Phytoceramides and acylated phytosterol glucosides from Pterospermum acerifolium Willd. seed coat and their osteogenic activity

Phytochemistry 81 (2012) 117–125

Contents lists available at SciVerse ScienceDirect

Phytochemistry journal homepage: www.elsevier.com/locate/phytochem

Phytoceramides and acylated phytosterol glucosides from Pterospermum acerifolium Willd. seed coat and their osteogenic activity q Preety Dixit a, Kailash Chand a, Mohd Parvez Khan b, Jawed Akhtar Siddiqui b, Deepshikha Tewari b, Florence Tsofack Ngueguim b, Naibedya Chattopadhyay b, Rakesh Maurya a,⇑ a b

Medicinal and Process Chemistry Division, CSIR – Central Drug Research Institute, Lucknow 226001, India Endocrinology Division, CSIR – Central Drug Research Institute, Lucknow 226001, India

a r t i c l e

i n f o

Article history: Received 16 February 2012 Received in revised form 18 May 2012 Available online 10 July 2012 Keywords: Pterospermum acerifolium Acylated phytosterol glucoside Phytoceramides Osteogenic activity Osteoblast

a b s t r a c t Phytochemical investigation of seed coats of Pterospermum acerifolium afforded two phytoceramides (1, 2) and two acylated phytosterol glucosides (3, 4) together with five known compounds (5–9). Their structures were elucidated on the basis of extensive spectroscopic analysis using 1D, 2D NMR and Mass spectrometry. Compounds 1, 2, 3, and 4 were assessed for their osteogenic activity using primary cultures of osteoblasts harvested from neonatal rat calvaria. Among these compounds, 1 and 2 markedly stimulated osteoblast differentiation assessed by alkaline phosphatase production and osteoblast mineralization by alizarin red-S staining. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction The Pterospermum acerifolium (Linn.) Willd. belongs to the family Sterculiaceae is distributed through Southeast Asia, from India to Burma. The plant is locally known as Kanak Champa. P. acerifolium has a wide application in traditional system of Indian medicine. The ethanol extract of flowers was reported to inhibit the growth of cancer cells (Balachandran and Govindrajan, 2005). Flowers and bark were known for treatment of smallpox (Caius, 1990). A number of flavonoids and their glucosides, lignans, terpenes and amino acids (Gunasegaran and Subramanian, 1979; Rizvi and Sultana, 1972; Tandon et al., 1970) have been isolated from this plant in the search of chemical constituents. Previously, we have investigated the flowers of P. acerifolium (Dixit et al., 2011) and evaluated them for osteogenic activity. The seed coat of P. acerifolium has not been chemically and pharmacologically investigated so for, thus, we have attempted to isolate compounds from seed coat and evaluated them for osteogenic activity. Osteoporosis is a leading cause of fractures in adults, characterized by progressive bone loss with attendant deterioration of bone microarchitecture. In pathophysiological terms, increased bone loss in osteoporosis is coupled with reduced formation of new bone (Alldredge et al., 2009; Kelsey, 1989). Anabolic q

CDRI Communication No. 8270

⇑ Corresponding author. Tel.: +91 522 2612411 18x4235; fax: +91 522 2623405/ 2623938/2629504. E-mail address: [email protected] (R. Maurya). 0031-9422/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.phytochem.2012.06.005

therapy, or stimulating the function of bone-forming osteoblasts, is the preferred pharmacological intervention for osteoporosis. In our effort to discover new compounds with osteogenic effect, we isolated new phytoceramides and phytosterols of P. acerifolium seed coat and evaluated them for osteogenic activity. Ceramides are sphingoid base linked to a fatty acid via an amide bond and found as traces in tissues. They are the key intermediate for the biosynthesis of all complex sphingolipids and powerful second-signal effector molecule that regulates diverse cellular processes including apoptosis, cell senescence, the cell cycle, and cellular differentiation (Ruvolo, 2003). Phytoceramides basically differ from ceramide by the origin. Dietary phytosterols inhibit intestinal cholesterol absorption and regulate whole body cholesterol excretion and balance. However, they are biochemically heterogeneous and a portion is glycosylated in some foods with unknown effects on biological activity. Phytosterol glycosides reduce cholesterol absorption in humans (Lin et al., 2009). Taken together, these properties of phytoceramides and phytosterols suggest that they may impact osteoblast activity. Herein, we report the isolation and structural elucidation of four new compounds including phytoceramides (1, 2) and acylated phytosterol glucosides (3, 4) (Fig. 1) along with five known compounds from the seed coat of P. acerifolium. New compounds (1, 2, 3 and 4) were evaluated for their osteogenic activity using neonatal (1–3 days old) rat calvaria derived primary osteoblast cultures. Compound 1 and 2 showed a significant stimulative effect on differentiation of cultured osteoblast cells.

118

P. Dixit et al. / Phytochemistry 81 (2012) 117–125

O OH

HN

OH HO 1

OH O OH

HN

OH HO OH

OH

2 HO

H H H

3R = HO HO

O

"

4 R=

OH

O

HO

O O OH

O

6 R=H

HO HO

O

H3C 7

OH 8 R=

OH

5 OH

1"

HO HO

O

"

29

27

2"

*27" O

O

OH 28

25

OCH3

H3CO

H

RO O

O

O OH

O

Fig. 1. Basic structure of isolated compounds (1–8).

2. Results and discussion Air-dried, powdered seed coats of P. acerifolium were blended to a fine powder and extracted with ethanol. The ethanol extract was successively fractionated with n-hexane, chloroform, n-butanol and water. The chloroform fraction was subjected to normal phase column chromatography afforded four new compounds (Fig. 1) named pteroceramide A (1), pteroceramide B (2), pterosterol A (3) and pterosterol B (4), along with the known compounds 5,7dihydroxy-3-(4-hydroxy-3-methoxyphenyl)-6-methoxy-chromen4-one (5) (Kang et al., 2008), b-sitosterol (6) (Rani et al., 2010), Lacinilene C (7) (McCormick et al., 1984), b-sitosterol-O-b-D-glucopyranoside (8) (Ramadana et al., 2009) and friedeline (9) (Mahato and Kundu, 1994).

