Phytoestrogenic effect of Inula racemosa Hook f – A cardioprotective root drug in traditional medicine

Author’s Accepted Manuscript Phytoestrogenic effect of Inula racemosa Hook f – A Cardioprotective Root Drug in Traditional Medicine Kalachaveedu Mangathayaru, Divya Raghavan, Srivani Telapolu, Sarah Kuruvilla, Kedike Balakrishna www.elsevier.com/locate/jep

PII: DOI: Reference:

S0378-8741(16)32237-1 http://dx.doi.org/10.1016/j.jep.2017.09.001 JEP11013

To appear in: Journal of Ethnopharmacology Received date: 4 December 2016 Revised date: 12 June 2017 Accepted date: 1 September 2017 Cite this article as: Kalachaveedu Mangathayaru, Divya Raghavan, Srivani Telapolu, Sarah Kuruvilla and Kedike Balakrishna, Phytoestrogenic effect of Inula racemosa Hook f – A Cardioprotective Root Drug in Traditional Medicine, Journal of Ethnopharmacology, http://dx.doi.org/10.1016/j.jep.2017.09.001 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Phytoestrogenic effect of Inula racemosa Hook f – A Cardioprotective Root Drug in Traditional Medicine Kalachaveedu Mangathayarua*, Divya Raghavana, Srivani Telapolub, Sarah Kuruvillac, Kedike Balakrishnad a

Faculty of Pharmacy, Sri Ramachandra University, Chennai, India

b

SRU Center for Indian Systems of Medicine - Quality Assurance and Standardization,

Central Research Facility, Sri Ramachandra University, Chennai, India c

d

Dept of Pathology, Madras Medical Mission, Chennai, India

Captain Srinivasa Murty Drug Research Institute for Ayurveda and Siddha

(CSMDRIAS) Ministry of Health & Family Welfare, Government of India, Chennai, India *Corresponding author Kalachaveedu Mangathayaru Department of Pharmacognosy, Faculty of Pharmacy, Sri Ramachandra University, Porur, Chennai 600 116, India. E-mail:[email protected], Phone: 91 044 24768403 Extn. 8927

1

ABSTRACT

Ethnopharmacological relevance: Roots of Inula racemosa are used as a cardio protective in Ayurveda in India, being prescribed as a medicine for precordial chest pain, cough and dyspnoea, both singly and as a poly herbal. Aim: Evaluation of Phytoestrogenic activity of the root extracts of Inula racemosa and compounds isolated therefrom in vivo, in silico and in vitro. Materials and Methods: Alcohol (IrA) and hexane (IrH) extracts characterized by HPTLC/GC-MS analysis respectively and processed for compound isolation were evaluated for estrogenic activity (100 &250 mg/kg bw) by the Immature rat uterotrophic assay using ethinylestradiol (EE -30µg/kg bw) as standard drug. Alantolactone (ALT), Isoalantolactone (IALT) and Stigmasterolglucoside (SG) isolated from the extracts were characterized and screened in silico for ERα, ERβ binding affinity, assessed in vitro for growth modulatory effects on MCF-7 cells by MTT assay and cell cycle distribution analysis using Flow cytometry. RT-PCR analysis evaluated the mRNA expression of pS2 in these cells post exposure to ALT, IALT and SG. Results: In the IrA treated groups there has been a statistically significant increase (P<0.05) in absolute and normalised uterine weight, uterine diameter, endometrial thickness, luminal epithelial cell height,diameter of ovary and in the number of primary and secondary ovarian follicles relative to untreated controls. Presence of ciliated epithelial cells in the oviduct, elevated number of early growing follicles characterized by an increased oocyte diameter, and signs of vascularization in the cortex of ovarian sections in this group relative to EE treated group are indicative of pervasive activation of follicular growth and initiation. Virtual docking demonstrated ERα affinity for IALT, ERβ affinity for ALT, while SG showed a high binding affinity to both with a relatively greater ERβ binding affinity. Dose dependent decrease in cell viability mediated by IALT and SG in the MTT assay is corroborated by a statistically significant increase (p<0.05)

