- Email: [email protected]
Phylogenetic origins of Borrelia recurrentis
ARTICLE IN PRESS
International Journal of Medical Microbiology 298 (2008) S1, 193–202 www.elsevier.de/ijmm
Phylogenetic origins of Borrelia recurrentis Sally J. Cutlera,, Julie C. Scottb, David J.M. Wrightb a
Health & Biosciences, University of East London, Stratford, London E15 4LZ, UK Imperial College of Science, Technology & Medicine, London SW7 2AZ, UK
b
Accepted 20 November 2007
Abstract Intragenic spacer (IGS, between 16S–23S genes) provides resolution among Lyme-borreliosis-associated spirochaetes and some relapsing fever Borrelia. When applied to East African relapsing fever borreliae, two and four types were found, respectively, among B. recurrentis and B. duttonii. Surprisingly, IGS typing was unable to discriminate between the tick- and louse-borne forms of disease, raising the possibility that these organisms are the same species. In order to resolve this question, further genes were sequenced to produce a multi-locus approach to determine whether these are indeed different species. Various housekeeping genes were selected from data deposited for B. hermsii (limited sequence information exists for either B. recurrentis or B. duttonii). Of selected targets, sufficient amplification was only produced using glpQ; thus, further genes were analysed including flaB, rrs rDNA, and p66 outer membrane protein. The fastidious nature of these organisms limited numbers of isolates available for full analysis. In contrast, the IGS typing was applied to a variety of patient’s blood samples and arthropod vectors in addition to cultivable isolates, potentially introducing a bias to the results. Results highlighted the remarkable similarity between these B. recurrentis and B. duttonii, with only minor nucleotide differences. Collectively, these findings suggest a common ancestral lineage for these spirochaetes. These minor nucleotide differences of 2–10 nucleotides were able to differentiate both ‘species’. It is likely that these differences reflect an accumulation of adaptive changes through time and pressures resulting from different vector transmission, with these spirochaetes being subgroups of the same species. In contrast, the IGS sequence, being non-coding, is not under such selective pressure and thus probably reflects changes accumulated over time alone, without the functional constraints. Complete genomic sequence analysis is likely to illuminate greater insights into the taxonomic relationship between these microbes and elucidate the molecular basis of arthropod competence and pathogenicity among these spirochaetes. r 2007 Elsevier GmbH. All rights reserved. Keywords: Borrelia recurrentis; Borrelia duttonii; Louse-borne relapsing fever; Tick-borne relapsing fever; Spirochaetes
Introduction It is currently held that relapsing fever spirochaetes in the Old World occupy distinct geographical niches; this Corresponding author. Tel.: +44 208 223 6386; fax: +44 208 223 4959 E-mail address: [email protected] (S.J. Cutler).
1438-4221/$ - see front matter r 2007 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2007.11.011
was not always the case. Prior to the 1960s, major epidemics of louse-borne forms of the disease were responsible for significant worldwide morbidity and mortality. Since these times, the disease now only persists in Ethiopia, occasionally spilling into neighbouring countries such as Sudan (Cutler et al., 1997a, Porcella et al., 2000). What is often overlooked in countries endemic for louse-borne relapsing fever is that
ARTICLE IN PRESS 194
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
ticks may also frequent traditional dwellings and thus both louse- and tick-borne populations of spirochaetes could overlap. Tick-borne varieties of relapsing fever spirochaetes have also resulted in a significant public health burden. Indeed, David Livingstone, while on his epic travels through Africa, noted the significant disease burden associated with ticks. Subsequently, it became accepted that B. crocidurae persists in western regions of Africa with countries such as Senegal considered endemic (Brahim et al., 2005), while B. duttonii persists in East Africa, particularly in regions of Tanzania (Cutler et al., 1999). These geographical demarcations and indeed the specificities of vector ticks for transmission may be less well established than previously thought, possibly resulting from the absence of suitably discriminatory tests able to address these issues. Indeed, some evidence for this comes from a recent PCR-based study in Togo, where both B. crocidurae and B. duttonii were found (Nordstrand et al., 2007). Furthermore, diversity has also been noted among the vector ticks coupled with variation among their probable vector competence for these spirochaetes (Vial et al., 2006b). Early researchers questioned the host and vector specificities for these relapsing fever spirochaetes, with several studies that described ticks feeding on patients with the louse-borne form of the disease and subsequently being allowed to engorge on non-febrile individuals. These studies revealed that B. recurrentis had apparently lost its competence for tick transmission; however, several tick species could be transmitted by lice. Many of these early investigations can be criticised through the inability to reliably identify the organisms used, the lack of available cultivable strains, and the absence of means for assessing the immune status of recipient hosts. Since these early investigations, speciation of relapsing fever spirochaetes has been reliant upon the geographical region from where infection was acquired and evidence of exposure to the vector responsible for transmission. Only recently have molecular approaches been applied to identify these spirochaetes (Fukunaga et al., 2001; Kisinza et al., 2003; Brahim et al., 2005; Assous et al., 2006; Vial et al., 2006a). Relapsing fever spirochaetes are a challenge to many molecular microbiological typing methods, in part, through their possession of segmented genomes carried on large linear plasmids. The number and sizes differ between isolates of B. recurrentis and B. duttonii (Cutler et al., 1997a, 1999); however, typically the chromosome is 930 kb, with strains possessing circa 7 and 12 plasmids, respectively (for strains A1 and Ly, Lescot et al., 2007, unpublished findings), totalling 319 and 641 kb in each species. Inter- and intragenomic recombination associated with antigenic variation may result in size variation among these plasmids through duplication events, thus invalidating their use as typing tools
(Pennington et al., 1999). Consequently, molecular characterisation of these spirochaetes has been largely reliant upon gene amplification and sequencing. The rrs gene has highlighted the remarkable similarity among those relapsing fever species from the Old World, with only limited nucleotide differences discriminating between the known species (Ras et al., 1996). Others have used this approach with the flagellin gene, flaB, and, similarly, found only minor differences between species (Fukunaga et al., 2001; Kisinza et al., 2003). More recently, non-coding intragenic spacer between 16S–23S genes has been shown to be particularly valuable for characterising relapsing fever spirochaetes (Bunikis et al., 2004b; Scott et al., 2005). This method proved highly discriminatory and enabled grouping within species; however, a surprising finding was the failure of this approach to be able to differentiate B. recurrentis and B. duttonii (Scott et al., 2005). To further investigate this apparent lack of differentiation between these two species, four additional gene targets were assessed for these isolates.
Materials and methods Various genes were used to analyse the phylogenetic relationships among isolates of B. recurrentis and B. duttonii to establish the differences between these spirochaetes. These included those targets previously shown to have discriminatory value for examining these spirochaetes (rrs and flaB), non-coding regions expected to show increased variability partial intragenic spacer (IGS) target residing between the 16S–23S rDNA genes (rrs-rrlA) surface exposed protein (p66), and other essential gene targets where sequence data existed for related spirochaetes that may enable amplification through sufficient conservation.
Isolates East African relapsing fever borreliae were isolated from patients in endemic areas for louse-borne relapsing fever (Addis Ababa, Ethiopia) and tick-borne relapsing fever (Mvumi, Tanzania) (Cutler et al., 1994, 1997b, 1999). These organisms were cultivated using BSKII medium, stored at 70 1C for long-term storage, and revived prior to investigation (Barbour, 1984).
PCR Primer sequences used are listed in Table 1. All primers were supplied by Sigma Genosys (UK). PCR amplicons were resolved using 1% agarose gels. Products were cleaned using a PCR clean-up kit (Promega) and sequenced directly or bands excised,
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
Table 1.
