Phylogenetic relationships among monogenean gill parasites (Dactylogyridea, Ancyrocephalidae) infesting tilapiine hosts (Cichlidae): Systematic and evolutionary implications

Molecular Phylogenetics and Evolution 38 (2006) 241–249 www.elsevier.com/locate/ympev

Phylogenetic relationships among monogenean gill parasites (Dactylogyridea, Ancyrocephalidae) infesting tilapiine hosts (Cichlidae): Systematic and evolutionary implications Laurent Pouyaud a,b, Erick Desmarais a, Marty Deveney c, Antoine Pariselle a,d,¤ a

Laboratoire Génome, Populations, Interactions, Adaptations; UMR 5171, cc 92, Université Montpellier II, Sciences et Techniques du Languedoc, Place Eugène Bataillon, 34095 Montpellier, Cedex 5, France b IRD/GAMET, B.P. 5095, 34033 Montpellier Cedex 1, France c PIRSA Aquaculture, 14th Floor, 25 Grenfell Street, P.O. Box 1625, Adelaide, SA 5001, Australia d IRD—CRH, Rue Jean Monnet, B.P. 171, 34203 Sète Cedex, France Received 5 April 2005; revised 16 August 2005; accepted 23 August 2005 Available online 7 October 2005

Abstract We studied the systematics of 14 species of monogenean (Ancyrocephalidae) gill parasites from West African tilapiine hosts (Cichlidae) using both morphological and genetic data. With these tools, we were able to: (i) conWrm the validity of the previously described morphological parasite species and of the genus Scutogyrus; (ii) propose that some stenoxenous species (i.e., parasite species with more than one host) may be composed of sister species (e.g., Cichlidogyrus tilapiae); (iii) state that the use of the morphology of the haptoral sclerites is more suitable to infer phylogenetic relationships than the morphology of the genitalia (which seems to be more useful to resolve species-level identiWcations, presumably because of its faster rate of change). These results imply that: (i) the speciWcity of these monogenean parasites is greater than initially supposed (what were thought to be stenoxenous species may be assemblages of oïoxenous sister species); (ii) related species groups (i.e., “tilapiae,” “halli,” and “tiberianus”) have to be, as genus Scutogyrus, validated within the 54 ancyrocephalid species described from 18 species of tilapiine hosts in West Africa, (iii) the group “tilapiae,” due to its morphology and host range, have to be considered as being the most primitive; (iv) the occurrence of lateral transfers and parallel speciation processes are necessary to describe the repartition of the newly described parasite groups on the three host genera studied (Tilapia, Oreochromis, and Sarotherodon).  2005 Elsevier Inc. All rights reserved. Keywords: Monogenea; Phylogenetic analyses; rDNA; Systematic; Cichlid Wshes; West Africa

1. Introduction Several analyses of coevolutionary processes in parasites have been conducted (Baverstock et al., 1985; Boeger and Kristky, 1997; Caira and Jensen, 2001; Desdevises et al., 2002; Hafner and Nadler, 1988, 1990; Hafner et al., 1994; Hoberg and Klassen, 2002; Klassen and Beverley-Burton, 1987; Rannala, 1992; Sinnappah et al., 2001; Verneau et al.,

*

Corresponding author. Fax: +33 4 99 57 32 95. E-mail address: [email protected] (A. Pariselle).

1055-7903/$ - see front matter  2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2005.08.013

1997). Surprisingly, none have been performed on the monogeneans of cichlid Wshes, one of the most dramatic examples of speciation and diversiWcation in vertebrate hosts (Galis and Metz, 1998). Within the Cichlidae, the tilapiine Wshes [namely tilapia sensu lato formed by species of Tilapia (Smith, 1840), Sarotherodon (Rüppell, 1852), and Oreochromis (Günther, 1889) (cf. Trewavas, 1983)] is indisputably the host species group that displays the greatest diversity and complexity in its parasite community. In a taxonomic revision of gill parasites of West African cichlids, Pariselle (1996) listed more than 50 species representing only two genera, Cichlidogyrus

242

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

(Paperna, 1960) and Scutogyrus (Pariselle and Euzet, 1995a) (Table 1). Parasite communities on respective hosts display noteworthy richness (more than Wve per host species), but species are unequally distributed among hosts [e.g., Tilapia cessiana (Thys van den Audenaerde, 1968) is infested by only one monogenean species while 17 were described from Tilapia guineensis (Bleeker, 1962)]. The host-speciWcity of these parasites, moreover, is also highly variable with 31 oïoxenous and 19 stenoxenous species [e.g., within Tilapia, eight host species are infested by Cichlidogyrus cubitus (Dossou, 1982) while Sarotherodon occidentalis (Daget, 1962) is infested by six parasite species which infest only that host]. These observations in addition to the morphological variability, the wide range of host-speciWcity and community richness on any single host species, raise numerous questions concerning the validity of the species and genus concepts for these parasites. These parasite communities also suggest possible parallel speciation events in this host– parasite association, probably shaped by a complex evolutionary process of the host Wshes. The aim of this paper is to describe the phylogenetic relationships between the monogenean parasites (Ancyrocephalidae) infesting West African tilapias, using two complementary approaches: a morphologic study based on anatomical diVerences (measurements of sclerotised parts in the haptor and the copulatory complex) and a molecular one, using DNA sequence data from nuclear ribosomal clusters (18S rDNA and ITS1, the Wrst internal transcribed spacer region). Congruence between the phylogenies inferred with the two methods will be of signiWcance in: • Validating the morphological characters traditionally used in monogenean systematics at diVerent levels and therefore to validate the “morphological” species and genera described. • ConWrming the current systematic classiWcation, using independent criteria. • Understanding the diVerent kinds of parasite host-speciWcity. Finally, the parasite phylogenies will be put in the light of well-described phylogenetic relationships of their hosts (MacAndrew and Majumbar, 1984; Rognon, 1993; Pouyaud and Agnèse, 1995; Seyoum, 1989) to assess the existence of potential parallel speciation processes. 2. Materials and methods 2.1. Parasite samples and DNA extraction Fourteen species of parasites were collected in Ivory Coast (West Africa) from Wve species of tilapia to determine molecular and morphological phylogenies (Table 2). Fish were dissected immediately after capture and the gill arches were frozen in liquid nitrogen. SpeciWc identity of host Wshes was determined using keys in Lévêque et al.