2

in sub G0-G1 cells by SG at 200 and 400 µM in cell cycle analysis and there has been an induction of pS2 by IALT and SG in the ER regulated MCF-7 cells. Conclusions: Demonstration of classical morphological changes induced by estrogen stimulation mediated by IrA in vivo at both the tested doses, isolation of the antioxidant SG from IrA and its dose dependent growth inhibitory effect on estrogen sensitive MCF7 cells through apoptotic induction and an up regulation of pS2 are suggestive of an antiestrogenic effect through estrogen receptor binding affinity, typical of phytoestrogens that bind to ER but do not elicit a full estrogenic response. The observed estrogenic effect of IrA suggests a multi mechanistic molecular action involving antioxidant as well as redox signalling pathways acting in consonance with their anti-estrogenic effects owing to the weak estrogen like competitive receptor binding of SG.

Graphical abstract

3

Keywords Inula racemosa; Stigmasterol-3-O-β-D-glucopyranoside; ER binding; pS2; Immature rat uterotrophic assay; Flow cytometry

Chemical compounds studied in this article: Stigmasterolglucoside (Pubchem CID: 6602508) Alantolactone (PubchemCID: 72724) Isoalantolactone(Pubchem CID: 73285)

4

Ethinylestradiol (Pubchem CID: 5991)

Abbreviations IrA- alcohol extract of Inularacemosa. IrH - hexane extract of Inularacemosa, EE Ethinylestradiol, ER-estrogen receptor, Na-CMC - Sodium carboxy methyl cellulose, SG - Stigmasterol-3-O-β-D-glucopyranoside, ALT - Alantolactone, IALT - Isoalantolactone, RCSB-PDB - Research Collaboratory for Structural Bioinformatics - Protein Data Bank.

1. Introduction Vascular protective effects of estrogen are well established (Farhat et al., 1996). These are reportedly mediated indirectly, by an effect on lipoprotein metabolism and by a direct effect on the vessel wall. Functionally competent estrogen receptors have been identified in vascular smooth muscle cells and specific binding sites have been demonstrated in the endothelium (Losordo et al., 1994). Estrogen is known to protect against the development of diet induced atherosclerosis in rats (Moskowitz et al., 1956) and rabbits (Constantides et al., 1962). Phytoestrogens are a group of plant-derived estrogen analogues whose dietary intake is associated with a reduction in risk of cardiovascular diseases (Murkies, et al., 1998). In model systems they have been shown to be anti-estrogenic competing for estradiol at the receptor complex, yet fail to stimulate a full estrogenic response after binding to the nucleus. The profound physiological effects of phytosterols, isoflavones, lignans and coumestans - the known classes of phytoestrogens, have triggered an exponential expansion of literature on their possible therapeutic effects. Inularacemosa Hook f (Asteraceae), commonly known as ‘pushkarmool’ in India is mentioned in the ancient Ayurvedic treatise ‘Charaka samhita’ (Charak, 1941) as a medicine for precordial chest pain, cough and dyspnoea (Arora et al., 1980). The root powder reportedly reverses exercise induced ST-T changes in electrocardiographs of patients with ischaemic heart disease and possesses adrenergic beta blocking activity