195
Primers used in study
Gene
Forward primers 50 –30
Reverse primers 50 –30
IGS Outer IGS Inner 16S rRNA (FD3-UniB) 16S rRNA fragment 1 (FD3-500R) 16S rRNA fragment 2 (400F-1050R) 16S rRNA fragment 3 (800F-rD1R) glpQ fragment 1 glpQ fragment 2 p66 (P6651-P6631) Flagellin (Flf1-Flr1) Flagellin (Flf2-Flr2)
GTATGTTTAGTGAGGGGGGTG AGGGGGGTGAAGTCGTAACAAG AGAGTTTGATCCTGGCTTAG AGAGTTTGATCCTGGCTTAG GGAGCGACACTGCGTG ATTAGATACCCTGGTAG TAATAATGTTTGCAATAAGTAC CCAATATACCCTAACCGTTTTC AGTGATTTTTCTATACTTGGACAC CGTGATGATCATAAATCATAATACG ACATATTCAGATGCAGACAGAGGT
GGATCATAGCTCAGGTGGTTAG GTCTGATAAACCTGAGGTCGGA T(AC)AAGGAGGTGATCCAGC CTGCTGGCACGTAATTAGCC CACGAGCTGACGACA AAGGAGGTGATCCAGCC CAATATTTTTCCCTGTGCTTTT CTTTATTGATATATCAACAAAG GTTAATTTGATTAAGTTKTCTAGTTCT CCAAGCTCTTCAGCTGTTCTTAC CATATTGAGGTACTTGATTTGC
and DNA purified using a Wizard SV gel and PCR cleanup system (Promega). The IGS PCR used a Borrelia-specific nested PCR designed to amplify the 16S–23S intragenic spacer (IGS) region as described (Bunikis et al., 2004a). Outer primers are anchored in the 30 -end of the rrs gene and the ileT genes, respectively, with nested internal inner primers. The 16S rRNA rrs gene was amplified initially using primers FD3 and UniB using 94 1C for 60 s, 54 1C for 60 s and 72 1C for 60 and 30 s for a total of 45 cycles. Overlapping contigs were amplified using further primers described by others (Ras et al., 1996). Flagellin was amplified using two overlapping fragments following 35 cycles of 1 min for denaturation at 94 1C and annealing at 56 and 52 1C, respectively, and extension at 72 1C. A 750-bp region of the p66 outer surface protein was amplified using primers kindly described by Alan Barbour. These should include the loop region, hydrophobic flanking regions of this protein. Cycling conditions of 94 1C for 60 s, 40 1C for 2 min, and finally 72 1C for 2 min for a total of 35 cycles were used. The glycerophosphodiester phosphodiesterase (glpQ) gene for four B. recurrentis strains had already been submitted (AF247152–AF247155). These sequences, together with those deposited for other relapsing fever spirochaetes, were aligned, and primers designed against homologous regions. The target gene was amplified using two overlapping fragments. Amplification was achieved using 35 cycles of 60 s for denaturation at 94 1C, annealing at 48 1C and extension at 72 1C.
Data analysis Chromatograms were analysed using Chromas (version 1.45) and DNA Star software (Lasergene 6). Multiple alignments were assessed using ClustalW. Results produced by IGS fragment typing were compared with those using the rrs gene using sequences held in GenBank.
Phylogenetic trees The phylogenetic relationships of sequences were compared using Mega software (version 3) and neighbour-joining methods for compilation of the trees. A bootstrap value of 250 was used to determine confidence in tree-drawing parameters.
Results Only those assays for flagellin, p66, 16S rRNA, IGS, and glpQ successfully generated amplicons from sufficient isolates to allow phylogenetic comparisons. Attempts to compare other gene targets assuming homology with sequences generated from B. hermsii were unsuccessful in amplifying targets from our isolates for recB, recC, bdrB, fruK, fruA2, and hexoV. A comparative summary of those genes successfully amplified is given in Table 2.
Intragenic spacer amplifications DNA sequencing Purified DNA was either directly sequenced or cloned into pGEMT-easy (Promega) before being sequenced. Sequencing reactions were performed using BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems) according to the manufacturer’s instructions and analysed on an Applied Biosystems Genetic Analyzer.
Isolates of B. duttonii yielded a 587-bp portion of the IGS that revealed total homology among this species. Consequently, strain Ly was selected to represent these isolates and has since been used by others as the representative isolate for B. duttonii (Fukunaga et al., 2001; Brahim et al., 2005). Despite descriptions of further B. duttonii types (Scott et al., 2005) having been
ARTICLE IN PRESS 196
Table 2.
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
Summary of relationships within species and between species of African relapsing fever borreliae
Locus
% homology with B. recurrentis
% homology with B. duttonii
% homology between B. recurrentis and B. duttonii
% homology between B. recurrentis, B. duttonii and B. crocidurae
Flagellin, 981 bp IGS, 587 bp glpQ, 932 bp 16S rRNA, 1525 bp Outer membrane p66, 650 bp Overall concatenated, 4642 bp
100 99.66 99.79 99.9 100 99.94
99.9 97.44a 100 100 100 100
99.8 97.27a 99.79 99.74 98.46 99.42
99.6 87.56a 99.25 99.54 98.46 NT
NT: not tested, as the full concatenated sequence was not available on any single isolate.Deletions not scored as a difference. a Includes uncultivated sequence types.
described, these were detected only in direct amplifications from ticks described elsewhere (Scott et al., 2005), and these were not represented among cultivable isolates. IGS fragment sequencing of B. recurrentis resolved strains into two types that differed by two nucleotides. Of the 18 isolates tested, A1 through to A10, A17, and A18 comprised one group (type I), while isolates A11–A16 gave the remaining profile (type II). These findings are outlined elsewhere (Scott et al., 2005). As described previously, IGS was able to offer sub-species groups to be assessed (Schwan et al., 2007).
Ribosomal 16S sDNA Comparison of a 1525-bp portion of the rrs gene sequences confirmed the difference between the two groups of B. recurrentis, however, using this target, only with a single nucleotide difference (Fig. 1). Whereas the IGS fragment analysis produced within-species differentiation, the rrs gene sequences, with the exception of the B. recurrentis types above, produced single clusters for each relapsing fever species (see Fig. 1). Differences between these species were small, with just 4-nucleotide difference between B. recurrentis and B. duttonii; and six nucleotides differentiating between B. recurrentis and B. crocidurae; and only two nucleotides between B. duttonii and B. crocidurae.
Flagellin Partial flagellin flaB gene was sequenced from B. recurrentis isolates A1–A18 and B. duttonii isolates Ku, Ly, and Ma. When sequences were compared within species, total homology was demonstrated over almost the entire sequence. When both B. recurrentis and B. duttonii were compared over the full length of this 983/4bp sequence, only a 2-adjacent-nucleotide difference
distinguished these species. At this position, these two adjacent nucleotides gave a diagnostic signature that may be of value for identification with B. recurrentis giving AA; B. duttonii GC; while B. crocidurae gave GA. Interestingly, B. duttonii strain 406K (D82859) gave a GA signature at this location, thus resembling B. crocidurae. Over the sequence length studied, one nucleotide was unique to B. recurrentis, one to B. duttonii (absent from D82859), and two specific for B. crocidurae. The phylogenetic relationship of flagellin sequences, together with available sequences from GenBank, is depicted in Fig. 2. Two sequences of B. crocidurae analysed from GenBank were more divergent over 14 nucleotides, illustrated in Fig. 2, with the sequence for U28496 falling away from clades containing other sequences types. This sequence was not included in the overall comparison of similarity given in Table 2. Sequences for B. recurrentis A1–A18 were given accession numbers DQ346814–DQ346831, while B. duttonii strains Ku, Ly, and Ma had the numbers DQ346837, DQ346833, and DQ346835, respectively.
Glycerophosphodiester phosphodiesterase GlpQ Partial glpQ gene products were sequenced for eight isolates of B. recurrentis (A1, A8, A10, A11, A14, A15, A16, and A17 banked with numbers DQ346777– DQ346784, respectively) and for four B. duttonii isolates (Wi, La, Ly, and Ku banked with numbers DQ346785– DQ346788, respectively). These sequences were 932 and 938 bp long for each species, respectively. Alignment of these sequences revealed total homology among either B. recurrentis or B. duttonii isolates, and when each was compared with the other, only 2-nucleotide differences were found between these groups of spirochaetes. When B. recurrentis isolates were compared with those sequences already deposited in GenBank, only slight variation was found between strains at two positions (Fig. 3). Thus, variation seen between different isolates
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
197
B.duttonii AB113315 B.hispanica U42294 B.hispanica DQ057988 B.recurrentis A11 AF107361 B.recurrentis A16 AF107362 B.recurrentis A4 AF107356 B.recurrentis A17 AF107360 B.recurrentis U42300 B.recurrentis A2 DQ346813 B.recurrentis A10 AF107359 B.recurrentis A5 AF107357 B.recurrentis A8 AF107358 B.recurrentis A1 AF107367 B.duttonii UESV 334RWA U42298 B.duttonii Ly AF107364 B.duttonii Ku AF107363 B.duttonii UR BD94MIT U42293 B.duttonii UESV 117DUTT U42288 B.duttonii Ma AF107366 B.duttonii La AF107365 B.crocidurae UESV MER U42291 B.crocidurae UESV 1096TEN U423 B.crocidurae DQ057989 B.crocidurae UESV 1045 U42290 B.crocidurae UESV 1043 U42295 B.crocidurae UESV 523SIS U4230 B.crocidurae UESV 1040DAK U422 B.crocidurae DQ057990 B.crocidurae UESV 917BAR U4228 B.crocidurae UESV 626BAN U4228 B.crocidurae U42286
0.002
Fig. 1. Phylogenetic relationship of Borrelia duttonii and B. recurrentis based on 16S rDNA gene, rrs. Inclusion of other species enables a broader appreciation of the phylogenetic position of these spirochaetes.
of B. recurrentis was equivalent to that seen between B. recurrentis and B. duttonii.