(1992). After a rapid thaw, the parasites were detached from the gills using a strong water current and preserved immediately in 70% ethanol. Each parasite specimen was then identiWed following the staining procedures and using the keys in Pariselle (1996). Each individual parasite was returned to 70% ethanol for further molecular procedures. Total DNA was extracted from these specimens using the hexa-decyl-methyl-ammonium bromide method (Doyle and Doyle, 1987). 2.2. Phylogenetic analysis from morphological data Morphological relationships were determined for the 14 parasite species from tilapiine hosts that were also studied by molecular methods. Measurements are those proposed by Gussev (1962) and refer to haptoral and reproductive sclerotised parts. The method of numbering sclerotised haptoral components is that adopted at ICOPA IV (Euzet and Prost, 1981) and the terminology used is described in Pariselle and Euzet (1995b). For each “morphological” species, measurements (see, for example, Pariselle and Euzet, 1996) were performed on 10 specimens [except for C. anthemocolpos (Dossou, 1982), C. lagoonaris (Paperna, 1969), C. njinei (Pariselle et al., 2003), and C. quaestio (Douëllou, 1993), which where not found in this study, for those species data were derived from original descriptions (Dossou, 1982; Paperna, 1969; Pariselle et al., 2003a; Douëllou, 1993)]. Morphometrical similarities among the 14 genetically studied species were assessed using Euclidean distances computed from measurements. 2.3. DNA ampliWcation and sequencing A large portion of the ribosomal cluster was ampliWed into two contiguous pieces using two pairs of primers. Three primers were designed from the sequence of Gyrodactylus salaris (Malmberg, 1957) (Monogenea, Gyrodactylidae) (see Cunningham et al., 1995): on the 18S rDNA side ATCCAAGGAAGGCAGCAGG (420–438, light strand of G. salaris) used in combination with ACGGGCGGTGTGT ACAAAG (1797–1815 heavy strand), and on the 28S side, TCGCTACTACCGATTGAATG (1815–1834, light strand) used with GTTAGTTTCTTTTCCTCCGC (3229–3248 heavy strand), the latter designed from conserved regions of a sequence alignment containing Schistosoma sp. (Trematoda, Schistosomatidae) (see Littlewood and Johnston, 1995), Caenorhabditis elegans (Maupas, 1900) (Nematoda, Rhabditidae) (see Ellis et al., 1986), and Trichomonas tenax (Muller, 1773) (Trichomonada, Trichomonadidae) (see Fukura et al., 1996). PCR ampliWcations were performed on about 20 ng of DNA in 1£ PCR buVer containing 2 mM MgCl2, 1
M primers (each), 200
M dNTPs (each), 2 U Taq polymerase (Promega), and distilled water to a Wnal volume of 50
l. The mixture was overlaid with mineral oil and subjected to 30 cycles of 92 °C for 1 min, 58 °C for 1 min, and 72 °C for

Table 1 West African cichlid host and related gill parasite species (C., Cichlidogyrus; S., Scutogyrus) Sarotherodon

aureus

niloticus

mossambicus

caudomarginatus

galilaeus

melanotheron

occidentalis

C. halli C. thurstonae C. tilapiae S. longicornis

C. cirratus C. halli C. thurstonae C. rognoni C. tilapiae S. longicornis

C. acerbus C. sclerosus C. halli S. chikhii

C. giostrai

C. douellouae C. halli C. tilapiae S. bailloni

C. acerbus C. lagoonaris C. halli C. halinus S. minus

C. bouvii C. fontanai C. halli C. guirali C. paganoi C. sanjeani S. ecoutini

brevimanus

busumana

buttikoferi

cabrae

cessiana

dageti

guineensis

louka

mariae

walteri

zillii

C. albareti C. hemi C. digitatus

C. aegypticus C. arthracanthus C. cubitus C. tiberianus

C. cubitus C. nuniesi C. bonhommei C. slembroucki

C. berradae C. legendrei C. lemoallei C. reversati

C. nuniesi

C. aegypticus C. arthracanthus C. cubitus C. digitatus C. ergensi C. Xexicolpos C. microscutus C. ornatus C. tiberianus C. yanni

C. agnesei C. anthemocolpos C. arthracanthus C. berradaae C. bilongi C. cubitus C. digitatus C. dossoui C. ergensi C. Xexicolpos C. gallus C. kouassii C. louipaysani C. microscutus C. tiberianus C. vexus C. yanni

C. aegypticus C. amphoratus C. cubitus C. digitatus C. dossoui C. ergensi C. yanni

C. cubitus C. dossoui C. testiWcatus C. yanni

C. aegypticus C. arthracanthus C. cubitus C. digitatus C. ergensi C. gallus C. tiberianus C. yanni

C. aegypticus C. anthemocolpos C. arthracanthus C. cubitus C. digitatus C. ergensi C. ornatus C. tiberianus C. vexus C. yanni

Tilapia

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

Oreochromis

243

244

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

Table 2 Species and origin of samples from Ivory Coast (n, number of specimens studied for genetic analysis) Monogenean species or population

Host

Locality

n

EMBL Accession No.