2.1. Structure elucidation Compound 1 was obtained as white amorphous solid, ½aD29 þ 7:76 (c 0.10, MeOH:CHCl3; 1:1). The ESI-MS and high-resolution Q-TOF-MS of 1 displayed a pseudomolecular ion peak at m/z 682 [M + H]+ and 682.6347 [M + H]+ respectively (calcd. for C42H84NO5, 682.6350) with two degrees of unsaturation. The IR spectrum (in KBr) displayed absorption band at 3342 cm1, 1672 and 1647 cm1, indicating the presence of hydroxyl, amide and olefinic functionalities. The UV spectrum showed the absorption bands at 240 nm which is a characteristic band of amides. The

inspection of 1 by 1H NMR and 13C NMR spectra in C5D5N showed dH 8.58 (1H, d, J = 9.2 Hz, exchangeable with D2O), dC 52.7 and 175.1 signals, consistent with the presence of secondary amide group and overlapped protons signal at dH 1.27–2.23 was inferred the occurrence of long aliphatic chains. The signals appeared at dH 5.11 (1H, m, dC 52.7) was assigned to methine proton, connected to nitrogen atom of amide group. The signal displayed at dH 4.28 (m), 4.34 (1H, dd, J = 12.0, 6.0 Hz) and 4.36 (1H, dd, J = 12.0, 6.0 Hz) were assigned to oxygenated methine protons. One oxygenated methylene protons were resonated at dH 4.50 (1H, dd, J = 11.4, 6.4 Hz) and 4.45 (1H, dd, J = 11.4, 4.6 Hz). Two terminal methyl group of aliphatic chains were suggested by the presence of signal at dH 0.90 (6H, t, J = 6.0 Hz). The above data was reminiscent with ceramides type-sphingolipid (Loukaci et al., 2000; Sun et al., 2006). Moreover two olefinic overlapped protons signals appeared at dH 5.55 (m) and corresponding carbon signals at dC 130.3 and 130.6, indicated the presence of a double bond in aliphatic chain. The configuration of double bond of aliphatic chain was assigned to E, on the basis of chemical shift of carbons next to double bond which appeared at dC 33.4 and 32.7 (Jung et al., 1996; Kang et al., 2004). Usually, the carbon signals adjacent to a trans double bond appear at dC 32–33, while those of a cis double bond appear at dC 27–28 (Stothers, 1972). The adjacent nature of protons was made possible by analysis of 1H–1H COSY experiment. 13 C NMR spectrum (Table 1) showed 42 resonances included the signal at dC 175.1 and dC 52.7 supported that the compound was sphingolipid. In addition the spectrum exhibited three carbon

119

P. Dixit et al. / Phytochemistry 81 (2012) 117–125 Table 1 1 H and 13C NMR (300 and 75 MHz) data of compounds 1 and 2 in pyridine-d5. Position

NH 1a 1b 2 3 4 5a 5b 6 7–17 18 19–20 21 10 20 30 a 30 b 40 a 40 b 50 –80 90 , 120 100 110 130 –220 230 240 a 240 b

Pteroceramide A (1)

Pteroceramide B (2)

dH (m, J in Hz)

dC

HMBC

dH(m, J in Hz)

dC

HMBC

8.58 (d, J = 9.2) 4.50 (dd, J = 11.4, 4.45 (dd, J = 11.4, 5.11 (m) 4.34 (dd, J = 12.0, 4.28 (m) 1.98 (m) 1.91 (m) 1.74 (m) 1.27–0.92 (m) 0.90 (t, J = 6.0) – – – 4.36 (dd, J = 12.0, 2.02 (m) 2.23 (m) 2.02 (m) 1.75 (m) 1.30–1.26 (m) 2.07 (m) 5.55 (m) 5.55 (m) 1.30–1.27 (m) 1.27 (m) 0.90 (t, J = 6.0) –

– 61.9 – 52.7 76.3 72.5 32.7 – 26.4 22.7–32.7 14.7 – – 175.1 72.2 35.4 – 22.7 – 24.3–28.0 33.4, 32.7 130.3 130.6 22.7–31.9 22.7 14.7 –

C-1 C-2, C-3, C-1, C-1, C-2, C-3, C-7 C-4, – –

8.58 (d, J = 9.0) 4.28 (dd, J = 12.0, 6.0) 4.26 (dd, J = 12.0, 6.0) 5.04 (m) 4.28 (dd, J = 12.0, 6.0) 4.63 (m) 4.64 (m) – 1. 24 (m) 1.30–0.94(m) 1.30–0.94(m) 1.30–0.94(m) 0.93 (t, J = 6.0) – 4.29 (dd, J = 12.0, 6.0) 2.00 (m) 2.25 (m) 2.1 (m) 2.1 (m) 2.03 (m) 2.05 (m) 5.54 (m) 5.54 (m) 1.30 (m) 5.90 (m) 4.98 (dd, J = 1.6, 10.1) 5.09 (dd, J = 17.4, 1.6)

– 63.1 – 54.1 77.9 73.6 74.1 – 27.0 24.3–36.9 24.3–36.9 22.7–28.9 15.6 176.6 74.0 39.1 – 23.9 – 28.0–30.7 32.7 131.8 132.0 24.3–30.3 140.6 115.8 115.8

C-1 C-2, 3 – C-1, 4, 10 C-1, 5 C-2, 6 C-3, 7 – C-4, 8 – – – – – C-10 , 30 , 40 C-10 , 20 – – – – – C-80 , 120 C-90 ,110 – C-210 C-220 –

6.4) 4.6) 6.0)

6.0)

3 10 3, 4, 10 5 6 7 8

– C-10 , 30 , 40 C-10 , 20 – – – – C-100 , C-110 C-80 , 120 C-90 ,110 – – – –

signals at dC 76.3, 72.5, 72.2 and one carbon at dC 61.9 resonated to oxygenated methines and methylene respectively. The chemical shift of the H-2 signal and the 13C chemical shifts of C-1–C-4, C10 and C-20 of sphingolipid are especially suitable for the relative stereochemistry of the phytosphingosine moiety (Sugiyama et al., 1990, 1991; Higuchi et al., 1990). The chemical shift of H-2 (dH 5.11) and the carbon chemical shift at dC 61.9 (C-1), 52.7 (C-2), 76.3 (C-3), 72.5 (C-4), 175.1 (C-10 ) and 72.2 (C-20 ) in 1 were identical to that of others natural (2S, 3S, 4R)-phytosphingosine moieties (Kang et al., 1999; Zhan et al., 2003; Oueslati et al., 2005). The carbon spectra showed the signals of methylenes and terminal methyl groups of the fatty acyl chain and long chain base present in sphingolipid at 35.4–22.7 (32C) and 14.7(2C) respectively. The assignments of 1H and 13C resonances of the skeleton were unambiguously assigned with the aid of HSQC and HMBC experiments. In the HMBC spectrum, oxygenated methine proton at dH 4.36 showed correlation with the carbonyl carbon at dC 175.1(C-10 ) and amide proton dH 8.58 with dC 61.9 (C-1), 76.3 (C-3) and 72.2 (C-20 ). Proton at dH 5.11 showed cross coupling with dC 175.1 (C-10 ) and 72.5 (C-4) in HMBC spectrum. Compound 1 possessed two aliphatic chains, which was reinforced by analysis of the 1D, 2D NMR as well as by acid hydrolysis of 1. On acid hydrolysis of compound 1 with hydrochloric acid in aqueous methanol, long chain base (LCB) 1A and fatty acid chain, 1B were liberated. The Q-TOF-MS and HRESI-MS spectrum of fatty acid chain showed [M]+ ion peak at m/z 382.2975 and m/z 382.3026 respectively (calcd. for C24H46O3, 382.3447) with two degree of unsaturation indicated the presence of double bond in the chain. LCB 1A showed peak at m/z 318.3208 [M + H]+ (calcd. for C18H40NO3, 318.3008) expected as 2-amino-octadecane-1,3,4-triol (Fig. 4). The position of double bond, between C-100 and C-110 in 1B was confirmed by HRESI-MS fragments of 1 followed by Q-TOF-MS peak, obtained at m/z 513.1934 [M]+ (Fig. 2) and exhaustive analysis of COSY spectrum. The absolute configuration at C-20 in compound 1 was established with CD spectrum. The CD spectrum of fatty acid chain (1B) showed negative cotton effect at 214 nm, which is consistent with 20 R configuration (Sun et al.,