P66 outer membrane protein Presumably the p66 membrane protein through its surface location would be subject to environmental pressures potentially influencing its heterogeneity; however, it has been used to examine spirochaetes (Bunikis et al., 1998). Primers used successfully amplified a 683bp portion of this gene. Amplicons from all isolates of
B. duttonii showed total sequence homology, as did those from B. recurrentis. When these sequences were compared with each other, 10 bp differed between these two species. Similarly, when the other African relapsing fever spirochaete, B. crocidurae, was compared with either B. duttonii or B. recurrentis, each spirochaete differed from each other by 10 nucleotides. The equivalent level of differentiation between these spirochaetes can be seen in Fig. 4. Validity of the sequence data produced in this study was gained through comparison with a sequence already deposited with
ARTICLE IN PRESS 198
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202 B recurrentis A12 DQ346825 B recurrentis A7 DQ346820 B recurrentis A11 DQ346824 B recurrentis A18 DQ346831 B recurrentis A10 DQ346823 B recurrentis A5 DQ346818 B recurrentis A17 DQ346830 B recurrentis A6 DQ346819 B recurrentis A13 DQ346826 61
B recurrentis A3 DQ346816 B recurrentis A9 DQ346822 B recurrentis AY604984 B recurrentis A16 DQ346829 B recurrentis A8 DQ346821 B recurrentis A2 DQ346815
47
B recurrentis A1 DQ346814 B recurrentis A4 DQ346817 B recurrentis D86618 B recurrentis A14 DQ346827
89
B recurrentis A15 DQ346828 B duttonii Ku DQ346837 66
B duttonii Ly DQ346833 B duttonii Ma DQ346835
B duttonii D82859 B crocidurae X75204 B crocidurae U28496
0 .0 0 2
Fig. 2. Neighbour-joining tree of flagellin flaB sequences of Borrelia duttonii and B. recurrentis.
GenBank for B. recurrentis from different geographical locations and by independent researchers. No data could be found for p66 for B. duttonii. Sequences generated were given the accession numbers of DQ346789– DQ346806 for B. recurrentis isolates A1–A18 and DQ346807–DQ346812 for B. duttonii isolates Ly, Lw, La, Ku, Ma, and Wi.
Concatenated sequences Assuming that polymorphisms have resulted from coevolution reflecting the genomic background of these spirochetes, that there is no linkage disequilibrium and excluding differences in possible environmental selective pressure, sequences were concatenated with the results portrayed in Fig. 5. Not all isolates had been sequenced for all genes; thus Fig. 5 only depicts those strains where
all gene targets had been analysed. The overall sequence homology between B. recurrentis and B. duttonii was 99.42% among those isolates with fully concatenated sequences. Apparent differences in phylogenetic relationships displayed in Fig. 5 are likely to reflect the linkage disequilibrium of these different markers. Weighting was not applied to tree drawing parameters. These findings however fail to conclusively demonstrate whether or not these two species should remain as such, or be considered as clones of a single species.
Discussion This study looked at the differences between various gene targets to elucidate whether B. recurrentis and
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
199
B. crocidurae AF247151 B. recurrentis A16 DQ346783 B. recurrentis A11 DQ346780 B. recurrentis A17 DQ346784 B. recurrentis A15 DQ346782 B. recurrentis AF247154 64
60
B. recurrentis AF247155
B. recurrentis A10 DQ346779 B. recurrentis A8 DQ346778 B. recurrentis AF247153 B. recurrentis A1 DQ346777 B. recurrentis AF247152 B. recurrentis A14 DQ346781 B. duttonii Wi DQ346785 B. duttonii Ku DQ346788 65
B. duttonii La DQ346786 B. duttonii Ly DQ346787
0.0005
Fig. 3. Neighbour-joining tree for glpQ sequences for African relapsing fever borreliae.
B. duttonii were different species or should represent clones of a single species. Targets selected included surface-exposed outer membrane protein, p66, likely to be under selective pressure and thus predicted to show greater variability; partial rrs-rrl intragenic spacer which, because of being non-coding, would be predicted to accumulate greater diversity; flagellin flaB and the rrs gene, used in previous studies to address phylogeny of these spirochaetes, and finally the glpQ gene. A similar approach, but using slightly different gene targets has been recently applied to assign a Borrelia species isolated from a dog in Florida to the B. turicatae species (Schwan et al., 2005). This study used the 16S rRNA gene, flaB, gyrB, and glpQ to determine phylogenetic relationships. Furthermore, intragenic spacer regions; 16S rRNA; flaB; gyrB; and glpQ have recently been applied to isolates of B. hermsii (Schwan et al., 2007). In summary, outer membrane protein, p66, showed a 10-nucleotide difference between B. recurrentis and B. duttonii. Similar divergence was observed between either of these spirochaetes and B. crocidurae, thus suggesting that these spirochaetes may indeed represent different species. In contrast, the rrs gene, traditionally used to determine phylogenetic relationships, only revealed slight heterogeneity. This gene is not subject to such selective pressures as surface-exposed proteins, but, however, must maintain functionality. Differences
between species were only slight, with a 4-nucleotide difference between B. recurrentis and B. duttonii; and six nucleotides differentiating B. recurrentis and B. crocidurae; and only two nucleotides between B. duttonii and B. crocidurae. In contrast, the flagellin flaB gene showed only a twoadjacent-nucleotide difference between these spirochaetes, whereas B. crocidurae appeared to be more distantly related. Comparison of the isolates sequenced within this study again showed heterogeneity with those deposited in GenBank. Collectively, these findings support the view that B. recurrentis may indeed be a clone arising from a common ancestral strain or directly from the B. duttonii cluster. This is further supported by the closer clustering of B. duttonii strain 406K with isolates of B. recurrentis, rather than the B. duttonii clade. However, the low numbers of isolates sequenced, coupled with limited diversity at the nucleotide level, make it difficult to conclusively demonstrate this hypothesis. Given the homogeneity among the B. recurrentis and B. duttonii isolates, it was a concern to see the divergence between the two B. crocidurae sequences deposited in GenBank (U28496 and X75204). These appeared to be only distantly related based upon their flagellin sequences. The sequence U28496 gave a 2- and 3-nucleotide difference from B. recurrentis and B. duttonii, respectively, while the sequence X75204 gave 12 further differences above
ARTICLE IN PRESS 200
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202 B recurrentis A17 DQ346805 B recurrentis A4 DQ346792 B recurrentis A16 DQ346804 B recurrentis A1 DQ346789 B recurrentis A15 DQ346803 B recurrentis A6 DQ346794 B recurrentis A13 DQ346801 B recurrentis A9 DQ346797 B recurrentis A2 DQ346790 B recurrentis A12 DQ346800 B recurrentis A8 DQ346796 B recurrentis A5 DQ346793 B recurrentis A3 DQ346791 B recurrentis A14 DQ346802 B recurrentis A11 DQ346799 B recurrentis A10 DQ346798 B recurrentis AF228024 B recurrentis A18 DQ346806 B recurrentis A7 DQ346795 B crocidurae AF125321 B duttonii Ku DQ346810 B duttonii La DQ346809 B duttonii Lw DQ346808 B duttonii Ma DQ346811 B duttonii Ly DQ346807 B duttonii Wi DQ346812
0.002
Fig. 4. Phylogeny of African relapsing fever borreliae using p66 outer membrane protein.