C. acerbus (Dossou, 1982) C. aegypticus (Ergens, 1981) C. agnesi (Pariselle and Euzet, 1995a) C. bilongi (Pariselle and Euzet, 1995a) C. cubitus (Dossou, 1982) C. digitatus (Dossou, 1982) C. Xexicolpos (Pariselle and Euzet, 1995a) C. gallus (Pariselle and Euzet, 1995a) C. halli 2 (Price and Kirk, 1967) C. halli 1 (Price and Kirk, 1967) C. halli 1 (Price and Kirk, 1967) C. halli 3 (Price and Kirk, 1967) C. halli 3 (Price and Kirk, 1967) C. tiberianus (Paperna, 1960) C. tilapiae 3 (Paperna, 1960) C. tilapiae 1 (Paperna, 1960) C. tilapiae 2 (Paperna, 1960) C. thurstonae (Ergens, 1981) S. bailloni (Pariselle and Euzet, 1995a) S. minus (Dossou, 1982)

S. melanotheron (Rüppel, 1852) T. zillii (Gervais, 1848) T. guineensis (Bleeker, 1962) T. guineensis (Bleeker, 1962) T. guineensis (Bleeker, 1962) T. guineensis (Bleeker, 1962) T. guineensis (Bleeker, 1962) T. guineensis (Bleeker, 1962) O. niloticus (L.) S. galilaeus (L.) S. galilaeus (L.) S. melanotheron (Rüppel, 1852) S. melanotheron (Rüppel, 1852) T. guineensis (Bleeker, 1962) S. galilaeus (L.) S. galilaeus (L.) S. galilaeus (L.) O. niloticus (L.) S. galilaeus (L.) O. niloticus (L.)

Ebrié lagoon Kossou dam Ebrié lagoon Ebrié lagoon Ebrié lagoon Ebrié lagoon Ebrié lagoon Ebrié lagoon Kossou dam Kossou dam Comoé River Comoé River Ebrié lagoon Ebrié lagoon Kossou dam Comoé River Comoé River Kossou dam Kossou dam Kossou dam

4 2 1 2 5 4 2 2 7 3 4 1 5 3 2 3 2 4 2 4

AJ920270 AJ920282 AJ920286 AJ920287 AJ920278 AJ920284 AJ920283 AJ920285 AJ920272 AJ920273 AJ920273 AJ920271 AJ920271 AJ920281 AJ920275 AJ920276 AJ920277 AJ920274 AJ920280 AJ920279

1.5 min. PCR incubations were carried out in a programmable thermocycling block (PTC-100, MJ Research). AmpliWed DNA fragments were puriWed with Gene-Clean II kit (Bio 101) and both strands were sequenced using Xuorescent-labelled primers and Thermo-Sequenase sequencing kit (Amersham Biosciences). Sequencing conditions consisted of an initial denaturation at 95 °C for 4.5 min followed by 25 cycles at 95 °C for 30 s, and 60 °C for 30 s. Products were run out on a denaturing 6% acrylamide gel (Bio-Rad) and visualised on an ALF automated sequencer (Amersham Biosciences).

The same alignments of sequences were analysed with a maximum likelihood method using the PHYML package (Guindon and Gascuel, 2003). The maximum likelihood tree was calculated with the same model of evolution as in the neighbor joining analysis except that the Gamma parameter was set to 4. These phylogenies were tested with 100 bootstrap replicates. 3. Results 3.1. Phylogenetic analysis from morphological data of the 14 genetically studied species

2.4. Phylogenetic analysis from DNA sequences Sequences of both strands were compared and aligned manually to the aforementioned available sequences using the sequence editor GENEDOC (Nicholas et al., 1997). Smaller sequences of other dactylogyrid Monogenea were recovered in GenBank to be used as outgroup in the phylogeny reconstructions (Kimková et al., 2003): Urocleidus similis (Mueller, 1936), Thaparocleidus vistulensis (Sivak, 1932), T. siluri (Zandt, 1924), Cleidodiscus pricei (Mueller, 1936), and Ancyrocephalus percae (Ergens, 1966). Two sets of data were then used: the Wrst (383 bp long) corresponding to the part of the sequence shared by all the species including the outgroups and the second (1640 bp long) corresponding to the maximum number of common nucleotide sites in the species we sequenced. The package MEGA ver.2.1 (Kumar et al., 2001) was used to reconstruct phylogenies with the neighbor joining method. The substitution model used the distance of Tamura and Nei (1993) with Gamma distributed variation rates among sites (Gamma Parameter: 2.0). The phylogenies were tested with 1000 bootstrap replicates.

Many authors consider that haptoral and genital functional apparatus are subject to distinct selective constraints (Guégan and Lambert, 1990; El Gharbi et al., 1993; Van Every and Kritsky, 1992). For this reason, data from these two apparatus have been treated independently and two separate dendrograms of morphological similarity were computed from the haptoral and the genital euclidian distance matrices. These two dendrograms show clear diVerences in their topologies: for example, species belonging to Scutogyrus S. minus (Dossou, 1982) and S. bailloni (Pariselle and Euzet, 1995a) are grouped in a clade that is distinct from other species belonging to Cichlidogyrus in “haptoral” phylogeny (Fig. 1A), whereas they are markedly separated in the “genital” tree (Fig. 1B). 3.2. Phylogenetic analysis from DNA sequences For each species, about 1670 bp of new sequence was determined, corresponding to the last three quarters of the 18S gene with a gap of 134 bp around the central primer

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

A

50

C. acerbus

40

30

20

10

245

B

C. acerbus

C. cubitus

C. tilapiae

C. digitatus

C. digitatus

C. tilapiae

C. aegypticus

C. aegypticus

C. gallus

C. flexicolpos C. gallus

C. tiberianus S. minus

C. agnesi

C. thurstonae

C. bilongi

C. halli

C. thurstonae

C. cubitus

C. tiberianus

C. flexicolpos

S. bailloni

C. bilongi

S. minus

S. bailloni

C. halli

C. agnesi

0

50

40

30

20

10

0

Fig. 1. Trees built from haporal (A) and genital (B) sclerite morphological data.

location (position 1734–1867 on G. salaris) and about 300 bp of the ITS1. Of these sequences, only 383 bp from the end of the 18S to the beginning of the ITS1 were shared with the sequences found in GenBank and aligned with them. This alignment was used to place a root on the phylogeny of our species group. Whole sequences were also used to resolve the phylogenetic relationships between the species. For the two sets of data, distance analysis using the neighbor joining method and maximum likelihood analysis with PHYML gave either identical or compatible topologies, but with diVerent bootstrap values. We chose to present only the maximum likelihood trees because of the better accuracy of this model-based method for analysing poorly resolved phylogenies.

