i.e. flotation in air, deposition, and survival. Based on the mechanism of spore release, air-transmitted fungi can be divided into two groups, with active or passive dispersal, the later being of less concern and so little studied. Fungi with a passive dispersal strategy are highly adapted to the use of wind energy for spore
167 liberation. Field studies of several air-transmitted fungi revealed positive correlations between wind speed and spore liberation (Gregory 1973, Langenberg, Sutton & Gillespie 1977, Rotem 1994). The spores are often presented to the wind on an elevated sporophore, any stem or leaf pathogen usually being adequately raised on its host tissue (Gregory 1973). However, this is not the case in Alternaria. In dispersal of Alternaria conidia, the beak plays an important role in liberation where the passive dispersal of the spore is mainly facilitated by increases of wind speed (Langenberg et al. 1977, Meredith 1966, Pearson & Hall 1975, Rotem 1991). To be transmitted by wind, the first requirement for an air-transmitted plant pathogen is exposure to a free air-stream above the boundary layer which covers the surface of leaves and stems. Within the boundary layer, the viscosity of air fluid obviously limits the flow of air current and also the dissemination of air-transmitted microbiota (Vogel 1994). During evolution, the two groups of Alternaria spp. evidently developed different strategies through the boundary layer by the development of the beak, a unique conidiogenous apparatus on conidia. The dispersal of small-spored Alternaria involved the catenate proliferation of conidia emerging from the beak or the secondary conidiophore of the precedent conidium. In contrast, the liberation of filament-beaked Alternaria was facilitated by the elongated filamentous beak. Both strategies result in the elevation of conidia through the boundary layer. To demonstrate this hypothesis, we applied two equations for describing spore liberation in different conditions, in laminar flow or brief gust. The first equation was applied to calculate the average thickness of the boundary layer in laminar flow. The correlation between the wind speed and the thickness of the boundary layer can be expressed as in equation 1, where l(cm) is the length of the leaf in the downwind direction, v(m/s) is the ambient wind speed, and δbl is (µm) the average thickness of the boundary layer (4i10$ is a factor suitable for leaf surface) (Nobel 1991, Vogel 1994). δbl l 4i10$ (µm)
Avl
(cm)
(1)
(m/s)
Equation 2 was applied to estimate the duration of the time before the development of the boundary layer over a certain height from the surface in a brief gust. In this equation : t(ms) is the length of time required for the boundary layer to develop above a certain height, v is the kinematic viscosity of air (ν l 0n15 cm\s#), y(µm) is the developmental height of boundary layer which is the dimensionless distance from the surface (η l 1n4) (Aylor & Parlange 1975, Schlichting 1960). t(ms) l ν−"(y\2η)#i10−&
(2)
To make a comparison with normal condition, we considered Alternaria alternata and A. brassicicola as examples of the catenate situation found in small-
Phylogenetic analysis of genus Alternaria
168
Table 2. The effect of the boundary layer in laminar flow and brief gust on the liberation of small-spored and filament-beaked Alternaria.
Speciesa Small-spored Alternaria alternata A. brassicicola Filament-beaked A. solani A. zinniae
Conditionb
Height (µm)c
In laminar flow, v (m\s)d
In brief gust, t (ms)e
8 conidia in chain Solitary 10 conidia in chain Solitary
346 87 310 94
5n35 84n56 6n66 72n43
1n02 0n06 0n82 0n08
With beak Without beak With beak Without beak
295 194 333 225
7n35 17n00 5n77 12n64
0n74 0n32 0n94 0n43
a A. alternata and A. brassicicola were taken to represent small-spored Alternaria ; A. solani and A. zinniae were taken to represent filamentbeaked Alternaria. b Different conidial arrangements and conidial morphology of small-spored and filament beaked Alternaria, respectively, were assumed to compare with their authentic condition. The number of conidial catenations of small-spored Alternaria’s was assumed in a reasonable range (Ellis 1971, Simmons 1995). c The average lengths of conidiophores, conidia, and filamentous beaks in Ellis (1971, 1976) and Rotem (1994) were applied to calculate the height of the sporulation structure from the leaf surface. d In each case, we used the height of the sporulation structure as the thickness of the boundary layer in laminar flow to calculate the corresponding wind speed by equation 1 when assuming the length of the leaf in the downwind direction (l) was 4 cm. e In each case, we applied the height of sporulation structure as the thickness of the developing boundary layer in brief gust to calculate the corresponding duration of time by equation 2.