those observed for X75204. No information was available as to the source or geographical location of these isolates. The 2-adjacent-nucleotide signature observed within the flagellin gene could prove of use for a diagnostic assay for differentiating these strains. This difference could be incorporated into a restriction endonuclease assay resulting in different digest patterns or probe-based hybridisation differentiation of these spirochaetes. Of concern is the possession of a B. crocidurae-like signature at this discriminatory position for B. duttonii strain 406K. Although sequences indicative of B. crocidurae have been reported from areas endemic for B. duttonii, further investigation is needed before a general conclusion can be drawn (Scott et al., 2005). Similarly, analysis of the glpQ gene revealed just a 2-base-pair difference between B. recurrentis and
B. duttonii. An equivalent divergence was found when the sequences generated within this study were compared with others deposited with GenBank. In an earlier study based on IGS sequence comparisons, greater diversity was found among B. duttonii when compared with B. recurrentis, leading to speculation that this may be the ancestral species (Scott et al., 2005). Many of these variants were, however, not represented among cultivable strains and were not available for investigation in this current study. The demonstration of greater diversity among B. duttonii was not evident from the analyses presented in this study; however, it must be remembered that this work was reliant on cultivable organisms to produce sufficient biomass and consequently may not reflect the true variability among these spirochaetes. Limitations of this study must be considered when attempting to draw firm conclusions from the data
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202 84
201
B. recurrentis A11 B. recurrentis A16
B. recurrentis A1 B. recurrentis A10 61
B. recurrentis A8 B. recurrentis A17 B. duttonii Ku 100
B. duttonii Ly B. duttonii La
0.0005
Fig. 5. Neighbour-joining phylogenetic tree of concatenated DNA sequences for isolates of Borrelia duttonii and B. recurrentis where all five loci were examined (bootstrap analysis using 250 replicates).
presented. The quality of sequences deposited to GenBank may be variable and thus lead to small differences among strains. Furthermore, the identity of these spirochaetes has been largely concluded based on sequence homology and epidemiological knowledge. This has recently been questioned as the characterisation of B. crocidurae-like sequences present in spirochaetes derived from both patients and ticks in East Africa, an area endemic for B. duttonii, which has not previously been described as also having B. crocidurae (Scott et al., 2005). Another potential cause of further variation is the use of different isolates for the depositions made to GenBank. Although the strains used in this study were from largely similar geographical origins, those used by others were from different spatial temporal origins and were sometimes multiply passaged either in vitro or in vivo. In contrast, the isolates we report herein were only from patients within a limited local area and thus may not reflect true diversity among these spirochaetes. Given these limitations coupled with the linkage disequilibrium likely to arise from the different markers assessed, it is difficult to categorically conclude whether or not these are distinct species. Certainly, the rrs and p66 genes would argue against these being the same spirochaete; however, results from glpQ, IGS, and flaB tend to support the idea of B. recurrentis being a louseadapted clone of either B. duttonii or a common ancestor. Again, the narrow ecological niche of B. recurrentis suggests that this spirochaete has recently evolved. Certainly these spirochaetes, unlike other relapsing fever spirochaetes, have no as yet identified alternative animal reservoirs. They have been largely refractory to in vivo investigation, requiring primate models to mimic human disease, and thus remain sadly unstudied. This is in stark contrast to other relapsing fever spirochaetes that have mammalian natural reser-
voirs, typically small rodents. Whether reported differences in clinical presentation between B. recurrentis and B. duttonii are associated with their different vector transmission, host immunological susceptibility, or clonally associated virulence factors remains to be elucidated. It is likely that the dilemma of whether or not these represent different species will not be fully resolved until full genomic sequencing becomes available.
References Assous, M.V., Wilamowski, A., Bercovier, H., Marva, E., 2006. Molecular characterization of tickborne relapsing fever Borrelia, Israel. Emerg. Infect. Dis. 12, 1740–1743. Barbour, A., 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57, 521–525. Brahim, H., Perrier-Gros-Claude, J., Postic, D., Baranton, G., Jambou, R., 2005. Identifying relapsing fever Borrelia, Senegal. Emerg. Infect. Dis. 11, 474–475. Bunikis, J., Luke, C.J., Bunikiene, E., Bergstro¨m, S., Barbour, A.G., 1998. A surface-exposed region of a novel outer membrane protein (P66) of Borrelia spp. is variable in size and sequence. J. Bacteriol. 180, 1618–1623. Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., Barbour, A.G., 2004a. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150, 1741–1755. Bunikis, J., Tsao, J., Garpmo, U., Berglund, J., Fish, D., Barbour, A., 2004b. Typing of Borrelia relapsing fever group strains. Emerg. Infect. Dis. 10, 1661–1664. Cutler, S.J., Fekade, D., Hussein, K., Knox, K.A., Melka, A., Cann, K., Emilianus, A.R., Warrell, D.A., Wright, D.J., 1994. Successful in-vitro cultivation of Borrelia recurrentis. The Lancet 343, 242.
ARTICLE IN PRESS 202
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
Cutler, S., Moss, J., Fukunaga, M., Wright, D., Fekade, D., Warrell, D., 1997a. Borrelia recurrentis characterization and comparison with relapsing-fever, Lyme-associated, and other Borrelia spp. Int. J. Syst. Bacteriol. 47, 958–968. Cutler, S.J., Moss, J., Fukunaga, M., Wright, D.J., Fekade, D., Warrell, D., 1997b. Borrelia recurrentis characterization and comparison with relapsing-fever, Lyme-associated, and other Borrelia spp. Int. J. Syst. Bacteriol. 47, 958–968. Cutler, S.J., Akintunde, C.O., Moss, J., Fukunaga, M., Kurtenbach, K., Talbert, A., Zhang, H., Wright, D.J., Warrell, D.A., 1999. Successful in vitro cultivation of Borrelia duttonii and its comparison with Borrelia recurrentis. Int. J. Syst. Bacteriol. 49, 1793–1799. Fukunaga, M., Ushijima, Y., Aoki, L., Talbert, A., 2001. Detection of Borrelia duttonii, a tick-borne relapsing fever agent in central Tanzania, within ticks by flagellin genebased nested polymerase chain reaction. Vector Borne Zoonotic Dis 1, 331–338. Kisinza, W.N., McCall, P.J., Mitani, H., Talbert, A., Fukunaga, M., 2003. A newly identified tick-borne Borrelia species and relapsing fever in Tanzania. The Lancet 362, 1283–1284. Nordstrand, A., Bunikis, I., Larsson, C., Tsogbe, K., Schwan, T.G., Nilsson, M., Bergstro¨m, S., 2007. Tickborne relapsing fever diagnosis obscured by malaria, Togo. Emerg. Infect. Dis. 13, 117–123. Pennington, P.M., Cadavid, D., Barbour, A.G., 1999. Characterization of VspB of Borrelia turicatae, a major outer membrane protein expressed in blood and tissues of mice. Infect. Immun. 67, 4637–4645.
Porcella, S.F., Raffel, S.J., Schrumpf, M.E., Schriefer, M.E., Dennis, D.T., Schwan, T.G., 2000. Serodiagnosis of louseborne relapsing fever with glycerophosphodiester phosphodiesterase (GlpQ) from Borrelia recurrentis. J. Clin. Microbiol. 38, 3561–3571. Ras, N., Lascola, B., Postic, D., Cutler, S., Rodhain, F., Baranton, G., Raoult, D., 1996. Phylogenesis of relapsing fever Borrelia spp. Int. J. Syst. Bacteriol. 46, 859–865. Schwan, T.G., Raffel, S.J., Schrumpf, M.E., Policastro, P.F., Rawlings, J.A., Lane, R.S., Breitschwerdt, E.B., Porcella, S.F., 2005. Phylogenetic analysis of the spirochetes Borrelia parkeri and Borrelia turicatae and the potential for tickborne relapsing fever in Florida. J. Clin. Microbiol. 43, 3851–3859. Schwan, T.G., Raffel, S.J., Schrumpf, M.E., Porcella, S.F., 2007. Diversity and distribution of Borrelia hermsii. Emerg. Infect. Dis. 13, 436–442. Scott, J.C., Wright, D.J.M., Cutler, S.J., 2005. Typing African relapsing fever spirochetes. Emerg. Infect. Dis. 11, 1722–1729. Vial, L., Diatta, G., Tall, A., Ba, E.H., Bouganali, H., Durand, P., Sokhna, C., Rogier, C., Renaud, F., Trape, J.F., 2006a. Incidence of tick-borne relapsing fever in West Africa: longitudinal study. The Lancet 368, 37–43. Vial, L., Durand, P., Arnathau, C., Halos, L., Diatta, G., Trape, J.F., Renaud, F., 2006b. Molecular divergences of the Ornithodoros sonrai soft tick species, a vector of human relapsing fever in West Africa. Microbes Infect. 8, 2605–2611.