C. thurstonae 52 C. tiberianus

C. aegypticus C. flexicolpos S. bailloni 47

S. minus

78

C. agnesi C. gallus C. bilongi

24

C. acerbus C. tilapiae 1 C. tilapiae 2

3.3. Rooted phylogeny (Fig. 2)

100

C. digitatus

38

C. tilapiae 3

The very low number of variable sites examined in this analysis (95 over 383) resulted in weak resolution and bootstrap values within the species group under examination. Consequently, the position of the root is not robust, but two groups display high nodal support, one containing the three lineages of C. halli (Price and Kirk, 1967) from diVerent host species (named “halli” group) and one containing S. minus and S. bailloni (named “scutogyrus” group). Several species, however, do have the same sequence over this small and conserved region [e.g., C. tiberianus (Paperna, 1960)/C. aegypticus (Ergens, 1981)/C. thurstonae (Ergens, 1981) or C. gallus (Pariselle and Euzet, 1995a)/C. agnesi (Pariselle and Euzet, 1995a)/ C. bilongi (Pariselle and Euzet, 1995a)]. 3.4. Whole sequence phylogeny (Fig. 3) Over the 1664 positions of the alignment of the complete sequences, 187 were variable between species. Most sequences are identical in all the individuals of a single “morphological” species (Table 2), but two species have several diVerent sequences: we found three diVerent “genetic” C. halli in a sample of 20 individuals originat-

C. cubitus C. halli 1 84

C. halli 2

60

C. halli 3

100 T. siluri

T. vistulensis C. pricei A. percae

100 97

U. similis

0.02

Fig. 2. Maximum likelihood tree of the partial sequence data set (383 bp) including outgroup species.

ing from diVerent locations/hosts and three diVerent “genetic” C. tilapiae collected in two places. The Tamura–Nei distances (Table 3) appeared to be very low since

246

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

The phylogeny built from this data set conWrms the existence of two monophyletic groups found in the precedent tree (Fig. 2): “halli” (bootstrap 100 %) and “scutogyrus” (bootstrap 100%). The relationships between the other species are clariWed with a better resolution of the internal branches leading to higher bootstrap values. Especially, the existence of three diVerent lineages within C. tilapiae is conWrmed.

C. gallus

94

C. agnesi

31

C. flexicolpos 64 13

C. bilongi

72

C. aegypticus 52

C. thurstonae

30

4. Discussion

C. tiberianus S. bailloni

66 100

61

4.1. Morphological versus molecular species concept

S. minus C. cubitus

C. digitatus 60

C. tilapiae 3 C. tilapiae 1 C. tilapiae 2

59

C. acerbus C. halli 1

45

C. halli 2

100 100

C. halli 3

0.005

Fig. 3. Maximum likelihood tree built from total sequences (1664 bp).

they were calculated from sequences that encompass a large part of the highly conserved 18S gene. They range from 0.001 between C. gallus and C. agnesi to 0.053 between C. tilapiae 1 and C. halli 2 or C. halli 3.

The topologies of the ribosomal sequences trees indicate that the morphological species C. tilapiae (Paperna, 1960) seems to be genetically polyphyletic, even if these observations are not supported by strong bootstrap values. Moreover, a genetic distance of 0.043 is observed between two specimens of C. tilapiae 3 collected on S. galilaeus (L., 1758) from the Kossou Dam and three specimens of C. tilapiae 1 collected on S. galilaeus from Comoé River, while a distance of only 0.026 is observed between C. tilapiae 3 and C. cubitus. The average genetic distances observed between species in this study indicate that C. tilapiae may comprise a species complex of closely morphologically related taxa. Within the “halli” group, which is also composed of three distinct genetic lineages, the distances are smaller: d D 0.007 (11 nucleotidic substitutions) between C. halli 1 collected on S. galilaeus from Comoé River (4 individuals) or Kossou Dam (n D 3) and specimens of C. halli 2 collected on O. niloticus (L., 1758) from Kossou Dam (n D 7), d D 0.007 between the same C. halli 1 and C. halli 3 collected on S. melanotheron (Rüppel, 1852) from Ebrié lagoon (n D 5) and Comoé River (n D 1), d D 0.004 between C. halli 2 and C. halli 3 (seven nucleotide substitutions). Therefore,

Table 3 Matrix of genetic distances (number of diVerences between pairs of species above the diagonal and Tamura–Nei distances below) 1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

C. acerbus C. halli 3 C. halli 2 C. halli 1 C. thurstonae C. tilapiae 3 C. tilapiae 1 C. tilapiae 2 C. cubitus S. minus S. bailloni C. tiberianus C. aegypticus C. Xexicolpos C. digitatus C. gallus C. agnesi C. bilongui

0.038 0.038 0.036 0.032 0.037 0.041 0.024 0.034 0.032 0.034 0.032 0.033 0.033 0.033 0.034 0.033 0.034