5

(Tripathy et al., 1988). The aqueous extract is anti-anginal (Tripathy et al., 1984), hypoglycaemic (Gholaps and Kar, 2003) and anti-asthmatic (Sekhar et al., 2003). Its anti-oxidant and anti-atherosclerotic activity in guinea pigs has been reported by our group (Mangathayaru et al., 2009). The plant is a rich source of sesquiterpene lactones of which alantolactone (ALT) and isoalantolactone (IALT), occurring in the ratio of 4:6 are the major alantolides. Dihydroalantolactone, dihydroisoalantolactone, alloalantolactone, inunolide, dihydroinunolide, neoalantolactone and isoalantodiene are a few of the minor alantolides. Several simple phenolics such as phenyl acetonitrile and phenyl ethanol have been reported from the roots (Wealth of India, 2002). In view of the ethnopharmacological usage of the root as a cardio protective, reported presence of sesquiterpene lactones, known for a wide variety of biological activities, structural similarity of major alantolides to phytoestrogenic lignans and reported anti atherosclerotic activity, a vascular protective action mechanism due to a phytoestrogenic influence is hypothesized. Thus it was proposed to evaluate the phytoestrogenic activity of the root extracts and the compounds isolated from them. Estrogenicity being a determinant of their estrogen receptor (ER) binding affinity, isolated compounds were screened in silico for ERα and ERβ docking and assessed for their growth modulatory effects on estrogen receptor positive MCF-7 human breast cancer cell through MTT assay and cell cycle distribution analysis by flow cytometry. Being sensitive to estrogen stimulated pS2 transcription, MCF-7 cells treated with the isolated molecules were evaluated for its mRNA expression by RT-PCR. 2. Materials and Methods 2.1. Plant Material and extract preparation Authenticated roots of I. racemosa were obtained from, National Research Institute for Sowa Rigpa (Amchi) Research Centre, Leh-Ladakh, India in May 2005, and a voucher sample wasdeposited in the herbarium of Sri Ramachandra University (No: IR/17/23.05.05).They (2.5 kg) were cut into small pieces, shade dried for 7 days,

6

extracted with hexane (4x1500 mL) by cold maceration and vaccum distilled to an yellowish oily mass (IrH). The hexane exhausted marc was air-dried, similarly extracted with methanol (3x2500 mL) and the same vacuum distilled to yield a syrupy brownish mass (IrA).

2.2. Chemicals Ethinylestradiol (EE >99% purity) was purchased from Sigma (St Louis, USA). Inulin (92-95% purity) was purchased from Aumgene Biosciences Pvt Ltd (Gujarat, India). Precoated silica gel plates 60F254 of 0.2 mm thickness were from E Merck (Mumbai, India). Silica gel G 60-120 mesh for column chromatography was from SISCO Research (Mumbai, India). DMEM, Fetal Bovine Serum (FBS), Phosphate Buffered Saline (PBS),trypsin, penicillin and streptomycin were purchased from Hi-Media (Mumbai, India).

Dimethyl

sulphoxide

(DMSO),

3-(4,5-Dimethyl

thiazol-2yl)-2,5-

diphenyltetrazolium (MTT) and Propidium Iodide were purchased from Sigma-Aldrich (St.Louis, USA).All other solvents and chemicals were of analytical grade.

2.3.Phytochemical processing and characterization 2.3.1. HPTLC analysis of IrA The methanolic extract of Inula racemosa was standardized for inulin using HPTLC analysis. The sample and inulin standard solutions were appliedon pre-coated silica gel G 60 F254 (10 cm × 10 cm with 250 μm thickness, E. Merck) plate in with a Hamilton 100 μl syringe using a Camag Linomat V applicator (automated spray-on applicator equipped with a 100 μl syringe and operated with the settings distance from the plate side edge 15 mm, and distance from the bottom of the plate 10 mm). The slit dimension was kept 6.00 mm × 0.45mm. Linear ascending development was carried out in 10 cm × 10 cm, Camag twin trough glass Chamber saturated with butanol: acetic acid: water (6.3:2.7:1) as mobile phase.After development, TLC plate was completely air dried at room

7

temperature and derivatized with 20% sulphuric acid reagent. Peak areas for samples and standard were recorded by densitometric scanning at 297 nm, using a CAMAG TLC Scanner 3 with WINCATS version 3.2.1 software. Photo documentation was performed using CAMAG REPROSTAR 3. The data of the peak areas were plotted against the corresponding concentrations. The obtained values were treated by linear regression analysis.