International Journal of Medical Microbiology 298 (2008) S1, 193–202 www.elsevier.de/ijmm
Phylogenetic origins of Borrelia recurrentis Sally J. Cutlera,, Julie C. Scottb, David J.M. Wrightb a
Health & Biosciences, University of East London, Stratford, London E15 4LZ, UK Imperial College of Science, Technology & Medicine, London SW7 2AZ, UK
b
Accepted 20 November 2007
Abstract Intragenic spacer (IGS, between 16S–23S genes) provides resolution among Lyme-borreliosis-associated spirochaetes and some relapsing fever Borrelia. When applied to East African relapsing fever borreliae, two and four types were found, respectively, among B. recurrentis and B. duttonii. Surprisingly, IGS typing was unable to discriminate between the tick- and louse-borne forms of disease, raising the possibility that these organisms are the same species. In order to resolve this question, further genes were sequenced to produce a multi-locus approach to determine whether these are indeed different species. Various housekeeping genes were selected from data deposited for B. hermsii (limited sequence information exists for either B. recurrentis or B. duttonii). Of selected targets, sufficient amplification was only produced using glpQ; thus, further genes were analysed including flaB, rrs rDNA, and p66 outer membrane protein. The fastidious nature of these organisms limited numbers of isolates available for full analysis. In contrast, the IGS typing was applied to a variety of patient’s blood samples and arthropod vectors in addition to cultivable isolates, potentially introducing a bias to the results. Results highlighted the remarkable similarity between these B. recurrentis and B. duttonii, with only minor nucleotide differences. Collectively, these findings suggest a common ancestral lineage for these spirochaetes. These minor nucleotide differences of 2–10 nucleotides were able to differentiate both ‘species’. It is likely that these differences reflect an accumulation of adaptive changes through time and pressures resulting from different vector transmission, with these spirochaetes being subgroups of the same species. In contrast, the IGS sequence, being non-coding, is not under such selective pressure and thus probably reflects changes accumulated over time alone, without the functional constraints. Complete genomic sequence analysis is likely to illuminate greater insights into the taxonomic relationship between these microbes and elucidate the molecular basis of arthropod competence and pathogenicity among these spirochaetes. r 2007 Elsevier GmbH. All rights reserved. Keywords: Borrelia recurrentis; Borrelia duttonii; Louse-borne relapsing fever; Tick-borne relapsing fever; Spirochaetes
Introduction It is currently held that relapsing fever spirochaetes in the Old World occupy distinct geographical niches; this Corresponding author. Tel.: +44 208 223 6386; fax: +44 208 223 4959 E-mail address: [email protected] (S.J. Cutler).
1438-4221/$ - see front matter r 2007 Elsevier GmbH. All rights reserved. doi:10.1016/j.ijmm.2007.11.011
was not always the case. Prior to the 1960s, major epidemics of louse-borne forms of the disease were responsible for significant worldwide morbidity and mortality. Since these times, the disease now only persists in Ethiopia, occasionally spilling into neighbouring countries such as Sudan (Cutler et al., 1997a, Porcella et al., 2000). What is often overlooked in countries endemic for louse-borne relapsing fever is that
ARTICLE IN PRESS 194
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
ticks may also frequent traditional dwellings and thus both louse- and tick-borne populations of spirochaetes could overlap. Tick-borne varieties of relapsing fever spirochaetes have also resulted in a significant public health burden. Indeed, David Livingstone, while on his epic travels through Africa, noted the significant disease burden associated with ticks. Subsequently, it became accepted that B. crocidurae persists in western regions of Africa with countries such as Senegal considered endemic (Brahim et al., 2005), while B. duttonii persists in East Africa, particularly in regions of Tanzania (Cutler et al., 1999). These geographical demarcations and indeed the specificities of vector ticks for transmission may be less well established than previously thought, possibly resulting from the absence of suitably discriminatory tests able to address these issues. Indeed, some evidence for this comes from a recent PCR-based study in Togo, where both B. crocidurae and B. duttonii were found (Nordstrand et al., 2007). Furthermore, diversity has also been noted among the vector ticks coupled with variation among their probable vector competence for these spirochaetes (Vial et al., 2006b). Early researchers questioned the host and vector specificities for these relapsing fever spirochaetes, with several studies that described ticks feeding on patients with the louse-borne form of the disease and subsequently being allowed to engorge on non-febrile individuals. These studies revealed that B. recurrentis had apparently lost its competence for tick transmission; however, several tick species could be transmitted by lice. Many of these early investigations can be criticised through the inability to reliably identify the organisms used, the lack of available cultivable strains, and the absence of means for assessing the immune status of recipient hosts. Since these early investigations, speciation of relapsing fever spirochaetes has been reliant upon the geographical region from where infection was acquired and evidence of exposure to the vector responsible for transmission. Only recently have molecular approaches been applied to identify these spirochaetes (Fukunaga et al., 2001; Kisinza et al., 2003; Brahim et al., 2005; Assous et al., 2006; Vial et al., 2006a). Relapsing fever spirochaetes are a challenge to many molecular microbiological typing methods, in part, through their possession of segmented genomes carried on large linear plasmids. The number and sizes differ between isolates of B. recurrentis and B. duttonii (Cutler et al., 1997a, 1999); however, typically the chromosome is 930 kb, with strains possessing circa 7 and 12 plasmids, respectively (for strains A1 and Ly, Lescot et al., 2007, unpublished findings), totalling 319 and 641 kb in each species. Inter- and intragenomic recombination associated with antigenic variation may result in size variation among these plasmids through duplication events, thus invalidating their use as typing tools
(Pennington et al., 1999). Consequently, molecular characterisation of these spirochaetes has been largely reliant upon gene amplification and sequencing. The rrs gene has highlighted the remarkable similarity among those relapsing fever species from the Old World, with only limited nucleotide differences discriminating between the known species (Ras et al., 1996). Others have used this approach with the flagellin gene, flaB, and, similarly, found only minor differences between species (Fukunaga et al., 2001; Kisinza et al., 2003). More recently, non-coding intragenic spacer between 16S–23S genes has been shown to be particularly valuable for characterising relapsing fever spirochaetes (Bunikis et al., 2004b; Scott et al., 2005). This method proved highly discriminatory and enabled grouping within species; however, a surprising finding was the failure of this approach to be able to differentiate B. recurrentis and B. duttonii (Scott et al., 2005). To further investigate this apparent lack of differentiation between these two species, four additional gene targets were assessed for these isolates.
Materials and methods Various genes were used to analyse the phylogenetic relationships among isolates of B. recurrentis and B. duttonii to establish the differences between these spirochaetes. These included those targets previously shown to have discriminatory value for examining these spirochaetes (rrs and flaB), non-coding regions expected to show increased variability partial intragenic spacer (IGS) target residing between the 16S–23S rDNA genes (rrs-rrlA) surface exposed protein (p66), and other essential gene targets where sequence data existed for related spirochaetes that may enable amplification through sufficient conservation.
Isolates East African relapsing fever borreliae were isolated from patients in endemic areas for louse-borne relapsing fever (Addis Ababa, Ethiopia) and tick-borne relapsing fever (Mvumi, Tanzania) (Cutler et al., 1994, 1997b, 1999). These organisms were cultivated using BSKII medium, stored at 70 1C for long-term storage, and revived prior to investigation (Barbour, 1984).
PCR Primer sequences used are listed in Table 1. All primers were supplied by Sigma Genosys (UK). PCR amplicons were resolved using 1% agarose gels. Products were cleaned using a PCR clean-up kit (Promega) and sequenced directly or bands excised,
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
Table 1.