spored Alternaria’s with solitary conidia, and took A. solani and A. zinniae as examples to compare the filament-beaked conidia with ones without a beak. According to the equation 1, the wind speed must gust to 12 and 2 times stronger than the initial wind speed for the conidia of small-spored and filament-beaked Alternaria, respectively, to be exposed to a free airstream (Table 2). In the equation 2, the length of time the conidia were protected by a developmental boundary layer was 10 and 2 times longer than that of the original situation to small-spored and filament-beaked Alternaria, respectively. The longer the conidia are exposed to a free air-stream, the more likely is the detaching force needed to liberate the conidia to be achieved. Considering subsistence, small-spored Alternaria spp. develop diverse survival strategies in their ecological niches. Some are cosmopolitan saprophytes, while others are opportunistic plant pathogens, and severely damage their hosts with host-specific toxins (Roberts, Reymond & Andersen 2000, Rotem 1994). In other words, most filament-beaked Alternaria species found so far are plant pathogens and unique for their excretion of non-host-specific toxins, which are less damaging to plants than host-specific toxins and are not a prerequisite for infection (Cotty & Misaghi 1984). The same non-host-specific toxin might be produced by several members of this group and affected several hosts. Cotty & Misaghi suggested that such a broad range of producers and hosts ensured a relative stability of host-pathogen relationship. The possibility that filament-beaked Alternaria’s possess the potential to produce highly selective toxins during the period of coevolution cannot be excluded. If so, they either eliminated the susceptible old genotypes or disappeared
in the absence of susceptible hosts. The presence of non-host-specific toxins in filament-beaked Alternaria species possibly results from a long period of hostpathogen coevolution. The relative stability of the filament-beaked Alternaria species might be strengthened, in part, by their ability to produce non-selective toxins, synthesized (like zinniol) with maximum metabolic economy, and conserved in various Alternaria species (Rotem 1994). In agreement with the evolutionary theory, the abundance and low toxicity of the non-specific toxins hints at an ancient origin, as suggested for the evolution of zinniol in a number of Alternaria spp. (Cotty & Misaghi 1984). In contrast, the dominance of virulent small-spored Alternaria species producing host-specific toxins has probably been due to the strong selection pressure resulting from modern monocrop agriculture and newly developed susceptible genotypes, leading to rapid increases in their population from less virulent small-spored Alternaria spp. The evolution of small-spored Alternaria is producing hostspecific toxins was exemplified by A. alternata f. sp. citri. Scheffer (1983) assumed that this pathogen appeared as mutation of the existing weak pathogenic Alternaria rather than mutations of saprophytes. Based on the molecular evidence, the unique traits of morphological adaptation for liberation and their subsistent strategies, we consider that the filamentbeaked Alternaria’s evolved an evolutionary route different from other members of the genus.
A C K N O W L E D G E M E N TS We thank H. T. Yu for interpretation and assistance in sequence analysis, C. P. Lin for technical assistance with the PCR, and Y. Y. Chen, H. Chang, and C. H. Chung for helpful comments.
H.-H. Chou and W.-S. Wu REFERENCES Alexopoulos, C. J., Mims, C. W. & Blackwell, M. (1996) Introductory Mycology. 4th edn. John Wiley & Sons, New York. Aylor, D. E. & Parlange, J. Y. (1975) Ventilation required to entrain small particles from leaves. Plant Physiology 56 : 97–99. Cooke, D. E. L., Forster, J. W., Jenkins, P. D., Jones, D. G. & Lewis, D. M. (1998) Analysis of intraspecific and interspecific variation in the genus Alternaria by the use of RAPD–PCR. Annals of Applied Biology 132 : 197–209. Cotty, P. J. & Misaghi, I. J. (1984) Zinniol production by Alternaria species. Phytopathology 74 : 785–788. Ellis, M. B. (1971) Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew. Ellis, M. B. (1976) More Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew. Felsenstein, J. (1985) Confidence limits on phylogenies : An approach using the bootstrap. Evolution 39 : 782–791. Gregory, P. H. (1973) Microbiology of the Atmosphere. 