2.3.2. Column Chromatographic processing of IrA IrA (30 g) was subjected to column chromatography on silica gel (54x4.5 cm, ILE India Pvt Ltd) using a step gradient of hexane (600 mL), hexane-CHCl3, 1:1 (900 mL ), CHCl3(600 mL), CHCl3–MeOH, 19:1 (1000 mL), 9:1 (500 mL), 4:1 (750 mL) and 1:1 (600 mL) to yield 45 fractions of 100 mL each. These were collected and monitored by TLC. Fractions 28 to 38 were combined, concentrated (1100 mL, 3.05 g) and separated on silica gel column (60-120 mesh, 47x2.7 cm), using hexane (100 mL), Toluene (75 mL), CHCl3 (150 mL), CHCl3-MeOH,19:1 (415 mL), 9:1 (100 mL), 4:1 (200 mL) and 1:1 (100 mL). Fractions 21 to 34 (350 mL) yielded an amorphous powder (Compound A) upon concentration. It gave a single spot of Rf-0.46 in CHCl3-MeOH (9:1). 2.3.3. Characterization of IrH by GC-MS analysis GC –MS analysis was carried out on Agilent HP 6890 GC/MS System with 5973 Mass Selective Detectorequipped with a HP 5 MS capillary column (30 m × 0.25 mm, 0.25 μm film thickness), carrier gas – helium (flow rate - 1.3 mL/min), linear velocity 25 cm/s, split ratio 1:100. Column temperature was programmed from 80 to 210°C at a rate of 15°C/min, 210°C to 250°C at a rate of 5°C/min, 250°C to 280°C at a rate of 15°C/min and for 9 min at 280°C. Split injection mode was used for sample injection. Components of the extract were identified by matching their 70 eV mass spectra with those recorded on Wiley MS data library and by comparison with standard published data.

2.3.4.Isolation of major alantolides from IrH

8

IrH (50 g) dissolved in hexane and allowed to stand overnight gave a colorless crystalline substance, which on recrystallization yielded fragrant needle shaped crystalline solid (Compound B – mp107º C). It answered Nollers test (Tin and thionyl chloride) for terpenes and gave a single spot (Rf- 0.53) on TLC in toluene:ethyl acetate (19:1). The mother liquor was concentrated and chromatographed over argentised silica gel (hexane, hexane-chloroform 1:1, chloroform) when a crystalline substance (Compound C – mp76º C) deposited in the early chloroform fractions and the later chloroform fractions yielded Compound B. The former was recrystallized from hexane-acetone and it gave a single spot of Rf -0.71 on TLC in the same solvent system. 2.3.5. Spectral characterization of isolated compounds The IR spectra of the isolated compounds were taken on ALPHA FT-IR (BrukerOptik, GmbH- Ettlingen, Germany) Spectrometer equipped with a versatile high throughput ZnSe ATR crystal, using OPUS software version 6.5. Samples were scanned between 600 & 4000 cm-1. 1

H and

13

C NMR spectra were recorded on a Bruker AV-300 Supercon NMR system at

300 and 75 MHz respectively. Deuterated chloroform (CDCl3) was used as solvent with Trimethylsilane (TMS) as internal standard. Chemical shift values are given in δ scale with TMS as zero. 2.4. Pharmacological activity 2.4.1. Animals and ethics Female wistar foster dams with 9-11 day old, fostered pups (minimum of 10 pups/female) from Centre for Toxicology and Developmental Research, Sri Ramachandra University were housed in plastic cages containing paddy husk bedding in separate environmentally controlled rooms for the duration of the study. The acclimatization period was 5 days and they were caged with dams until weaning. On day 17, i.e., the first day of dosing, all female pups were weighed and those weighing 25-40 g were included in the study and identified uniquely. The experimental procedure was carried out in accordance with the