2006). On the basis of the above spectral evidences, the structure of 1 was deduced as pteroceramide A, a new compound (Fig. 2). Compound 2 was obtained as white amorphous solid, ½aD29 þ 8:03 [c 0.10, MeOH:CHCl3 (1:1)]. The Q-TOF-MS showed molecular peaks at m/z 737.5406 [M]+ (calcd. for C45H87NO6, 737.6533) and 738.5518 [M + H]+ (calcd. for C45H88NO6, 737.6612). The UV showed absorption at 243 nm. The close structural relationship between compounds 1 and 2 was evident from similar spectral features (Table 1). The most significant differences between the 1H and 13C NMR spectra of compound 1 and 2 were borne an extra hydroxyl group at C-5 and a terminal double bond of the acyl chain at C-230 –C-240 position in compound 2, which was recognized by the signals at 4.64 (1H, m, dC 74.1), 5.90 (1H, m, dC 140.6), 4.98 (1H, dd, J = 10.1, 1.6 Hz, dC 115.8), 5.09 (1H, dd, J = 17.1, 1.6 Hz, dC 115.8). The fragment peaks appeared in the QTOF-MS (Fig. 3) at m/z 712, 698, 532, 518 and 376 also supported the structure as pteroceramide B. The relative stereochemistry of C-2 to C-5 has already been established in similar type of molecule. The absolute stereochemistry of C-2 to C-5 was determined as 2S, 3S, 4R, 5R on the basis of biogenetic consideration as well as by comparison of 1H and 13C NMR data those reported into literature (Bankeu et al., 2010). Acid hydrolysis of Compound 2 with hydrochloric in aqueous methanol yielded two fragments (Fig. 4). Less polar fatty acid chain (2B), showed most prominent peak at m/z 381.3025 [M + H]+ in Q-TOF-MS corresponds to the molecular formula C24H45O3 with three degree of unsaturation. The mass fragmentation pattern also supported the presence of double bond in fatty acid chain at C-10 and C-23 positions. The absolute configuration at C-20 in compound 2 was established with CD spectrum. The CD spectrum of fatty acid chain (2B) showed negative cotton effect at 216 nm which is consistent with 20 R configuration (Sun et al., 2006). The LCB (2A) showed [M + H]+ ion peak at m/z 376.3024 (calcd. for C21H45O3) in Q-TOF-MS, expected for 2-amino-henicosane-1,3,4,5-tetraol. From above data the structure of compound 2 was deduced as pteroceramide B, a new compound (Fig. 3). Compound 3, ½aD29  22:7 (c 0.3, CHCl3) was obtained as brown sticky solid. The Q-TOF-MS displayed the molecular ion peak at m/z

120

P. Dixit et al. / Phytochemistry 81 (2012) 117–125

m/z 389.3[M]+

m/z 382[M+H]+ m/z 381[M]+

m/z 513.4[M]+

O

m/z 318[M+H]+ HN

11'

2'

1'

3'

23' 24'

10

OH OH

HO 1

2

18

3

OH

5

Fig. 2. Mass fragmentation pattern of compound 1.

m/z 689 [M+H]+

O m/z 376.3[M+H]+

1'

HN HO 1

2

3

m/z 532[M+H]+

2'

11' 24'

10'

OH

m/z 712 [M+H]+

OH 5

21

OH OH Fig. 3. Mass fragmentation pattern of compound 2.

O 1' HN 1 HO

2

O

11'

2' 10'

OH

1'

24'

OH 4 3

HN

HO

OH

2

m/z 682.6347[M+H]+

24'

10'

OH

OH OH

1 18

11'

2'

3

4

21

5

OH

m/z 737.5406[M]+ Acid Hydrolysis of 2

Acid Hydrolysis of 1

NH2 1 HO

OH 4

NH2

18

OH

1A

1

m/z 318.3208[M+H]+ HO

1

HO

1'

OH 4 OH

O

11'

2' OH

10'

HO

OH OH 3

OH

18 O

m/z 301.2067[M]+ 24'

1B

1'

OH

2A

m/z 376.3024[M+H]+

11'

2' HO

21

5

10'

24'

2B

m/z 381.3025[M+H]+.

m/z 382.3026[M]+

Fig. 4. Acid hydrolysis of compounds 1 and 2.

969.5485 [M + H]+ corresponding to the molecular formula C62H112O7 also supported by its NMR spectra. The IR spectrum exhibited bands at 3404, 1738, 1640, 830 and 721 cm1. It shows UV absorption at kmax 252 and 213 nm. The 1H and 13C spectrum of compound 3 showed resemblance with those of compound 8, (Ramadana et al., 2009) except for the presence of aliphatic acyl chain with double bond. The 1H NMR spectrum of 3 (Table 2) showed seven methyl signals in which six methyl generates for b-sitosterol skeleton and one for fatty acyl chain, at dH 0.67 (3H, s, H-18), 0.82 (3H, d, J = 6.6 Hz, H-26), 0.86 (3H, d, J = 6.0 Hz, H-27), 0.88 (3H, t, J = 6.0 Hz, H-29), 0.91 (3H, d, J = 5.4 Hz, H-21), 1.00 (3H, s, H-19)

and 0.81 (3H, t, J = 6.6 of fatty chain). A methine proton, germinal to oxygen was appeared at 3.51 (1H, m, H-3) and an olifinic proton at dH 5.34 (1H, m, H-6). These signals are similar to b-sitosterol (6). The adjacent nature of protons was confirmed by 1H–1H COSY experiments. A signal at dH 4.36 (1H, d, J = 6.6 Hz) was assignable to the anomeric proton and signals at the region of dH 3.36_3.58 (4H, m) were due to the four oxygenated methines protons of the glucopyranosyl unit. The oxygenated methylene protons of sugar moiety were resonated at dH 4.34 (1H, dd, J = 11.2, 1.2 Hz) and 4.26 (1H, dd, J = 11.2, 6.2 Hz). The coupling constant of the signal resulting from the anomeric proton of the glucopyranoside indicated b-configuration of glucopyranosyl unit. The position of