2nd edn. Leonard Hill, Amersham. Higgins, D. G., Bleasby, A. J. & Fuchs, R. (1991) Clustal V : Improved software for multiple sequence alignment. Computer Applications in the Biosciences 8 : 189–191. Kusaba, M. & Tsuge, T. (1994) Nuclear ribosomal DNA variation and pathogenic specialization in Alternaria fungi known to produce host-specific toxins. Applied and Environmental Microbiology 60 : 3055–3062. Kusaba, M. & Tsuge, T. (1995) Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA. Current Genetics 28 : 491–498. Langenberg, W. J., Sutton, J. C. & Gillespie, T. J. (1977) Relation of weather variables and periodicities of airborne spores of Alternaria dauci. Phytopathology 67 : 879–883. Li, D.-C., Zhang, T.-Y. & Wu, J.-S. (1993) A preliminary study of numerical taxonomy of the genus Alternaria (Hyphomycetes). Acta Mycologica Sinica 12 : 232–239. [In Chinese]. Meredith, D. S. (1966) Spore dispersal in Alternaria porri (Ellis) Neerg. on onions in Nebraska. Annals of Applied Biology 57 : 67–73. Neergaard, P. (1975) Danish Species of Alternaria and Stemphylium. Munksgaard, Copenhagen. Nobel, P. S. (1991) Physicochemical and Environmental Plant Physiology. Academic Press, San Diego. Pearson, R. C. & Hall, D. H. (1975) Factors affecting the occurrence and severity of blackmold of ripe tomato fruit caused by Alternaria alternata. Phytopathology 65 : 1352–1359. Pryor, B. M. & Gilbertson, R. L. (2000) Molecular phylogenetic relationships amongst Alternaria species and related fungi based upon analysis of nuclear ITS and mt SSU rDNA sequences. Mycological Research 104 : 1312–1321. Roberts, R. G., Reymond, S. T. & Andersen, B. (2000) RAPD fragment pattern analysis and morphological segregation of smallspored Alternaria species and species groups. Mycological Research 104 : 151–160. Rotem, J. (1991) Assessment of production and dispersal of Alternaria mcarospora in various parts of the cotton canopy. Phytoparasitica 19 : 121–132.
169 Rotem, J. (1994) The Genus Alternaria : biology, epidemiology, and pathology. American Phytopathological Society Press, St Paul, MN. Savile, D. B. O. (1954) Cellular mechanics, taxonomy and evolution in the Uredinales and Ustilaginales. Mycologia 46 : 736–761. Scheffer, R. P. (1983) Toxins as chemical determinants of plant disease. In Toxins and Plant Pathogenesis ( J. M. Daly & B. J. Deverall, eds) : 1–40. Academic Press, Sydney. Scheffer, R. P. (1992) Ecological and evolutionary roles of toxins from Alternaria species pathogenic to plants. In Alternaria : biology, plant diseases and metabolites ( J. Chelkowski & A. Visconti, eds) : 101–122. Elsevier, Amsterdam, Netherlands. Schlichting, H. (1960) Boundary Layer Theory. 6th edn. McGrawHill, New York. Schlichting, H. (1960) Boundary Layer Theory. 6th edn. McGrawHill, New York. Simmons, E. G. (1967) Typification of Alternaria, Stemphylium and Ulocladium. Mycologia 59 : 67–92. Simmons, E. G. (1986) Alternaria themes and variations (22–26). Mycotaxon 25 : 287–308. Simmons, E. G. (1989) Macrospora Fuckel (Pleosporales) and related anamorphs. Sydowia 41 : 314–329. Simmons, E. G. (1992) Alternaria taxonomy : current status, viewpoint, challenge. In Alternaria : biology, plant diseases and metabolites ( J. Chelkowski & A. Visconti, eds) : 1–35. Elsevier, Amsterdam. Simmons, E. G. (1995) Alternaria themes and variations (112–144). Mycotaxon 55 : 55–163. Swofford, D. L. (1998) PAUP * : Phylogenetic Analysis Using Parsimony ( *and other methods). Version 4. Sinauer Associates, Sunderland, MA. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) CLUSTAL W : Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22 : 4673–4680. Vogel, S. (1994) Life in Moving Fluid : the physical biology of flow. Princeton University Press, Princeton, NJ. Weir, T. L., Huff, D. R., Christ, B. J. & Romaine, C. P. (1998) RAPD–PCR analysis of genetic variation among isolates of Alternaria solani and Alternaria alternata from potato and tomato. Mycologia 90 : 813–821. White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenies. In PCR Protocols : a guide to methods and applications (M. A. Innis, D. H. Gelford, J. J. Sninsky & T. J. White, eds) : 315–322. Academic Press, New York. Yu, S. H. (1992) Occurrence of Alternaria species in countries of Far East and their taxonomy. In Alternaria : biology, plant diseases and metabolites (J. Chelkowski & A. Visconti, eds) : 37–62. Elsevier, Amsterdam. Zhang, T. Y. & David, J. C. (1996) Notes on Alternaria species on Euphorbiaceae in IMI and K : I. Taxa on Euphorbia, Acalypha and Sauropus. Mycosystema 8–9 : 109–121. Corresponding Editor : Z.-C. Chen