9

guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Govt of India and the study was approved by our Institutional Animal Ethics Committee (Xth IAEC / SRMC & RI /57 /1.9.2006). 2.4.2. Evaluation of Estrogenic activity of IrA and IrH Evaluation of the estrogenic activity of the extracts of I. racemosa was undertaken by using a version of the uterotrophic assay in immature rats (Owens and Ashby, 2002) with ethinylestradiol as the positive control. Groups of 17 d old pre-pubertal female wistar pups were randomly divided into 6 groups of 6 animals each: Group I: Control group (CG) animals received vehicle, 0.5% Na CMC, 5 mL/kg bw p.o, Group II & III: the animals received 100 &250 mg/kg bw/day of Inula racemosa alcohol extract respectively in vehicle orally for 7 days Group IV & V: the animals received 100 & 250 mg/kg bw/day of Inula racemosa hexane extract respectively in vehicle orally for 7 days Group VI: the animals received Ethinyl estradiol 30μg/kg bw/day in vehicle, orally for 7 days

Daily body weights were measured during the treatment period. On day 8 the rats were sacrificed, uteri and ovaries removed as one piece caudal to the cervix, adhering fat and mesenchymal tissue dissected out, ovaries dissected free and the uteri weighed after blotting out surface fluid. Care was taken to ensure that any fluid in the uterus was not disturbed during trimming and weighing procedures. Left ovary and the left uterine horn with cervix from all the pups in each group was fixed in Bouin’s fixative (Ananthanarayanan et al., 2005) for 20 h and then in 10% formalin buffer for 24 h. They were dehydrated in ethanol and processed to paraffin blocks. The tissues were then sectioned (5 μm), stained with H&E and subjected for histopathological assessment on a Nikon eclipse TE 2000S microscope and morphometricmeasurements were made with the help of Image ProPlus® Software (Version 6.0).

10

2.5. In-silico screening of isolated compounds for ER binding affinity Estrogen signaling is a balance between two opposing forces in the form of two distinct receptors (ERα and ERβ) and their splice variants that function both as signal transducers and transcription factors to modulate expression of target genes (Couse and Korach, 1999). To establish the ER modulatory effects of the extracts, major compounds isolated from IrH and IrA were screened for their binding affinity to ERα & ERβ in silico (Zhizhong et al., 2010). The docking simulations were performed using FRED docking engine - 2.2.5 version [Fast Rigid Exhaustive Docking -Open Eye Scientific Inc.] Alantolactone (ALT), Isoalantolactone (IALT), Stigmasterol glycoside (SG), estradiol, tamoxifen and raloxifen were taken up for the screen. Their molecular structures were obtained from the Pub Chem data base in the Mol 2/Dot sdf format and 3D structures of the receptors ERα and ERβ of accession numbers IA52 and 1QKM respectively were obtained from RCSB PDB. From the ligand binding domain (LBD) of ER - the target for xenoestrogens, the active binding sites on the ERα and ERβ were selected from the previous literature (Irene Barrett et al, 2008) and an active site box was constructed as a grid using FRED receptor module. FRED is an in silico simulation docking tool based on conformational analysis and the docking scores were read by Chemgauss 3. The docking score, a function of Gibb’s free energy (∆G) was used to assess the relative bonding affinity of the screened molecules with respect to standard estrogen receptor binders. 2.6. Cell viability and cell culture assays MCF-7 cell lines were obtained from the Department of Virology, King’s Institute of Preventive Medicine And Research, Guindy, Chennai and maintained in DMEM (Himedia) supplemented with 10% Fetal Bovine Serum (FBS) and Penicillin-Streptomycin (50 units/ml) at 37°C in a humidified atmosphere of 5% CO2.Cell viability was assessed by Trypan blue dye exclusion method (Freshney, 1994).