121

P. Dixit et al. / Phytochemistry 81 (2012) 117–125 Table 2 1 H and 13C NMR (300 and 75 MHz) data of compounds 3 and 4 in pyridine-d5. Position

1a 1b 2a 2b 3 4a 4b 5 6 7a 7b 8 9 10 11 12a 12b 13 14 15a 15b 16a 16b 17 18 19 20 21 22a 22b 23 24 25 26 27 28 29 10 20 30 40 50 60 a 60 b 100 200 300 –2600 2700 2800 2900 a 2900 b

Pterosterol A (3)

Pterosterol B (4)

dH (m, J in Hz)

dC

HMBC

dH (m, J in Hz)

dC

HMBC

1.09 (m) 1.83 (m) 1.58 (m) 1.81_1.94 3.51 (m) 2.29_2.33 (m) 2.36_2.49 (m) – 5.34 (m) 1.52_1.58 (m) 1.92_2.02 (m) 1.43_1.58 (m) 0.91_0.99 (m) – 1.43_1.58 (m) 2.00–2.02 (m) 2.29_2.33 (m) – 0.90_1.07 (m) 1.49_1.54 (m) 1.52_1.66 (m) 1.21_1.29 (m) 1.81_1.83 (m) 1.07_1.19 (m) 0.67 (s) 1.00 (s) 2.29_2.33 (m) 0.91(d, J = 5.4) 0.91_1.09 (m) 1.33_1.34 (m) 1.10_1.29 (m) 0.92_1.00 (m) 1.65_1.66 (m) 0.82 (d, J = 6.6) 0.86 (d, J = 6.0) 1.21_1.29 (m) 0.88 (t, J = 6.0) 4.36 (d, J = 6.6) 3.36_3.58 (m) 3.36_3.58 (m) 3.36_3.58 (m) 3.36_3.58 (m) 4.26 (dd, J=11.2, 6.2) 4.34_ (dd, J = 11.2, 1.2) – 2.33 (m) 0.91–1.55 (m) 0.81 (t, J = 6.6) – – –

36.6 – 29.1 – 79.8 37.3 – 140.3 120.0 31.9 – 31.9 45.8 36.2 21.0 38.9 – 39.7 56.7 24.3

C-3, 5, 10 C-3, 10 C-3, 4, 10 C-4, 10 C-1, 5, 10 C-2, 3, 6, 10 C-2, 3, 5, 10 – C-4, 8, 10 C-5, 8, 9 C-5, 9 C-9 C-5, 10, 14 – C-8, 12 C-8, 13, 14 C-8, 11, 14 – C-8, 17 C-8, 14, 17 C-14, 17 C-13, 14, 17 C-14, 15, 17 – C-12, 13, 14, 17 C-1, 5, 6, 9, 10 – – – – – – – C-24, 27 C-24, 27 – C-24, C-25 C-3, 20 , 30 C-30 , 50 , 60 C-40 , 50 – C-20 , 50 C-30 , 40 , 50 , C-10 – C-10 C-10 – – – –

1.09 (t, J = 13.0) 1.86 (d, J = 13.0) 1.59 (m) 1.93_1.98 3.57 (m) 2.27_2.36 (m) 2.39_2.45 (m) – 5.36 (m) 1.52_1.59 (m) 1.93_2.03 (m) 1.43_1.59 (m) 0.92_0.98 (m) – 1.43_1.59 (m) 2.00_2.03 (m) 2.16–2.34(m) – 0.97_1.05 (m) 1.00_1.12 (m) 1.52_1.69 (m) 1.23_1.28 (m) 1.81_1.86 (m) 1.07_1.16 (m) 0.67 (s) 1.00 (s) 1.33_1.44 (m) 0.91(d, J = 6.6) 1.00_1.09 (m) 1.33_1.36 (m) 1.11_1.28 (m) 0.92_1.00 (m) 1.62_1.69 (m) 0.84 (d, J = 6.6) 0.86 (d, J = 6.5) 1.23_1.28 (m) 0.88 (t, J = 6.6) 4.42 (d, J = 6.8) 3.36_3.38 (m) 3.45 (m) 3.36_3.38 (m) 3.56 (m) 4.28 (dd, J = 12.0, 6.2) 4.38 (dd, J = 12.0, 1.5) – 1.63 (m) 1.00–2.36 (m) 2..36 (m) 5.82 (m) 4.93 (d, J = 10.4) 5.00 (d, J = 17.4)

36.7 – 29.0 – 79.6 37.2 – 140.2 122.1 31.9 – 31.9 45.8 36.1 21.0 39.7 – 39.7 56.7 24.2

C-3, 5, 10 C-3, 10 C-3, 4, 10 C-4, 10 C-1, 5, 10 C-2, 3, 6, 10 C-2, 3, 5, 10 – C-4, 8, 10 C-5, 8, 9 C-5, 9 C-9 C-5, 10, 14 – C-8, 12 C-8, 13, 14 C-8, 11, 14 – C-8, 17 C-8, 14, 17 C-14, 17 C-13, 14, 17 C-14, 15, 17 – C-12, 13, 14, 17 C-1, 5, 6, 9 – – – – – – – C-24, 27 C-24, 27 – C-24, C-25 C-3, 20 , 30 C-30 , 50 , 60 C-40 ,50 – C-20 ,50 C-30 , 40 , 50 , C-10 – C-10 – – – C-2700 C-2700

26.2 – 50.1 11.8 19.3 34.3 18.8 33.9 – 26.0 42.3 26.1 19.0 19.8 23.0 11.9 101.3 73.3 73.6 70.5 76.2 63.7 – 174.1 34.2 21.0 14.8 – – –

glucopyranosyl moiety at C-3 was confirmed by HMBC correlation of anomeric proton with carbon at dC 79.8. Moreover, 1H NMR signals at the range of dH 0.91–2.33 as multiplates were indicated the presence of methylene of fatty chain (Kuo et al., 1998). The 13C NMR spectrum (Table 2) showed 62 carbon resonances. The multiplicity assignment was carried out by DEPT (135 & 90) experiments, which revealed the presence of 6 methyls, 14 methane, 12 methylene and three quaternary carbons closely similar to those of b-sitosterol-D-glycoside and other additional 25 methylene and 1 methyl for fatty acyl chain. Moreover the most downfield quaternary carbon at dC 174.1 was assigned to carbonyl carbon and dC 21.0–34.2 to aliphatic methylene carbons of fatty acyl chain (Wu et al., 1988). In 13C spectrum of compound 3, the signal at dC 79.8 was assigned to C-3 of b-sitosterol moiety. Signal, corresponded to anomeric carbon of glucose moiety was appeared at dC 101.3 and other methines carbons of glucopyranosyl moiety were reso-