195
Primers used in study
Gene
Forward primers 50 –30
Reverse primers 50 –30
IGS Outer IGS Inner 16S rRNA (FD3-UniB) 16S rRNA fragment 1 (FD3-500R) 16S rRNA fragment 2 (400F-1050R) 16S rRNA fragment 3 (800F-rD1R) glpQ fragment 1 glpQ fragment 2 p66 (P6651-P6631) Flagellin (Flf1-Flr1) Flagellin (Flf2-Flr2)
GTATGTTTAGTGAGGGGGGTG AGGGGGGTGAAGTCGTAACAAG AGAGTTTGATCCTGGCTTAG AGAGTTTGATCCTGGCTTAG GGAGCGACACTGCGTG ATTAGATACCCTGGTAG TAATAATGTTTGCAATAAGTAC CCAATATACCCTAACCGTTTTC AGTGATTTTTCTATACTTGGACAC CGTGATGATCATAAATCATAATACG ACATATTCAGATGCAGACAGAGGT
GGATCATAGCTCAGGTGGTTAG GTCTGATAAACCTGAGGTCGGA T(AC)AAGGAGGTGATCCAGC CTGCTGGCACGTAATTAGCC CACGAGCTGACGACA AAGGAGGTGATCCAGCC CAATATTTTTCCCTGTGCTTTT CTTTATTGATATATCAACAAAG GTTAATTTGATTAAGTTKTCTAGTTCT CCAAGCTCTTCAGCTGTTCTTAC CATATTGAGGTACTTGATTTGC
and DNA purified using a Wizard SV gel and PCR cleanup system (Promega). The IGS PCR used a Borrelia-specific nested PCR designed to amplify the 16S–23S intragenic spacer (IGS) region as described (Bunikis et al., 2004a). Outer primers are anchored in the 30 -end of the rrs gene and the ileT genes, respectively, with nested internal inner primers. The 16S rRNA rrs gene was amplified initially using primers FD3 and UniB using 94 1C for 60 s, 54 1C for 60 s and 72 1C for 60 and 30 s for a total of 45 cycles. Overlapping contigs were amplified using further primers described by others (Ras et al., 1996). Flagellin was amplified using two overlapping fragments following 35 cycles of 1 min for denaturation at 94 1C and annealing at 56 and 52 1C, respectively, and extension at 72 1C. A 750-bp region of the p66 outer surface protein was amplified using primers kindly described by Alan Barbour. These should include the loop region, hydrophobic flanking regions of this protein. Cycling conditions of 94 1C for 60 s, 40 1C for 2 min, and finally 72 1C for 2 min for a total of 35 cycles were used. The glycerophosphodiester phosphodiesterase (glpQ) gene for four B. recurrentis strains had already been submitted (AF247152–AF247155). These sequences, together with those deposited for other relapsing fever spirochaetes, were aligned, and primers designed against homologous regions. The target gene was amplified using two overlapping fragments. Amplification was achieved using 35 cycles of 60 s for denaturation at 94 1C, annealing at 48 1C and extension at 72 1C.
Data analysis Chromatograms were analysed using Chromas (version 1.45) and DNA Star software (Lasergene 6). Multiple alignments were assessed using ClustalW. Results produced by IGS fragment typing were compared with those using the rrs gene using sequences held in GenBank.
Phylogenetic trees The phylogenetic relationships of sequences were compared using Mega software (version 3) and neighbour-joining methods for compilation of the trees. A bootstrap value of 250 was used to determine confidence in tree-drawing parameters.
Results Only those assays for flagellin, p66, 16S rRNA, IGS, and glpQ successfully generated amplicons from sufficient isolates to allow phylogenetic comparisons. Attempts to compare other gene targets assuming homology with sequences generated from B. hermsii were unsuccessful in amplifying targets from our isolates for recB, recC, bdrB, fruK, fruA2, and hexoV. A comparative summary of those genes successfully amplified is given in Table 2.
Intragenic spacer amplifications DNA sequencing Purified DNA was either directly sequenced or cloned into pGEMT-easy (Promega) before being sequenced. Sequencing reactions were performed using BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems) according to the manufacturer’s instructions and analysed on an Applied Biosystems Genetic Analyzer.
Isolates of B. duttonii yielded a 587-bp portion of the IGS that revealed total homology among this species. Consequently, strain Ly was selected to represent these isolates and has since been used by others as the representative isolate for B. duttonii (Fukunaga et al., 2001; Brahim et al., 2005). Despite descriptions of further B. duttonii types (Scott et al., 2005) having been
ARTICLE IN PRESS 196
Table 2.
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
Summary of relationships within species and between species of African relapsing fever borreliae
Locus
% homology with B. recurrentis
% homology with B. duttonii
% homology between B. recurrentis and B. duttonii
% homology between B. recurrentis, B. duttonii and B. crocidurae
Flagellin, 981 bp IGS, 587 bp glpQ, 932 bp 16S rRNA, 1525 bp Outer membrane p66, 650 bp Overall concatenated, 4642 bp
100 99.66 99.79 99.9 100 99.94
99.9 97.44a 100 100 100 100
99.8 97.27a 99.79 99.74 98.46 99.42
99.6 87.56a 99.25 99.54 98.46 NT
NT: not tested, as the full concatenated sequence was not available on any single isolate.Deletions not scored as a difference. a Includes uncultivated sequence types.
described, these were detected only in direct amplifications from ticks described elsewhere (Scott et al., 2005), and these were not represented among cultivable isolates. IGS fragment sequencing of B. recurrentis resolved strains into two types that differed by two nucleotides. Of the 18 isolates tested, A1 through to A10, A17, and A18 comprised one group (type I), while isolates A11–A16 gave the remaining profile (type II). These findings are outlined elsewhere (Scott et al., 2005). As described previously, IGS was able to offer sub-species groups to be assessed (Schwan et al., 2007).
Ribosomal 16S sDNA Comparison of a 1525-bp portion of the rrs gene sequences confirmed the difference between the two groups of B. recurrentis, however, using this target, only with a single nucleotide difference (Fig. 1). Whereas the IGS fragment analysis produced within-species differentiation, the rrs gene sequences, with the exception of the B. recurrentis types above, produced single clusters for each relapsing fever species (see Fig. 1). Differences between these species were small, with just 4-nucleotide difference between B. recurrentis and B. duttonii; and six nucleotides differentiating between B. recurrentis and B. crocidurae; and only two nucleotides between B. duttonii and B. crocidurae.
Flagellin Partial flagellin flaB gene was sequenced from B. recurrentis isolates A1–A18 and B. duttonii isolates Ku, Ly, and Ma. When sequences were compared within species, total homology was demonstrated over almost the entire sequence. When both B. recurrentis and B. duttonii were compared over the full length of this 983/4bp sequence, only a 2-adjacent-nucleotide difference
distinguished these species. At this position, these two adjacent nucleotides gave a diagnostic signature that may be of value for identification with B. recurrentis giving AA; B. duttonii GC; while B. crocidurae gave GA. Interestingly, B. duttonii strain 406K (D82859) gave a GA signature at this location, thus resembling B. crocidurae. Over the sequence length studied, one nucleotide was unique to B. recurrentis, one to B. duttonii (absent from D82859), and two specific for B. crocidurae. The phylogenetic relationship of flagellin sequences, together with available sequences from GenBank, is depicted in Fig. 2. Two sequences of B. crocidurae analysed from GenBank were more divergent over 14 nucleotides, illustrated in Fig. 2, with the sequence for U28496 falling away from clades containing other sequences types. This sequence was not included in the overall comparison of similarity given in Table 2. Sequences for B. recurrentis A1–A18 were given accession numbers DQ346814–DQ346831, while B. duttonii strains Ku, Ly, and Ma had the numbers DQ346837, DQ346833, and DQ346835, respectively.
Glycerophosphodiester phosphodiesterase GlpQ Partial glpQ gene products were sequenced for eight isolates of B. recurrentis (A1, A8, A10, A11, A14, A15, A16, and A17 banked with numbers DQ346777– DQ346784, respectively) and for four B. duttonii isolates (Wi, La, Ly, and Ku banked with numbers DQ346785– DQ346788, respectively). These sequences were 932 and 938 bp long for each species, respectively. Alignment of these sequences revealed total homology among either B. recurrentis or B. duttonii isolates, and when each was compared with the other, only 2-nucleotide differences were found between these groups of spirochaetes. When B. recurrentis isolates were compared with those sequences already deposited in GenBank, only slight variation was found between strains at two positions (Fig. 3). Thus, variation seen between different isolates
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
197
B.duttonii AB113315 B.hispanica U42294 B.hispanica DQ057988 B.recurrentis A11 AF107361 B.recurrentis A16 AF107362 B.recurrentis A4 AF107356 B.recurrentis A17 AF107360 B.recurrentis U42300 B.recurrentis A2 DQ346813 B.recurrentis A10 AF107359 B.recurrentis A5 AF107357 B.recurrentis A8 AF107358 B.recurrentis A1 AF107367 B.duttonii UESV 334RWA U42298 B.duttonii Ly AF107364 B.duttonii Ku AF107363 B.duttonii UR BD94MIT U42293 B.duttonii UESV 117DUTT U42288 B.duttonii Ma AF107366 B.duttonii La AF107365 B.crocidurae UESV MER U42291 B.crocidurae UESV 1096TEN U423 B.crocidurae DQ057989 B.crocidurae UESV 1045 U42290 B.crocidurae UESV 1043 U42295 B.crocidurae UESV 523SIS U4230 B.crocidurae UESV 1040DAK U422 B.crocidurae DQ057990 B.crocidurae UESV 917BAR U4228 B.crocidurae UESV 626BAN U4228 B.crocidurae U42286
0.002
Fig. 1. Phylogenetic relationship of Borrelia duttonii and B. recurrentis based on 16S rDNA gene, rrs. Inclusion of other species enables a broader appreciation of the phylogenetic position of these spirochaetes.
of B. recurrentis was equivalent to that seen between B. recurrentis and B. duttonii.