2.6.1. Cell proliferation assay by MTT (Mosmann, 1983)

11

In view of their ability to process estrogen via estrogen receptors in the cell cytoplasm, MCF-7 cells were taken up for in vitro proliferation assessment on exposure to ALT, IALT and SG by MTT (3-[4,5-dimethyl thiazol-2yl]-2,5- diphenyl tetrazolium bromide) assay method. While ALT and IALT were taken in two test doses, geometric doses of SG have been taken up owing to significant estrogenic response for IrA in vivo. Cells were seeded at a density of 1×104 cells per well in 96-well plate overnight and then treated with different concentrations of ALT (10µM, 20µM), IALT(10µM, 20µM) and SG (50, 100, 150, 200, 250, 300 and 400 µM). After 24h treatment, 50 µL of MTT solution (5 mg/mL in PBS) was added to each well and the cells were further incubated at 37°C for 4 h. Subsequently, 150µL of DMSO was added to solubilize the purple colored formazan crystals. The plates were shaken and the optical density was measured at 570 nm using a microplate reader. The IC50 values of test compounds were determined using Graph Pad Prism version 3.00 (GraphPad, San Diego, CA). Results were expressed as mean±standard error mean (SEM).

2.6.2. Cell cycle distribution analysis by Flow Cytometry (Yan et al, 2015) MCF-7 cells (1x105cells each) were treated with ALT (10µM, 20µM), IALT (10µM, 20µM) and SG (200, 400μM) for 24 h. Subsequently, the cells were collected, washed with ice cold PBS, fixed with 70% alcohol at 4˚C for 2 h and stained with propidium iodide at 37˚C for 10 min prior to analysis using flow cytometry. Progress through the cell cycle was analyzed using a FACS Calibur instrument (Becton Dickinson Immuno cytometry Systems, Beckman/Coulter Inc.), equipped with an air cooled argon laser providing 15mW at 488 nm with a standard filter set up.Cell Quest Pro. Software (Becton Dickinson, USA) was used to de convolute DNA content frequency histograms into relative proportions of cells in different phases of division with 10,000 events being recorded. 2.6.3. pS2 gene –mRNA expression by RT-PCR

12

MCF-7 cells were seeded onto 6-well plates at the density of 1× 106 cells. After 50% confluency, they were treated with ALT (10µM), IALT (10µM), SG (200µM) using (1µl/ml & 20µl/ml) DMSO as solvent control and incubated for 48h. Total RNA was isolated using HiPura Total RNA miniprep purification spin kit as per manufacturer’s ®

instructions and quantified using NanoDrop ND-1000 Spectrophotometer. 1 µg of total RNA was converted into cDNA using Thermo Scientific VersoTMcDNA Synthesis Kit as per manufacturer’s instructions and the same was amplified for pS2 gene using specific primers (VBC Biotech):Forward-5’-TGACTCGGGGTCGCCTTTGGAG-3’, reverse-5’GTGAGCCGAGGCACAGCTGCAG-3’using

GAPDH,

(Forward

–

5’-

ACCACAGTCCATGCCATCAC’3, reverse – 5’-TCCACCACCCTGTTGCTGTA ’3 ) as internal control. The PCR reaction was carried out using Biolit Kitaccording to manufacturer’s instructions under the following conditions: 35 cycles at 95°C for 1min, 95 °C for 30 s, 60 °C for 1min, 72 °C for 1min in Master cycler gradient (Eppendorf, Germany). The PCR products were visualized using 1%agarose gel by ethidium bromide staining. Results were documented using Quantity1-D Analysis Software. The transcripts were normalized with GAPDH expression level. The gene expression was shown as ratio of densitometric value of target mRNA to that of GAPDH.