26.1 – 50.1 11.9 19.3 33.8 18.7 33.4 – 26.0 42.3 26.0 19.0 19.8 23.0 11.9 101.2 73.5 73.8 70.1 76.0 63.3 174.5 31.9 29.0–31.9 31.9 139.2 114.0 –

nated at dC 70.5, 73.3, 73.6 and 76.2. The signal at dC 63.7 was attributed to the oxygenated methylene group of the esterified glucose. The proton dH 4.34 (H-60 b) showed HMBC correlation with carbon at dC 174.1, which was suggested the linkage of acyl chain to 600 -C of glucose. The final structure of compound 3 was established by analyzing HMBC and HSQC spectrum of the molecule. The length of fatty acid chain was determined on the basis of mass fragments after basic hydrolysis of compound 3. The QTOF-MS and MALDI-TOF-MS of hydrolyzed compound showed the pseudo molecular ion peak at m/z 411.1024 [M + H]+ and m/ z 411.3631 [M + H]+ respectively (calcd. for C27H55O2, 411.7244) expected for heptacosanic acid (Fig. 5), also supported by NMR data. Thus, based on above spectral data compound 3 was characterized as pterosterol A. Compound 4 ½aD29  9:35 (c 0.1, CHCl3) was obtained as white amorphous solid. Its molecular formula, C64H114O7, was deduced from HRESI-MS which showed the molecular ions peak at m/z

122

P. Dixit et al. / Phytochemistry 81 (2012) 117–125

29 21

O O

3'

1

25

1"

4' 6' 5'

HO HO

27"

O

2'

19

OH

8

H

3 1'

H

9

5

O

H

17

13

28

20 22

18

23 24

25

27

26

14 15

m/z : 969.5485[M+H]+ Basic Hydrolysis of 3

HO 1 O

27

m/z : 411.3631[M+H]+ Fig. 5. Basic hydrolysis of compound 3.

995.8565 [M + H]+. The IR spectrum of compound showed the presence of hydroxyl (3404 cm1) and ester group (1740 cm1). The 1H and 13C NMR spectra (Table 2) of compound 4 has been resembled with that of compound 3 except the presence of additional signals at 5.82 (m, dC 139.2), 4.93 (d, J = 10.4, dC 114.0) and 5.00 (d, J = 17.4, dC 114.0) for vinyl group at the end of fatty chain. Basic hydrolysis of compound 4 afforded two products (Fig. 6). The polar product was similar to sitosterol-3-O-b-D-glucopyranoside by comparison of spectral data with those of compound 8 (Ramadana et al., 2009) and other was less polar fatty chain. This chemical evidence suggested that the less polar fatty chain in 4 has been bonded with a hydroxyl group of glucose moiety. The MALDITOF-MS of less polar fragment displayed molecular ion peak at m/z 437.1891 [M + H]+ (calcd. for C29H57O2, 437.4617) expected for the nonacos-28-enoic acid. The NMR data of 4 and MALDITOF-MS of fragments clearly supported the ester linkage between nonacos-28-enoic acid and hydroxyl at C-60 of glucose moiety. Further inspection of 4 by 1H NMR, 13C NMR and 2D NMR (1H–1H COSY, HSQC, HMBC) indicated it to be pterosterol B, a new compound (Fig. 6).

2009; Trivedi et al., 2008). ALP was measured by using p-nitrophenylphosphate (PNPP) as a substrate (Siddiqui et al., 2010). In mineralization assay, BMC were cultured in mineralizing media (aMEM medium containing 10 mM b-glycerophosphate and 50 lg/ ml ascorbic acid in presence or absence of compounds) up to 21 days. Cells were then stained with alizarin red-S and dye was extracted to quantify the extent of osteoblast mineralization (Siddiqui et al., 2010; Rawat et al., 2009; Sharan et al., 2010). Transcript levels of osteogenic genes including BMP-2, collagen type 1 (Col1) and runt-related transcription factor 2 (runx2) were determined in calvarial osteoblasts by qPCR following an optimized protocol (Trivedi et al., 2009). Primer pairs used were; BMP-2 – 5’C GGACTGCGGTCTCCTAA3’(sense), 5’GGGGAAGCAGCAACACTAGA3’ (antisense); runx2 – 5’CCACAGAGCTATTAAAGTGACAGTG3’(sense), 5’AACAAACTAGGTTTAGAGTCATCAAGC3’ (antisense); Col1 – 5’CAT GTTCAGCTTGTGGACCT3’ (sense), 5’CGAGCTGACTTCAGGGATGT3’ (antisense); GAPDH (house-keeping gene) – 5’CAGCAAGGATA CTGAGAGCAAGAG3’ (sense), 5’GGATGGAATTGTGAGGGAGATG3’ (antisense). Data are expressed as mean ± SEM. The data obtained in experiments with multiple treatments were subjected to one-way ANOVA of significance using prism 5.0 software. As shown in Fig. 7, BMP-2 markedly stimulated osteoblast ALP production compared to control cells (receiving vehicle). Variation in ALP production observed with control and BMP-2 treated cells can be attributed to batches of osteoblasts harvested from separate sets of animals. Fig. 7 further showed that 1 and 2 significantly increased osteoblast ALP activity compared to control. Maximum ALP activation was observed at 1 nM, and at this concentration, the increase in ALP activity was comparable to

2.2. Biological activity The isolated compounds (1, 2, 3 and 4) were evaluated for in vitro osteogenic activity using primary cultures of rat calvarial osteoblasts and bone marrow cells (BMC) following previously described protocol (Siddiqui et al., 2010), wherein stimulation of alkaline phosphatase (ALP) production indicated increased osteoblast differentiation (Siddiqui et al., 2010; Rawat et al.,

"

2"

O HO HO

"

29

25

28 1"

O O OH

H

H H

O

H

m/z : 995.8565[M+H]+ Basic Hydrolysis of 4 28

HO 1 O

m/z : 437.1891[M+H]+ Fig. 6. Basic hydrolysis of compound of 4.

29

P. Dixit et al. / Phytochemistry 81 (2012) 117–125

123

Fig. 8. Effect of 1 and 2 on mRNA levels of osteogenic genes. Rat calvarial osteoblasts were treated with 1 nM 1 and 2 for 48 h. qPCR for BMP-2, runx2 and Col1 mRNAs was performed. At 1 nM, 1 and 2 increased these mRNA levels when compared to control. Values are obtained from three independent experiments performed in triplicate set and expressed as mean ± SEM; ⁄P < 0.05 and ⁄⁄P < 0.01. Fig. 7. Effect of 1 and 2 on osteoblast differentiation. Rat calvarial osteoblasts (2  103 cells) were seeded in 96-well plates and treated with increasing concentrations of 1 and 2 for 48 h. BMP-2 was used as positive control. ALP activity was determined spectrophotometrically at 405 nm. Values are obtained from three independent experiments in the replicate of six treatment point and expressed as mean ± SEM ⁄P < 0.05 and ⁄⁄P < 0.001 compared with control.