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

17

18

60

60 7

57 11 11

50 57 57 54

58 69 69 64 44

64 82 82 79 69 68

38 62 62 57 48 50 58

54 67 67 64 35 42 67 58

50 62 62 60 32 47 65 67 58

54 67 67 65 37 52 67 65 67 8

51 57 57 56 22 44 61 67 65 31 37

52 60 60 57 13 41 74 61 67 34 39 25

52 62 62 59 13 41 72 74 61 34 39 25 8

52 65 65 63 44 41 62 72 74 42 47 44 47 46

53 60 60 57 14 42 73 62 72 35 40 28 9 7 47

52 59 59 56 13 41 72 73 62 34 39 27 8 6 46 1

54 63 63 60 18 47 75 72 73 36 41 30 17 13 51 13 12

0.004 0.007 0.036 0.044 0.053 0.040 0.043 0.039 0.043 0.036 0.038 0.040 0.042 0.038 0.038 0.040

0.007 0.036 0.044 0.053 0.040 0.043 0.039 0.043 0.036 0.038 0.040 0.042 0.038 0.038 0.040

0.034 0.041 0.051 0.036 0.041 0.038 0.041 0.036 0.036 0.038 0.040 0.036 0.036 0.038

0.028 0.044 0.030 0.022 0.020 0.023 0.014 0.008 0.008 0.028 0.009 0.008 0.011

0.043 0.031 0.026 0.030 0.033 0.028 0.026 0.026 0.026 0.026 0.026 0.030

0.037 0.043 0.041 0.043 0.039 0.048 0.046 0.040 0.047 0.046 0.048

0.033 0.031 0.034 0.030 0.033 0.032 0.028 0.032 0.032 0.033

0.022 0.024 0.022 0.024 0.024 0.032 0.026 0.025 0.027

0.005 0.019 0.021 0.021 0.026 0.022 0.021 0.022

0.023 0.024 0.024 0.030 0.025 0.024 0.026

0.015 0.015 0.028 0.017 0.017 0.019

0.005 0.030 0.006 0.005 0.010

0.029 0.004 0.004 0.008

0.030 0.029 0.032

0.001 0.008

0.007

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

we could not conclude that there are three distinct species in C. halli. 4.2. Morphological versus molecular phylogenies In all phylogenies except the tree derived from the measurements of the genital structures, the two species belonging to Scutogyrus are clearly monophyletic (Fig. 3). This congruence between phylogenies based on genetic data and the haptor morphology tend to prove that this grouping is robust. But it also suggests that, at least among monogenean parasites of tilapias, the haptor is more suitable for inferring phylogenetic relationships than the genital sclerites (which are used in resolving species-level identiWcations). This is probably the consequence of a faster rate of change over evolutionary time in the morphology of genital sclerites than in haptoral ones (see Section 3.1 above). 4.3. Consequence of the “haptoral” phylogeny validation The “haptoral” dendrogram (Fig. 1A) shows that four groups are well separated: • “halli,” clearly monophyletic but made up of three distinct lineages in the genetic tree (Fig. 3). • “scutogyrus,” validating Scutogyrus proposed by Pariselle and Euzet (1995a). • “tiberianus,” formed by C. aegypticus, C. Xexicolpos (Pariselle and Euzet, 1995a), C. gallus, C. agnesi, C. bilongi, C. thurstonae, and C. tiberianus. This group appears to be monophyletic in the genetic tree (Fig. 3), but is not well supported (bootstrap D 52). • “tilapiae” formed by C. acerbus (Dossou, 1982), C. cubitus, C. digitatus (Dossou, 1982), and C. tilapiae. This group is paraphyletic in the genetic tree (Fig. 3). This division into four groups based on morphological criterions is also supported by the genetic distances (Table 4), which are of the same order of magnitude of those obtained in other studies among a wide range of parasite groups (Adlard et al., 1993; Anderson and Barker, 1993; Bowles and MacManus, 1993; Cerbah et al., 1998; Chilton et al., 1995; Cunningham, 1997; Gasser et al., 1994; Luton et al., 1992; Stevenson et al., 1995). Therefore and by comparison with Scutogyrus, we can conclude that the “halli,” “tilapiae,” and “tiberianus” groups constitute discrete taxonomic entities which should be raised to the generic level.

Table 4 Mean genetic distance within and between groups

Genus Scutogyrus “tiberianus” group “halli” group “tilapiae” group

Genus Scutogyrus

“tiberianus” group

“halli” group

“tilapiae” group

0.005 0.023 0.041 0.032

0.009 0.038 0.032

0.006 0.043

0.034

247

4.4. SpeciWcity From the 54 Scutogyrus and Cichlidogyrus species infesting the tilapias, only 36 (66%) are oïoxenous (Table 1); so a considerable proportion infest two or more host species. The two species C. halli and C. tilapiae are reported from most of the mouthbrooder host species (Sarotherodon + Oreochromis) and appeared to constitute a group of several putative sister species or strains indistinguishable by conventional observations of morphology. Because nuclear rRNA genes are subjected to concerted evolution, all the copies of an rRNA array are usually identical within individuals and have a very low variability among species, although diVerences between species can be rapidly Wxed (Hillis and Dixon, 1991). In that way, we could reasonably deduce that the morphological “tilapiae” group represents a mix of distinct, hostspeciWc species, even if no classical genetic tools are available to demonstrate that they are reproductively isolated. In the case of the three C. halli groups: the genetic distances calculated are too small to conclude whether they are more than genetic strains. However and in spite of a relatively large collection, each one has been only found on a single Wsh species, whatever the location of sampling [C. halli 1 on S. galilaeus from Kossou Dam and Comoé River, C. halli 3 on S. melanotheron from Ebrié Lagoon, and Comoé River and C. halli 2 on O. niloticus only from the Kossou Dam (but seven individuals)]. So it seems that each genetic lineage is at least specialized on one host species suggesting that a genetic diVerentiation is on its way and might eventually lead to an alloxenic speciation. The isolation of the three strains into xeno populations seems to be eVective even when the populations are in sympatry (C. halli 1 and 2 in the Kossou Dam, C. halli 1 and 3 in the Comoé River). The occurrence of C. arthracanthus (Paperna, 1960) on numerous host species of the genus Tilapia, that are genetically distant [for example, T. zillii (Gervais, 1848) and T. busumana (Günther, 1903)], similarly suggests the possibility of the existence of numerous sister species. No parasite species observed in this study infests both mouthbrooders (genera Sarotherodon and Oreochromis) and substrate brooders (genus Tilapia). This was demonstrated by Pariselle (1996) who inferred relatedness among tilapiine host species by using parasites as independent characters, and displayed that mouthbrooders and substrate brooders are clearly separate when examined in this manner. As a consequence, the number of oïoxenous parasite species is certainly underestimated and most of the stenoxenous species (cf. C. cubitus) probably consist of an assemblage of oïoxenous species. The aim of this discussion is not to confuse the present taxonomic classiWcation with the description of numerous new molecular species, but aspires to emphasise that future investigations on the evolution or biogeography of parasites that use estimates of species richness should take into account these discoveries.