2.5.Statistical analysis Statistical calculations were carried out with Medcalc software. Cell proliferation was performed in triplicate, whereas flow cytometry was by two independent determinations. The data are presented as mean ± S.E.M. Treatment effects were assessed using one way ANOVA followed by Dunnett’s ‘t’ test for comparison of treatment groups with control. P<0.05 was considered statistically significant. 3. Results 3.1. Phytochemical analysis

13

The alcoholic extract (Ir A - 5.2% w/w of a syrupy brown mass) was characterized by HPTLC (Fig. 1) using inulin – an extractable fructose oligosaccharide reported from Inula racemosa (Srivastava et al., 1999) - as a marker. Densitometric scanning quantified inulin (1.104%) in IrA (Fig.1S, Mangathayaru et al., 2017).

Column chromatographic processing of IrA using hexane, hexane-chloroform, chloroform and chloroform-methanol by step gradient elution yielded an amorphous powder, which was purified by recrystallization from acetone-methanol (Compound A; 120 mg – 0.4%w/w yield). It tested positive for Liebermann Burchard reagent and gave a dark green colour with anthrone/sulphuric acid indicating its glycosidal nature. The compound on hydrolysis (70% alcoholic HCl, 2h on water bath) and crystallisation from methanol-ether (mp 165◦ C) gave a whitish powdery substance. The hydrolysis mixture on paper chromatography in butanol-pyridine-water, (6:4:3), using aniline hydrogen phthalate for visualization, demonstrated the presence of D-glucose co-spotted with it. Physical and spectral data confirmed the identity of Compound A as stigmasterol-3-O-βD-glucopyranoside (SG). It is a white powder soluble in chloroform with mp. 288◦C. The IR, 1H and

13

C NMR data of SG are in agreement with values reported in literature

(Maitra et al., 2006).

Characterization of the hexane extract (IrH -2.88% w/w of a yellowish oily mass) by GCMS analysis (Fig.2) identified the presence of alantolactone (Peak 4 - 52%) and isoalantolactone (Peak 5 - 34%) as major compounds. As reported previously (Purushothaman et al., 1972) Compound B (1.8g – 2.16%ww yield) and compound C (6.5g – 7.79%w/w yield) isolated from IrHwere identified as isoalantolactone and alantolactone respectively based on correlation of their IR, 1H and literature values (Arora et al., 1980).

3.2. Estrogenic activity of IrA and IrH in vivo

14

13

C NMR data with

Results of the study are presented in Table 1. It can be seen that, there was no significant body weight gain in IrA and IrH treated groups, while it was maximal in ethinyl estradiol treated animals which differed significantly from the control. Thus growth of the animals was not affected by extract treatment. Though uteri from IrA and EE treated animals were larger than those of control, they did not appear to have luminal fluid. A statistically significant increase (P<0.05) in uterine weight relative to bodyweight is noted in IrA and EE treated animals compared to control. Uterine weight gain is maximal due to EE. Uterine growth in immature rats following a 3-4 day exposure regimen has been used by several investigators as an indicator of estrogenic activity (Carthew et al., 1999; Christian et al., 1998). Also an increase in normalised tissue weight is considered a significant treatment effect, when treatment does not affect growth, since increase in uterine weight may be attributed entirely to estrogenicity. Morphometric measurement of uterine sections from both the IrA treated groups demonstrated an increase in uterine diameter relative to normal control (Table 2). They have also shown the presence of endometrial glands and glandular invagination of the epithelium (Fig. 3). Cross sections of coiled arteries and glands are seen in the deeper regions of the endometrium in sections from the EE treated pups. Luminal epithelial cell height is also maximal in group VI. Uterine tube histology corroborated with the uterine changes (Fig. 4, Inserts). Presence of ciliated lining epithelium is marked in group II (Fig. 4B1). They appear hypertrophied and the proportion of ciliated to non-ciliated cells is higher. Although less sensitive than uterine weight, changes in uterine epithelial cell height and wall thickness are stimulated by estrogens and are considered highly specific for estrogenic activity (Reel et al., 1996). When both the endpoints are affected by treatment, there is a high degree of confidence that estrogenic processes have mediated the event. Numerous ovarian follicles in various stages of development in the stroma of the cortex are seen in sections from vehicle control (Fig. 4A). Primordial follicles are more numerous and located in the periphery of the cortex. These follicles are smallest and most