BMP-2. Interestingly, 1 and 2 failed to stimulate osteoblast ALP activity at concentrations higher than 1 nM. Loss of stimulatory effect of 1 and 2 on osteoblasts at higher concentrations may be due to the unfavorable balance between estrogen receptors and peroxisome proliferator-activated receptors, which are reciprocally activated by phytoestrogens and determine the biological effects of phytoestrogens on bone. Furthermore, Cytochrome P-450 enzymes may be induced more with higher concentrations of phytoestrogens, which in turn could rapidly metabolize these compounds leading to abolition of effect. The loss of biological effects by phytochemicals at higher concentrations has previously been reported and our data attest to these reports (Dang et al., 2003; Kakai et al., 1992; Dixit et al., 2011). Since these two compounds at 1 nM maximally stimulated osteoblast ALP activity, this concentration was used in the remaining experiments. Compounds 3 and 4 had no effect on osteoblast ALP activity (data not shown), thus not studied further. With 1 and 2, we studied the stimulation of osteogenic gene expression and observed that these compounds increased mRNA levels of BMP-2, runx2 and Col1 in osteoblasts to varying extents (Fig. 8).These findings further confirmed osteogenic effect of 1 and 2. Calvarial osteoblasts represent osteoblasts from membranous bones that do not exhibit osteoporotic bone loss. Therefore, we also studied the effect of the compounds on the mineralization of BMC from one of the bones (femora) that undergo bone loss under estrogen deficiency. Compounds 1 and 2 increased mineralized nodules of cultured BMC (Fig. 9), suggesting significant osteogenic effect exerted by these compounds due to likely enhancement of bone marrow osteoprogenitors. Fifteen 1–2 days old rat neonatal pups were divided into three equal groups treated with both compounds 1 and 2 with 1 mg/kg

Fig. 9. Effect of 1 and 2 on mineralization of BMC. BMCs (2  105 cells) were seeded in 12-well plates and incubated with 1 nM 1 or 2 for 21 days. At the end of incubation, cells were fixed and stained with alizarin red-S (upper panel – representative photomicrograph). Stain was extracted and OD measured colorimetrically. Values were obtained from four performed in triplicate set and expressed as mean ± SEM; ⁄P < 0.05 compared with control.

and 10 mg/kg or equal amount of vehicle for three consecutive days, subcutaneously. At the end of the treatment, pups were euthanized and individual calvaria was harvested and cleaned off adherent tissue materials by gentle scraping. Total RNA was isolated and qPCR for OCN, BMP-2 and runx2 was performed as described previously. Primer pairs used were; OCN –5’ATAGACT CCGGCGCTACCTC 3’ (sense), 5’CCAGGGGATCTGGGTAGG3’ (antisense); for BMP-2, runx2 and GAPDH (house-keeping gene) primer pairs were used as in previous experiment. Data are expressed as mean ± SEM (Fig. 10). It was observed that treatment of rat pups at 10 mg/kg but not 1 mg/kg dose resulted in significant increase in the mRNA levels of OCN, runx2 and BMP-2 in rat calvaria. These data suggest that compounds 1 and 2 also have in vivo osteogenic effect.

124

P. Dixit et al. / Phytochemistry 81 (2012) 117–125

3.2. Plant material The seed coats (fruits) of P. acerifolium were collected from Lucknow, India during November 2010. The plant material was identified by Dr. A.K. Mangal, Central Council for Research in Ayurveda and Siddha. A voucher specimen (CDRI plant code no. 4741) has been preserved in the author’s laboratory. 3.3. Extraction and isolation

Fig. 10. Compound 1 and 2 increased mRNA levels of osteogenic genes in calvaria. Neonatal rats were given subcutaneous injection of compound 1 or 2 (1 and 10 mg/ kg in 25 ll saline) or vehicle (25 ll saline) for three consecutive days. Calvariae were harvested to quantitatively assess osteogenic genes, osteocalcin (OCN), BMP-2 and runx2. qPCR data of the three genes are presented. Data are expressed as mean ± SEM; ⁄P < 0.05 and ⁄⁄P < 0.01 compared with control (n = 3 rats/group).

2.3. Conclusion Our study demonstrates the isolation and characterization of new phytoceramides (1 and 2) and acylated phytsterol glucoside (3 and 4) along with several known compounds (5–9) form P. acerifolium seed coat. Known compounds 5 and 7 were obtained for the first time from this plant. Compounds 1 and 2 stimulated osteoblast differentiations in vitro and in vivo, suggesting significant bone anabolic effect. It is the first report of this class of compound from the genus Pterospermum exhibiting osteogenic activity. 3. Experimental

Dried seed coats (fruits) of P. acerifolium (15 kg) were extracted with ethanol (4 times). Combined ethanolic extract was filtered and concentrated under reduced pressure at 45 °C to a dark brown mass (340.0 g), which was further suspended in water (1.0 L) and successively triturated with hexane to separate non polar impurities and chloroform (600 mL  7) and n-butanol, saturated with water (500 mL  7). The chloroform, n-butanol, and water-soluble fractions were concentrated at 45 °C and afforded chloroform (128 g), n-butanol (102 g) and aqueous (60 g) fractions, respectively. The chloroform fraction (120.0 g) was fractionated by silica gel column chromatography with hexane–EtOAc (1:99 to 5:99, v/v) yielding 285 fractions (F1–285). Fractions (F35–40), were eluted with a mixture of hexane–EtOAc (9:1) yielding b-sitosterol (6) (200 mg) and compound (3) (150 mg), and fractions F107–112, which were eluted with hexane–EtOAc (17:3) and again subjected to a CC, afforded compound 1 (250 mg). Column fractions F151– 162 [hexane–EtOAc (3:7)] and F170–172 [hexane–EtOAc (4.5:5.5)] were subjected to repeated CC yielded compound 5 (300 mg) and compound 4 (85 mg). Column fractions F178–192 [hexane–EtOAc (3.5:6.5)] and F199–232 [hexane–EtOAc (3:7)] were afforded compound 2 (200 mg) and compound 8 (500 mg). Fractions F236–246 on CC using hexane–EtOAc (8:2), gave friedeline 9 (155 mg). Compound 7 was obtained by the CC of F246– 251 with MeOH–CHCl3 (1:9). 3.3.1. Phytoceramide A (1) White amorphous solid; ½aD29 þ 7:76 (c 0.10, MeOH:CHCl3; 1:1); UV (MeOH) kmax 240 nm; IR (in KBr) 3342, 2960, 1647, 1537, 1450 cm1; for 1H and 13C NMR spectroscopic data see Table 1; ESI-MS m/z 682 [M + H]+; Q-TOF-MS m/z 682.6347 [M + H]+ (calcd. for C42H84NO5, 682.6350). 3.3.2. Phytoceramide B (2) White amorphous solid; ½aD29 þ 8:03 (c 0.10, MeOH:CHCl3; 1:1); UV (MeOH) kmax 243 nm; IR (in KBr) 3342, 2962, 1695 cm1; for 1H and 13C NMR spectroscopic data see Table 1; Q-TOF-MS m/z 737.5406 [M]+ (calcd. for C45H87NO6, 737.6533).