P66 outer membrane protein Presumably the p66 membrane protein through its surface location would be subject to environmental pressures potentially influencing its heterogeneity; however, it has been used to examine spirochaetes (Bunikis et al., 1998). Primers used successfully amplified a 683bp portion of this gene. Amplicons from all isolates of
B. duttonii showed total sequence homology, as did those from B. recurrentis. When these sequences were compared with each other, 10 bp differed between these two species. Similarly, when the other African relapsing fever spirochaete, B. crocidurae, was compared with either B. duttonii or B. recurrentis, each spirochaete differed from each other by 10 nucleotides. The equivalent level of differentiation between these spirochaetes can be seen in Fig. 4. Validity of the sequence data produced in this study was gained through comparison with a sequence already deposited with
ARTICLE IN PRESS 198
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202 B recurrentis A12 DQ346825 B recurrentis A7 DQ346820 B recurrentis A11 DQ346824 B recurrentis A18 DQ346831 B recurrentis A10 DQ346823 B recurrentis A5 DQ346818 B recurrentis A17 DQ346830 B recurrentis A6 DQ346819 B recurrentis A13 DQ346826 61
B recurrentis A3 DQ346816 B recurrentis A9 DQ346822 B recurrentis AY604984 B recurrentis A16 DQ346829 B recurrentis A8 DQ346821 B recurrentis A2 DQ346815
47
B recurrentis A1 DQ346814 B recurrentis A4 DQ346817 B recurrentis D86618 B recurrentis A14 DQ346827
89
B recurrentis A15 DQ346828 B duttonii Ku DQ346837 66
B duttonii Ly DQ346833 B duttonii Ma DQ346835
B duttonii D82859 B crocidurae X75204 B crocidurae U28496
0 .0 0 2
Fig. 2. Neighbour-joining tree of flagellin flaB sequences of Borrelia duttonii and B. recurrentis.
GenBank for B. recurrentis from different geographical locations and by independent researchers. No data could be found for p66 for B. duttonii. Sequences generated were given the accession numbers of DQ346789– DQ346806 for B. recurrentis isolates A1–A18 and DQ346807–DQ346812 for B. duttonii isolates Ly, Lw, La, Ku, Ma, and Wi.
Concatenated sequences Assuming that polymorphisms have resulted from coevolution reflecting the genomic background of these spirochetes, that there is no linkage disequilibrium and excluding differences in possible environmental selective pressure, sequences were concatenated with the results portrayed in Fig. 5. Not all isolates had been sequenced for all genes; thus Fig. 5 only depicts those strains where
all gene targets had been analysed. The overall sequence homology between B. recurrentis and B. duttonii was 99.42% among those isolates with fully concatenated sequences. Apparent differences in phylogenetic relationships displayed in Fig. 5 are likely to reflect the linkage disequilibrium of these different markers. Weighting was not applied to tree drawing parameters. These findings however fail to conclusively demonstrate whether or not these two species should remain as such, or be considered as clones of a single species.
Discussion This study looked at the differences between various gene targets to elucidate whether B. recurrentis and
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
199
B. crocidurae AF247151 B. recurrentis A16 DQ346783 B. recurrentis A11 DQ346780 B. recurrentis A17 DQ346784 B. recurrentis A15 DQ346782 B. recurrentis AF247154 64
60
B. recurrentis AF247155
B. recurrentis A10 DQ346779 B. recurrentis A8 DQ346778 B. recurrentis AF247153 B. recurrentis A1 DQ346777 B. recurrentis AF247152 B. recurrentis A14 DQ346781 B. duttonii Wi DQ346785 B. duttonii Ku DQ346788 65
B. duttonii La DQ346786 B. duttonii Ly DQ346787
0.0005
Fig. 3. Neighbour-joining tree for glpQ sequences for African relapsing fever borreliae.
B. duttonii were different species or should represent clones of a single species. Targets selected included surface-exposed outer membrane protein, p66, likely to be under selective pressure and thus predicted to show greater variability; partial rrs-rrl intragenic spacer which, because of being non-coding, would be predicted to accumulate greater diversity; flagellin flaB and the rrs gene, used in previous studies to address phylogeny of these spirochaetes, and finally the glpQ gene. A similar approach, but using slightly different gene targets has been recently applied to assign a Borrelia species isolated from a dog in Florida to the B. turicatae species (Schwan et al., 2005). This study used the 16S rRNA gene, flaB, gyrB, and glpQ to determine phylogenetic relationships. Furthermore, intragenic spacer regions; 16S rRNA; flaB; gyrB; and glpQ have recently been applied to isolates of B. hermsii (Schwan et al., 2007). In summary, outer membrane protein, p66, showed a 10-nucleotide difference between B. recurrentis and B. duttonii. Similar divergence was observed between either of these spirochaetes and B. crocidurae, thus suggesting that these spirochaetes may indeed represent different species. In contrast, the rrs gene, traditionally used to determine phylogenetic relationships, only revealed slight heterogeneity. This gene is not subject to such selective pressures as surface-exposed proteins, but, however, must maintain functionality. Differences
between species were only slight, with a 4-nucleotide difference between B. recurrentis and B. duttonii; and six nucleotides differentiating B. recurrentis and B. crocidurae; and only two nucleotides between B. duttonii and B. crocidurae. In contrast, the flagellin flaB gene showed only a twoadjacent-nucleotide difference between these spirochaetes, whereas B. crocidurae appeared to be more distantly related. Comparison of the isolates sequenced within this study again showed heterogeneity with those deposited in GenBank. Collectively, these findings support the view that B. recurrentis may indeed be a clone arising from a common ancestral strain or directly from the B. duttonii cluster. This is further supported by the closer clustering of B. duttonii strain 406K with isolates of B. recurrentis, rather than the B. duttonii clade. However, the low numbers of isolates sequenced, coupled with limited diversity at the nucleotide level, make it difficult to conclusively demonstrate this hypothesis. Given the homogeneity among the B. recurrentis and B. duttonii isolates, it was a concern to see the divergence between the two B. crocidurae sequences deposited in GenBank (U28496 and X75204). These appeared to be only distantly related based upon their flagellin sequences. The sequence U28496 gave a 2- and 3-nucleotide difference from B. recurrentis and B. duttonii, respectively, while the sequence X75204 gave 12 further differences above
ARTICLE IN PRESS 200
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202 B recurrentis A17 DQ346805 B recurrentis A4 DQ346792 B recurrentis A16 DQ346804 B recurrentis A1 DQ346789 B recurrentis A15 DQ346803 B recurrentis A6 DQ346794 B recurrentis A13 DQ346801 B recurrentis A9 DQ346797 B recurrentis A2 DQ346790 B recurrentis A12 DQ346800 B recurrentis A8 DQ346796 B recurrentis A5 DQ346793 B recurrentis A3 DQ346791 B recurrentis A14 DQ346802 B recurrentis A11 DQ346799 B recurrentis A10 DQ346798 B recurrentis AF228024 B recurrentis A18 DQ346806 B recurrentis A7 DQ346795 B crocidurae AF125321 B duttonii Ku DQ346810 B duttonii La DQ346809 B duttonii Lw DQ346808 B duttonii Ma DQ346811 B duttonii Ly DQ346807 B duttonii Wi DQ346812
0.002
Fig. 4. Phylogeny of African relapsing fever borreliae using p66 outer membrane protein.