248

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249

4.5. Lateral transfers When considering phylogenetic relatedness and the type host of parasite species, the occurrence of parasite capture or host transfer cannot be neglected and probably occurs regularly. This type of transfer is currently reported in artiWcial conditions even between phylogenetically distant host species (see, for example, Pariselle et al., 2003b), revealing that the physiological traits of hosts are insuYcient to entirely explain parasite host-speciWcity. In natural conditions, lateral transfers could also arise (Bakke et al., 2002), especially when hosts hybridize (see Dupont and Crivelli, 1988). For example, C. thurstonae was the only species belonging to the phylogenetic “tiberianus” group which possesses an auxiliary plate in the genital complex and which infests a mouthbrooder host. All other species in this group were described from substrate brooders. Due to its morphological and genetic proximity to C. aegypticus (d D 0.008), described only from Tilapia spp., we could suppose that an ancestral form of C. thurstonae that shared many characters with the “tiberianus” group colonized a mouthbrooder host through a recent capture or host transfer event. This probably occurred on the common ancestor of O. niloticus and O. aureus (Steindachner, 1864) which has been proposed to have diverged in the late Pleistocene (Rognon, 1993). 4.6. Parallel speciation processes? The phylogenies, inferred from molecular and morphological data, revealed the existence of distinct monogenean species groups. Two of them infest only mouthbrooder tilapiine host species: cf. “scutogyrus” and “halli” groups. Both remaining groups, “tiberianus” and “tilapiae,” display higher species richness and infest both mouth- and substrate brooders. In the “tilapiae” group, however, the parasite species are equally distributed between mouth- and substrate brooders while in the “tiberianus” group they infest mainly substrate brooders (79%) (Table 1). As has been suggested of C. thurstonae, four species [namely C. paganoi (Pariselle and Euzet, 1997), C. guirali (Pariselle and Euzet, 1997), C. douellouae (Pariselle et al., 2003), and C. bouvii (Pariselle and Euzet, 1997)] belonging to the latter group probably colonized their mouthbrooder host species through lateral transfer events. Phylogenies of cichlids demonstrate that Tylochromis (Regan, 1920), Hemichromis (Peters, 1858), Chromidotilapia (Boulenger, 1898), and Pelmatochromis (Steindachner, 1895) are sister groups of the Tilapiines (Stiassny, 1991), and diverged between Wve and ten million years before present, through successive radiations of substrate and mouthbrooder species (Klett, 1999; Klett and Meyer, 2002; MacAndrew and Majumbar, 1984; Pouyaud and Agnèse, 1995). All species of Cichlidogyrus that are described from the sister groups of Tilapiines (i.e., the Tylochromiines, Hemichromiines, and Pelmatochromiines) display morphological characteristics similar to those belonging to the “tilapiae” group. The “tilapiae” group is also the most

diverse in terms of species richness and range of host genera infested, so we may also suppose that this species group possesses the most primitive haptoral features compared to the other four groups. The Scutogyrus, “halli,” and “tiberianus” groups, consequently, must be considered more recent lineages, characterized by more highly derived haptoral morphologies. Acknowledgment We are grateful to J.F. Agnèse and F. Duponchelle for their assistance in obtaining samples. References Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993. Comparison of the second internal transcribed spacer (Ribosomal DNA) from populations and species of fasciolidae (Digenea). Int. J. Parasitol. 23, 423–425. Anderson, G.R., Barker, S.C., 1993. Species diVerentiation in the didymozoidae (Digenea): restriction fragment length diVerences in internal transcribed spacer and 5.8S ribosomal DNA. Int. J. Parasitol. 23, 133–136. Bakke, T.A., Harris, P.D., Cable, J., 2002. Host speciWcity dynamics: observations on gyrodactylid monogeneans. Int. J. Parasitol. 32, 281–308. Baverstock, P.R., Adams, M., Beveridge, I., 1985. Biochemical diVerentiation in bile duct cestodes and their marsupial hosts. Mol. Biol. Evol. 2, 321–337. Boeger, W.A., Kristky, D.C., 1997. Coevolution of the Monogenoidea (Platyhelminthes) based on a revised hypothesis of parasite phylogeny. Int. J. Parasitol. 27, 1495–1511. Bowles, J., MacManus, D.P., 1993. Molecular variation in Echinococcus. Acta Tropica 53, 291–305. Caira, J.N., Jensen, K., 2001. An investigation of the co-evolutionary relationships between onchobothriid tapeworms and their elasmobranch hosts. Int. J. Parasitol. 31, 960–975. Cerbah, M., Souza-Chies, T., Jubier, M.F., Lejeune, B., Siljak-Yakovlev, S., 1998. Molecular phylogeny of the genus Hypochaeris using internal transcribed spacers of nuclear rDNA: inference for chromosomal evolution. Mol. Biol. Evol. 15, 345–354. Chilton, N.B., Gasser, R.B., Beveridge, I., 1995. DiVerences in a ribosomal DNA sequence of morphologically indistinguishable species within the Hypodontus macropi complex (Nematoda: Strongyloidea). Int. J. Parasitol. 25, 647–651. Cunningham, C.O., 1997. Species variation within the internal transcribed spacer (ITS) region of Gyrodactylus (Monogenea: Gyrodactylidae) ribosomal RNA genes. J. Parasitol. 83, 215–219. Cunningham, C.O., MacGillivray, D.M., MacKenzie, K., 1995. Phylogenetic analysis of Gyrodactylus salaris Malmberg, 1957 based on the small subunit (18S) robosomal RNA gene. Mol. Biochem. Parasitol. 71, 139–142. Desdevises, Y., Morand, S., Jousson, O., Legendre, P., 2002. Coevolution between Lamellodiscus (Monogenea: Diplectanidae) and Sparidae (Teleostei): the study of a complex host–parasite system. Evolution 56, 2459–2471. Dossou, C., 1982. Parasites de Poissons d’eau douce du Bénin III. Espèces nouvelles du genre Cichlidogyrus (Monogenea) parasites de Cichlidae. Bull. I.F.A.N. 44, 295–322. Douëllou, L., 1993. Monogeneans of the genus Cichlidogyrus Paperna, 1960 (Dactylogyridae: Ancyrocephalinae) from cichlid Wshes of Lake Kariba (Zimbabwe) with descriptions of Wve new species. Syst. Parasitol. 25, 159–186. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15. Dupont, F., Crivelli, A.J., 1988. Do parasites confer a disadvantage to hybrids? A case study of Alburnus alburnus £ Rutilus rubilio, a natural hybrid of Lake Mikri Prespa, Northern Greece. Oecologica (Berlin) 75, 587–592. Ellis, R.E., Sulston, J.E., Coulson, A.R., 1986. The rDNA of C. elegans: sequence and structure. Nucleic Acids Res. 14, 2345–2364.