3.1. General experimental procedures Optical rotations were measured on a Perkin-Elmer model 241 digital polarimeter. UV spectra were obtained on a Perkin-Elmer k-15 UV spectrophotometer. IR spectra were recorded on a Perkin-Elmer RX-1 spectrophotometer using KBr pellets. 1H and 13C NMR spectra were recorded on a Bruker DRX 300 MHz, Varian 600 MHz NMR spectrometer; proton-detected heteronuclear correlations were measured using the HSQC and HMBC techniques. Q-TOF-MS run on AGILENT 6520, MALDI-TOF-MS V-positive run on SYNAPT HDMS (Waters, UK) and ESMS was carried out on an Advantage Max LCQ Thermo-Finnigan mass spectrometer. Column chromatography was performed using silica gel (60–120 and 230– 400 mesh). TLC was carried out on precoated silica gel plates 60 F254 or RP-18 F254 plates with 0.5 or 1 mm adsorbent thickness (Merck). Spots were visualized by UV light or by spraying with H2SO4–MeOH or anisaldehyde–H2SO4 reagents.

3.3.3. Fatty acid chain after acid hydrolysis of 1 Q-TOF-MS m/z 382.2975[M]+; HRESI-MS m/z 382.3026 [M]+ (calcd. for C24H46O3, 382.3447); CD (CHCl3) De214  0.65. 3.3.4. Fatty acid chain after acid hydrolysis of 2 Q-TOF-MS m/z 381.3025 [M + H]+ (calcd. 381.6123); CD (CHCl3) De216  0.68.

for

C24H45O3,

3.3.5. Phytosterol A (3) Brown sticky solid; ½aD29  22:7 (c 0.3, CHCl3); UV (MeOH) kmax 252, 213 nm; IR (in KBr) 3404, 1738, 1640, 830, 721 cm1; for 1H and 13C NMR spectroscopic data see Table 2; Q-TOF-MS m/z 969.5485 [M + H]+ (calcd. for C62H113O7, 969.8486). For fatty acid chain: Q-TOF-MS m/z 411.1024 [M + H]+, MALDI-TOF-MS m/z 411.3631 [M + H]+ (calcd. for C27H55O2, 411.7244).

P. Dixit et al. / Phytochemistry 81 (2012) 117–125

3.3.6. Phytosterol B (4) White amorphous solid, ½aD29  9:35 (c 0.1, CHCl3); UV(MeOH) kmax 253, 215 nm; IR (in KBr) 3404, 1740 cm1; for 1H and 13C NMR spectroscopic data see Table 2; HRESI-TOF-MS m/z 995.8565 [M + H]+ (calcd. for C64H115O7, 995.8643). For fatty acid chain: MALDI-TOF-MS m/z 437.1891 [M + H]+ (calcd. for C29H57O2, 437.4617). 3.4. Acid hydrolysis of 1 and 2 Each compound 1 and 2 (25 mg) was subjected to acid hydrolysis with 0.9 N HCl in 80% aqueous MeOH (12 ml) and refluxed for 18 h. The resulting solution was extracted with n-hexane and combined organic phase was dried over Na2SO4. Evaporation of hexane yielded a fatty acid. Aqueous layer was neutralized with NH4OH and extracted with ether. Ether layer was concentrated to yield a long chain base. For compound 1, less polar fatty chain was obtained at m/z 382.3026 [M]+ from hexane layer and ether layer showed [M + H]+ peak at m/z 318.3208 by the analysis of mass spectra. For Compound 2, less polar fatty chain, was obtained at m/z 381.3035 [M + H]+ and ether layer afforded m/z 376.3024 [M + H]+ for 2-amino-henicosane-1,3,4,5-tetraol, identified by mass spectroscopic analysis. 3.5. Alkaline hydrolysis of 3 and 4 Each compound 3 and 4 (25 mg each) was subjected to basic hydrolysis with 2 N NaOH (3.0 ml) in 80% aqueous MeOH (12 ml). Reaction mixture was refluxed for 12 h at room temperature. The resulting solution was extracted with n-hexane and combined organic phase was dried over Na2SO4. Evaporation of hexane yielded a fatty acid. Aqueous basic layer was neutralized with 1 N HCl and extracted with chloroform. The chloroform was evaporated. The Q-TOF LC/MS and MALDI MS was performed for hexane fractions, resulted into molecular ion peak at m/z 411.3 [M + H]+ corresponding to the heptacosanoic acid for the compound 3 and the molecular ion peak at m/z 437.1 [M + H]+ corresponding to the nonacos-28-enoic acid for Compound 4 respectively. Moreover, the compound in chloroform fractions was identified as b-sitosterol-3-O-b-D-glucopyranoside by comparison of TLC with authentic sample. Acknowledgments The authors are thankful to Dr. Ashish Arora, Incharge 600 MHz NMR, Mr. Harsh Mohan Gauniyal and Dr. Brijesh kumar, SAIF division, CSIR–CDRI, for spectral data. Preety Dixit is thankful to the CSIR, Kailash Chand to UGC and Mohd Parvez Khan to Indian Council of Medical Research, New Delhi, India for the award of Research Fellowship. References Alldredge, B.K., Mary Anne, K.-K., Young, Lloyd Y., Kradjan, W.A., Guglielmo, B.J., 2009. Applied Therapeutics: The Clinical Use of Drugs. Wolters Kluwer Health/ Lippincott Williams & Wilkins, Philadelphia, pp. 101–103. ISBN 0-7817-6555-2. Balachandran, P., Govindrajan, R., 2005. Cancer – An ayurvedic perspective. Pharmacol. Res. 51, 19–30. Bankeu, J.J.K., Mustafa, S.A.A., Gojayev, A.S., Lenta, B.D., Noungoue, D.T., Ngouela, S.A., Asaad, K., Choudhary, M.I., Prigge, S., Guliyev, A.A., 2010. Ceramide and cerabroside from the stem bark of Ficus mucuso (Moraceae). Chem. Pharm. Bull. 58 (12), 1661–1665. Caius, J.F., 1990. The medicinal and poisonous plants of India. Indian Med. Plants 2, 489. Dang, Z.-C., Audinot, V., Papapoulos, S.E., Boutin, J.A., Lowik Clemens, W.G.M., 2003. Peroxisome proliferator-activated receptor c (PPARc) as a molecular target for the soy phytoestrogen genistein. J. Biol. Chem., 962–967.