those observed for X75204. No information was available as to the source or geographical location of these isolates. The 2-adjacent-nucleotide signature observed within the flagellin gene could prove of use for a diagnostic assay for differentiating these strains. This difference could be incorporated into a restriction endonuclease assay resulting in different digest patterns or probe-based hybridisation differentiation of these spirochaetes. Of concern is the possession of a B. crocidurae-like signature at this discriminatory position for B. duttonii strain 406K. Although sequences indicative of B. crocidurae have been reported from areas endemic for B. duttonii, further investigation is needed before a general conclusion can be drawn (Scott et al., 2005). Similarly, analysis of the glpQ gene revealed just a 2-base-pair difference between B. recurrentis and
B. duttonii. An equivalent divergence was found when the sequences generated within this study were compared with others deposited with GenBank. In an earlier study based on IGS sequence comparisons, greater diversity was found among B. duttonii when compared with B. recurrentis, leading to speculation that this may be the ancestral species (Scott et al., 2005). Many of these variants were, however, not represented among cultivable strains and were not available for investigation in this current study. The demonstration of greater diversity among B. duttonii was not evident from the analyses presented in this study; however, it must be remembered that this work was reliant on cultivable organisms to produce sufficient biomass and consequently may not reflect the true variability among these spirochaetes. Limitations of this study must be considered when attempting to draw firm conclusions from the data
ARTICLE IN PRESS S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202 84
201
B. recurrentis A11 B. recurrentis A16
B. recurrentis A1 B. recurrentis A10 61
B. recurrentis A8 B. recurrentis A17 B. duttonii Ku 100
B. duttonii Ly B. duttonii La
0.0005
Fig. 5. Neighbour-joining phylogenetic tree of concatenated DNA sequences for isolates of Borrelia duttonii and B. recurrentis where all five loci were examined (bootstrap analysis using 250 replicates).
presented. The quality of sequences deposited to GenBank may be variable and thus lead to small differences among strains. Furthermore, the identity of these spirochaetes has been largely concluded based on sequence homology and epidemiological knowledge. This has recently been questioned as the characterisation of B. crocidurae-like sequences present in spirochaetes derived from both patients and ticks in East Africa, an area endemic for B. duttonii, which has not previously been described as also having B. crocidurae (Scott et al., 2005). Another potential cause of further variation is the use of different isolates for the depositions made to GenBank. Although the strains used in this study were from largely similar geographical origins, those used by others were from different spatial temporal origins and were sometimes multiply passaged either in vitro or in vivo. In contrast, the isolates we report herein were only from patients within a limited local area and thus may not reflect true diversity among these spirochaetes. Given these limitations coupled with the linkage disequilibrium likely to arise from the different markers assessed, it is difficult to categorically conclude whether or not these are distinct species. Certainly, the rrs and p66 genes would argue against these being the same spirochaete; however, results from glpQ, IGS, and flaB tend to support the idea of B. recurrentis being a louseadapted clone of either B. duttonii or a common ancestor. Again, the narrow ecological niche of B. recurrentis suggests that this spirochaete has recently evolved. Certainly these spirochaetes, unlike other relapsing fever spirochaetes, have no as yet identified alternative animal reservoirs. They have been largely refractory to in vivo investigation, requiring primate models to mimic human disease, and thus remain sadly unstudied. This is in stark contrast to other relapsing fever spirochaetes that have mammalian natural reser-
voirs, typically small rodents. Whether reported differences in clinical presentation between B. recurrentis and B. duttonii are associated with their different vector transmission, host immunological susceptibility, or clonally associated virulence factors remains to be elucidated. It is likely that the dilemma of whether or not these represent different species will not be fully resolved until full genomic sequencing becomes available.
References Assous, M.V., Wilamowski, A., Bercovier, H., Marva, E., 2006. Molecular characterization of tickborne relapsing fever Borrelia, Israel. Emerg. Infect. Dis. 12, 1740–1743. Barbour, A., 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J. Biol. Med. 57, 521–525. Brahim, H., Perrier-Gros-Claude, J., Postic, D., Baranton, G., Jambou, R., 2005. Identifying relapsing fever Borrelia, Senegal. Emerg. Infect. Dis. 11, 474–475. Bunikis, J., Luke, C.J., Bunikiene, E., Bergstro¨m, S., Barbour, A.G., 1998. A surface-exposed region of a novel outer membrane protein (P66) of Borrelia spp. is variable in size and sequence. J. Bacteriol. 180, 1618–1623. Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., Barbour, A.G., 2004a. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150, 1741–1755. Bunikis, J., Tsao, J., Garpmo, U., Berglund, J., Fish, D., Barbour, A., 2004b. Typing of Borrelia relapsing fever group strains. Emerg. Infect. Dis. 10, 1661–1664. Cutler, S.J., Fekade, D., Hussein, K., Knox, K.A., Melka, A., Cann, K., Emilianus, A.R., Warrell, D.A., Wright, D.J., 1994. Successful in-vitro cultivation of Borrelia recurrentis. The Lancet 343, 242.
ARTICLE IN PRESS 202
S.J. Cutler et al. / International Journal of Medical Microbiology 298 (2008) S1, 193–202
Cutler, S., Moss, J., Fukunaga, M., Wright, D., Fekade, D., Warrell, D., 1997a. Borrelia recurrentis characterization and comparison with relapsing-fever, Lyme-associated, and other Borrelia spp. Int. J. Syst. Bacteriol. 47, 958–968. Cutler, S.J., Moss, J., Fukunaga, M., Wright, D.J., Fekade, D., Warrell, D., 1997b. Borrelia recurrentis characterization and comparison with relapsing-fever, Lyme-associated, and other Borrelia spp. Int. J. Syst. Bacteriol. 47, 958–968. Cutler, S.J., Akintunde, C.O., Moss, J., Fukunaga, M., Kurtenbach, K., Talbert, A., Zhang, H., Wright, D.J., Warrell, D.A., 1999. Successful in vitro cultivation of Borrelia duttonii and its comparison with Borrelia recurrentis. Int. J. Syst. Bacteriol. 49, 1793–1799. Fukunaga, M., Ushijima, Y., Aoki, L., Talbert, A., 2001. Detection of Borrelia duttonii, a tick-borne relapsing fever agent in central Tanzania, within ticks by flagellin genebased nested polymerase chain reaction. Vector Borne Zoonotic Dis 1, 331–338. Kisinza, W.N., McCall, P.J., Mitani, H., Talbert, A., Fukunaga, M., 2003. A newly identified tick-borne Borrelia species and relapsing fever in Tanzania. The Lancet 362, 1283–1284. Nordstrand, A., Bunikis, I., Larsson, C., Tsogbe, K., Schwan, T.G., Nilsson, M., Bergstro¨m, S., 2007. Tickborne relapsing fever diagnosis obscured by malaria, Togo. Emerg. Infect. Dis. 13, 117–123. Pennington, P.M., Cadavid, D., Barbour, A.G., 1999. Characterization of VspB of Borrelia turicatae, a major outer membrane protein expressed in blood and tissues of mice. Infect. Immun. 67, 4637–4645.
Porcella, S.F., Raffel, S.J., Schrumpf, M.E., Schriefer, M.E., Dennis, D.T., Schwan, T.G., 2000. Serodiagnosis of louseborne relapsing fever with glycerophosphodiester phosphodiesterase (GlpQ) from Borrelia recurrentis. J. Clin. Microbiol. 38, 3561–3571. Ras, N., Lascola, B., Postic, D., Cutler, S., Rodhain, F., Baranton, G., Raoult, D., 1996. Phylogenesis of relapsing fever Borrelia spp. Int. J. Syst. Bacteriol. 46, 859–865. Schwan, T.G., Raffel, S.J., Schrumpf, M.E., Policastro, P.F., Rawlings, J.A., Lane, R.S., Breitschwerdt, E.B., Porcella, S.F., 2005. Phylogenetic analysis of the spirochetes Borrelia parkeri and Borrelia turicatae and the potential for tickborne relapsing fever in Florida. J. Clin. Microbiol. 43, 3851–3859. Schwan, T.G., Raffel, S.J., Schrumpf, M.E., Porcella, S.F., 2007. Diversity and distribution of Borrelia hermsii. Emerg. Infect. Dis. 13, 436–442. Scott, J.C., Wright, D.J.M., Cutler, S.J., 2005. Typing African relapsing fever spirochetes. Emerg. Infect. Dis. 11, 1722–1729. Vial, L., Diatta, G., Tall, A., Ba, E.H., Bouganali, H., Durand, P., Sokhna, C., Rogier, C., Renaud, F., Trape, J.F., 2006a. Incidence of tick-borne relapsing fever in West Africa: longitudinal study. The Lancet 368, 37–43. Vial, L., Durand, P., Arnathau, C., Halos, L., Diatta, G., Trape, J.F., Renaud, F., 2006b. Molecular divergences of the Ornithodoros sonrai soft tick species, a vector of human relapsing fever in West Africa. Microbes Infect. 8, 2605–2611.