L. Pouyaud et al. / Molecular Phylogenetics and Evolution 38 (2006) 241–249 El Gharbi, S., Lambert, A., Berrebi, P., 1993. Le genre Barbus (sous-genre Barbus et Labeobarbus) au Maroc. Génétique et Parasitologie. Cah. Ethol. 13, 223–226. Euzet, L., Prost, M., 1981. Report of the meeting on Monogenea: problems of systematics, biology and ecology. In: Slusarski, W. (Ed.), Review of Advances in Parasitology. P.W.N. Polish ScientiWc Publishers, Warsaw, pp. 1003–1004. Fukura, K., Yamamoto, A., Hashimoto, T., Goto, N., 1996. Nucleotide sequence of the SrRNA gene and phylogenetic analysis of Trichomonas tenax. Microbiol. Immunol. 40, 183–188. Galis, F., Metz, J.A.J., 1998. Why are there so many cichlid species? TREE 13, 7–8. Gasser, R.B., Chilton, N.B., Hoste, H., Stevenson, L.A., 1994. Species identiWcation of trichostrongyle nematodes by pcr-linked rXp. Int. J. Parasitol. 24, 291–293. Guégan, J.-F., Lambert, A., 1990. Twelve new species of dactylogyrids (Platyhelminthes, Monogenea) from West African barbels (Teleostei, Cyprinidae), with some biogeographical implications. Syst. Parasitol. 17, 153–181. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52, 696–704. Gussev, A.V., 1962. In: Bychovskaya-Pavlovskaya, I.E., et al. (Eds.) Key to Parasites of Freshwater Fish of the USSR. Moscow–Leningrad: Academiya Nauk SSSR, 919 pp. (in Russian: English translation IPST, Ser. No. 1136, Jerusalem, 1964). Hafner, M.S., Nadler, S.A., 1988. Phylogenetic trees support the coevolution of parasites and their hosts. Nature 332, 258–259. Hafner, M.S., Nadler, S.A., 1990. Cospeciation in host–parasite assemblages: comparative analysis of rates of evolution and timing of cospeciation events. Syst. Zool. 39, 192–204. Hafner, M.S., Sudman, P.D., Villablanca, F.X., Spradling, T.A., Demastes, J.W., Nadler, S.A., 1994. Disparate rates of molecular evolution in cospeciating hosts and parasites. Science 265, 1087–1090. Hillis, D.M., Dixon, M.T., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 411–453. Hoberg, E.P., Klassen, G.J., 2002. Revealing the faunal tapestry: co- evolution and historical biogeography of hosts and parasites in marine systems. Parasitology 124, S3–S22. Klassen, G.J., Beverley-Burton, M., 1987. Phylogenetic relationships of Ligictaluridus spp. (Monogenea: Ancyrocephalidae) and their Ictalurid (Siluriformes) hosts: an hypothesis. P. Helm. Soc. Wash. 54, 84–90. Klett, V., 1999. Molekulare Phylogenie der Tilapiinen (Pisces: Cichlidae). Diplomarbeit der Fakultät für Biologie, Universität Konstanz, 154 pp. Klett, V., Meyer, A., 2002. What, if anything, is a Tilapia.—mitochondrial ND2 phylogeny of Tilapiines and the evolution of parental care systems in the African Cichlid Wshes. Mol. Biol. Evol. 19, 865–883. Kumar, S., Tamura, K., Jakobsen, I.B., Nei, M., 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17, 1244–1245. Lévêque, C., Paugy, D., Teugels, G., 1992. Faune des poissons d’eaux douces et saumâtres de l’Afrique de l’Ouest. Tome 2. Faune Tropical 28, 1–902. Littlewood, D.T.J., Johnston, D.A., 1995. Molecular phylogenetics of the four Schistosoma species groups determined with partial 28S ribosomal RNA gene sequences. Parasitology 111, 167–175. Luton, K., Walker, D., Blair, D., 1992. Comparisons of ribosomal internal transcribed spacers from two congeneric species of Xukes (Platyhelminthes: Trematoda: Digenea). Mol. Biochem. Parasitol. 56, 323–327. MacAndrew, B.J., Majumbar, K.C., 1984. Evolutionary relationships within three tilapiine genera (Pisces: Cichlidae). Zool. J. Linn. Soc. 80, 421–435. Nicholas, K.B., Nicholas Jr., H.B., DeerWeld II, D.W., 1997. GeneDoc: analysis and visualization of genetic variation, EMBNEW. NEWS 4, 14. Paperna, I., 1969. Monogenetic Trematodes of the Wsh of the Volta basin and South Ghana. Bull. l’I.F.A.N. 31, 840–880. Pariselle, A., 1996. Diversité, spéciation et évolution des Monogènes branchiaux de Cichlidae en Afrique de l’Ouest. Ph.D. Thesis, University of Perpignan. Pariselle, A., Euzet, L., 1995a. Gill parasites of the genus Cichlidogyrus Paperna, 1960 (Monogenea, Ancyrocephalidae) from Tilapia guineensis (Bleeker, 1862), with descriptions of six new species. Syst. Parasitol. 30, 187–198.