125

Dixit, P., Khan, M.P., Swarnkar, G., Chattopadhyay, N., Maurya, R., 2011. Osteogenic constituents from Pterospermum acerifolium Willd. flower. Bioorg. Med. Chem. Lett. 21, 4617–4621. Gunasegaran, R., Subramanian, S., 1979. Flavonoids of three Pterospermum species. Indian J. Pharm. Sci. 41, 72–73. Higuchi, R., Natori, T., Komori, T., 1990. Isolation and characterization of acanthacerebroside B and structure elucidation of related, nearly homogeneous cerebrosides. Liebigs Ann. Chem., 51–55. Jung, J.H., Lee, C.O., Kim, Y.C., Kang, S.S., 1996. New bioactive cerebrosides from Arisaema amurense. J. Nat. Prod. 59, 319–322. Kakai, Y., Kawase, T., Nakano, T., Mikuni-Takagaki, Y., Saito, S., 1992. Effect of ipriflavone and estrogen on the differentiation and proliferation of osteogenic cells. Calcif. Tissue Int. 51 (Suppl. 1), S11–S15. Kang, H.S., Choi, J.H., Cho, W.K., Park, J.C., Choi, J.S., 2004. A sphingolipid and tyrosinase inhibitors from the fruiting body of Phellinus linteus. Arch. Pharm. Res. 27 (7), 742–750. Kang, S.S., Kim, J.S., Xu, Y.N., Kim, Y.H., 1999. Isolation of a new cerebroside from the root bark of Aralia elata. J. Nat. Prod. 62, 1059–1060. Kang, S.W., Kim, M.C., Kim, C.Y., Jung, S.H., Um, B.H., 2008. Rapid identification of isoflavonoids from Belamcanda chinensis by LC-NMR and LC-MS. Chem. Pharm. Bull. 56, 1452–1454. Kelsey, J.L., 1989. Risk factors for osteoporosis and associated fractures. Public Health Rep. 104, 14–20. Kuo, Y.H., Chu, P.H., Chang, C.I., 1998. Chemical studies of the bark of the Bauhinia purpuria. Chem. Pharm. Bull. 46, 1630–1631. Lin, X., Ma, L., Racette, S.B., Spearie, C.L.A., Ostlund, R.E., 2009. Phytosterol glycosides reduce cholesterol absorption in human. Am. J. Physiol. Gastrointest. Liver Physiol. 296, G-931–G-935. Loukaci, A., Bultel-Ponce, V., Longeon, A., Guyot, M., 2000. New lipids from the tunicate cystodytes cf. dellechiajei, as PLA2 inhibitors. J. Nat. Prod. 63, 799–802. Mahato, S.B., Kundu, A.P., 1994. 13C spectra of pentacyclictriterpinoids: A compilation and some silent features. Phytochemistry 37, 1517–1575. McCormick, M.J.P., Teruo, S., Paul, P.J., Schafer, T.R., Gardner, J.W., Stipanovic, R.D., 1984. Gossipium cadinanes and their analog: Synthesis of lacinilene C, 2,7dihydroxycadalene, and their methyl esters. J. Org. Chem. 49, 34–40. Oueslati, M.H., Mighri, Z., Jannet, H.B., Abreu, P.M., 2005. New ceramides from Rantherium suaveolens. Lipids 40 (10), 1075–1079. Ramadana, M.A., Ahmad, A.S., Nafadyc, A.M., Mansour, A.I., 2009. Chemical composition of the stem bark and leaves of Ficus pandurata. Nat. Prod. Res. 23, 1218–1230. Rani, S., Khan, S.A., Ali, M., 2010. Phytochemical investigation of the seed of Althea officinalis. Nat. Prod. Res. 24, 1358–1364. Rawat, P., Kumar, M., Sharan, K., Chattopadhyay, N., Maurya, R., 2009. Ulmosides A and B: Flavonoid 6-C-glycosides from Ulmus wallichiana, stimulating osteoblast differentiation assessed by alkaline phosphatase. Bioorg. Med. Chem. Lett. 19, 4684–4687. Rizvi, S.A.I., Sultana, T., 1972. Phytochemical studies of the flowers of Pterospermum acerifolium. Phytochemistry 11, 856–858. Ruvolo, P.P., 2003. Intracellular signal transduction pathway activated by ceramide and its metabolites. Pharmacol. Res. 47, 383–392. Sharan, K., Swarnkar, G., Siddiqui, J.A., Kumar, A., Rawat, P., Kumar, M., Nagar, G.K., Manickavasagam, L., Singh, S.P., Mishra, G., Wahajuddin, Jain, G.K., Maurya, R., Chattopadhyay, N., 2010. A novel flavonoid, 6-C-beta-D-glucopyranosyl-(2S, 3S)-(+)-30 ,40 ,50 ,7-tetrahydroxyflavone, isolated from Ulmus wallichiana Planchon mitigates overiectomy-induced osteoporosis in rats. Menopause 17, 577–586. Siddiqui, J.A., Swarnkar, G., Sharan, K., Chakravarti, B., Sharma, G., Rawat, P., Kumar, M., Khan, F.M., Pierroz, D., Maurya, R., Chattopathyay, N., 2010. 8,800 biapigeninyl stimulates osteoblast function and inhibits osteoclast and adipocyte functions: Osteoprotective action of 8,800 -biapigeninyl in overiectomized mice. Mol. Cell. Endocrinol. 323, 256–267. Stothers, J.B., 1972. C-13 NMR Spectroscopy. Academic press, New York. Sugiyama, S., Honda, M., Komori, T., 1990. Stereochemistry of the four phytosphingosine. Liebigs Ann. Chem., 1069–1078. Sugiyama, S., Honda, M., Higuchi, R., Komori, T., 1991. Stereochemistry of the four diastereomers of ceramides and cerebroside lactoside. Liebigs Ann. Chem. 4, 349–356. Sun, Y., Xu, Y., Hua, H., Zhu, H., Pei, Y., 2006. Gracilarioside and Gracilamides from the red alga Gracilaria asiatica. J. Nat. Prod. 69, 1488–1491. Tandon, S.P., Tiwari, K.P., Saxena, V.K., 1970. Amino acid content of the trunk bark of Pterospermum acerifolium. Proc. Indian Natl. Sci. Acad. A 40, 217–218. Trivedi, R., Kumar, A., Gupta, V., Kumar, S., Nagar, G.K., Romero, J.R., Dwivedi, A.K., Chattopadhyay, N., 2009. Effects of Egb 761 on bone mineral density, bone microstructure, and osteoblast function: Possible roles of quercetin and kaempferol. Mol. Cell. Endocrinol. 302, 86–91. Trivedi, R., Kumar, S., Kumar, A., Siddiqui, J.A., Swarnkar, G., Gupta, V., Kendurker, A., Dwivedi, A.K., Romero, J.R., Chattopadhyay, N., 2008. Kaempferol has osteogenic effect in overiectomized adult Sprague–Dawley rats. Mol. Cell. Endocrinol. 289, 85–93. Wu, G.P., Fukuyama, Y., Rei, W., Jinxian, B., Nakagawa, K., 1988. An acylated sitosterol glucoside from Alisma plantago-aquatica. Phytochemistry 27, 1895– 1896. Zhan, Z.J., Sun, H.D., Wu, H.M., Yuf, J.M., 2003. Chemical components from the fungus Engleromyces goetzei. Acta Bot. Sin. 45 (2), 248–252.