249

Pariselle, A., Euzet, L., 1995b. Scutogyrus n. g. (Monogenea, Ancyrocephalidae) for Cichlidogyrus longicornis minus Dossou, 1982, C. longicornis and C. 1. gravivaginus Paperna and Thurston, 1969, with descriptions of three new species parasitic on African Cichlids. J. Helminthol. Soc. W. 62, 157–173. Pariselle, A., Euzet, L., 1996. Cichlidogyrus Paperna, 1960 (Monogenea, Ancyrocephalidae): gill parasites from West African Cichlidae of the subgenus Coptodon Regan, 1920 (Pisces), with descriptions of six new species. Syst. Parasitol. 34, 109–124. Pariselle, A., Euzet, L., 1997. New species of Cichlidogyrus Paperna, 1960 (Monogenea, Ancyrocephalidae) from the gill parasite of Sarotherodon occidentalis (Daget) (Osteichthyes, Cichlidae) in Guinea and Sierra Leone (West Africa). Syst. Parasitol. 38, 221–230. Pariselle, A., Bilong Bilong, C.F., Euzet, L., 2003a. Four new species of Cichlidogyrus Paperna, 1960 (Monogenea, Ancyrocephalidae) all gill parasites from African mouthbreeder tilapias of the genera Sarotherodon and Oreochromis (Pisces, Cichlidae), with a redescription of C. thurstonae Ergens, 1981. Syst. Parasitol. 56, 201– 210. Pariselle, A., Morand, S., Deveney, M., Pouyaud, L., 2003b. Parasite species richness of closely related hosts: historical scenario and “genetic” hypothesis. In: Combes C. and Jourdane J. (Eds.) Taxonomie, écologie et évolution des métazoaires parasites. Taxonomy, Ecology and Evolution of Metazoan Parasites. (Livre hommage à Louis Euzet). Tome II. PUP, Perpignan, pp. 147–166. Pouyaud, L., Agnèse, J.-F., 1995. Phylogenetic relationships between 21 species of three tilapiine genera Tilapia, Sarotherodon and Oreochromis using allozyme data. J. Fish Biol. 47, 26–38. Rannala, B., 1992. Comparative evolutionary genetics of trematode parasites (Plagiorchiidae) and their anuran hosts. Can. J. Zool. 70, 993–1000. Rognon, X., 1993. Diversité génétique et relations phylogénétiques chez les tilapias (Pisces, Cichlidae): comparaison des données du polymorphisme enzymatique et mitochondrial. Thèse de l’université Paris-Sud centre d’Orsay, Paris. Seyoum, S., 1989. Stock identiWcation and the evolutionary relationships of the tilapiine Wshes of the genera Oreochromis, Sarotherodon and Tilapia (Pisces: Cichlidae) using allozyme analysis and restriction endonuclease analysis. Ph.D. Thesis, University of Waterloo, Ontario. Kimková, A., Plaisance, L., Matejusová, I., Morand, S., Verneau, O., 2003. Phylogenetic relationships of the Dactylogyridae Bychowsky, 1933 (Monogenea: Dactylogyridea): the need for the systematic revision of the Ancyrocephalinae Bychowsky, 1937. Syst. Parasitol. 54, 1–11. Sinnappah, N.D., Lim, L.H.S., Rohde, K., Tinsley, R.C., Combes, C., Verneau, O., 2001. A paedormorphic parasite associated with a neotenic Amphibian host: phylogenetic evidence suggests a revised systematic position for Sphyranuridae with Anuran and Turtle Polytomatoineans. Mol. Phylogenet. Evol. 18, 189–201. Stevenson, L.A., Chilton, N.B., Gasser, R.B., 1995. DiVerentiation of Haemonchus placei from H. contortus (Nematoda: Trichostrongylidae) by the ribosomal DNA second internal transcribed spacer. Int. J. Parasitol. 25, 483–488. Stiassny, M.L.J., 1991. Phylogenetic intrarelationships of the family Cichlidae: an overview. In: Keenleyside, M.H.A. (Ed.), Cichlid Wshes: behaviour, ecology and evolution. Chapman & Hall, pp. 1–35. Tamura, K., Nei, M., 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. Trewavas, E., 1983. Tilapiine Fishes of the Genera Sarotherodon, Oreochromis and Danakilia. Br. Mus. Nat. History, Londres. Van Every, L.R., Kritsky, D.C., 1992. Neotropical Monogenoidea. 18. Anacanthorus Mizelle and Price, 1965 (Dactylogyridae, Anacanthorinae) of Piranha (Characoidea, Serrasalmidae) from the Central Amazon, their phylogeny, and aspects of host–parasite coevolution. J. Helminthol. Soc. W. 59, 52–75. Verneau, O., Renaud, F., CatzeXis, F., 1997. Evolutionary relationships of sibling tapeworm species (Cestoda) parasiting Teleost Wshes. Mol. Biol. Evol. 14, 630–636.