15

simple in structure. Few mature follicles and many atretic follicles are also seen. Ovarian sections from group II, III and VI show greater numbers of larger follicles with antral cavities of various sizes (Fig. 4B1, B2, D). These secondary and vesicular follicles are situated deeper in the cortex, which shows signs of vascularization. Results of histomorphometric analysis of uterus and ovaries of experimental animals are shown in Tables 2 & 3. There is a statistically significant increase in the measurement of all the three uterine layers in group VI (Table 2). Diameter of the ovary (Table 3) is largest in group III followed by group VI. Greater numbers of primary and secondary follicles are seen in group II&IIIrelative to control and more typical tertiary follicles were noted in group VI. Thus pervasive activation of follicular growth is mediated by the both the tested doses of IrA and by EE. In groups IV&V on the other hand, the measured histomorphologial features were not statistically different from those of control group indicating no significant estrogenic activity due to IrH. The observed histological and histomorphometric changes are indicative of early proliferative phase and follicular initiation, demonstrating weak estrogenic activity for IrA compared to EE. 3.3. Estrogenic activity evaluation of ALT, IALT and SG 3.3.1. In silico screening of isolated compounds for ER binding affinity To substantiate the estrogenic activity observed, the major alantolides of IrH and Stigmasterol glycoside isolated from IrA were screened for estrogen receptor binding affinity using in-silico ligand- receptor docking studies along with endogenous estrogen Estradiol (EE), estrogen agonist/antagonist Tamoxifen (Tx) and selective estrogen receptor modulator Raloxifen (Rx) as reference molecules. Chemgauss docking score of the binding energies (Fig. 5) indicates maximum binding affinity of SG to both ERα and ERβ. While Ethinylestradiol showed equal affinity to both ERα and ERβ, Tamoxifen and raloxifen showed marginally greater ERα binding affinity typical of mixed estrogen agonists/antagonists (Musa et al., 2007). While IALT has shown greater ERα binding affinity, SG and ALT have shown higher ERβ binding. SG has shown 2 times greater

16

ERβ binding and 1.8 times ERα binding relative to endogenous estrogen estradiol. Its binding affinity to ERα and ERβ relative to tamoxifen and raloxifen have been 1.39, 1.5 and 2.6, 2.7 times respectively. Thus while IALT has shown ERα affinity and ALT an ERβ affinity, SG has shown a high binding affinity to boththe subtypes with relatively greater ERβ binding.

3.3.2. Growth and proliferation inhibition of MCF -7 cells SG, ALT & IALT were evaluated for their antiproliferative action on (ER expressing) estrogen sensitive human breast cancer cell line MCF7 cells and the results are indicated in Fig.6. IALT & SG have shown a dose dependent decrease in cell viability while ALT demonstrated a proliferative effect at 10 µM and an anti-proliferative effect at 20µM thus showing a biphasic response. The proliferative effect of ALT correlates well with the observed higher ERα/ERβ ratio observed in silico (Nilsson et al., 2011).

3.3.3. Cell cycle analysis by Flow Cytometry To gain insight into the action mechanism of the anti-proliferative effect of the compounds, we investigated their effect on different phases of the cell cycle by fluorescence activated cell sorting (FACS) (Supporting information Fig 2S). Untreated control cells showed the expected pattern for continually growing cells as seen by the highest peak in the G0-G1 and a small low peak in G2/M phase (Fig. 7). It is seen that ALT has mediated an increase in G0-G1 cells, with a decrease in S phase and sub G0-G1 cells relative to controls at 10µM, whereas at 20µM a 1.5 fold increase in the number of sub G0-G1 cells indicates a greater apoptotic cells substantiated by an 15.5% and 0.9% decrease in the number of G0-G1 and G2-M cells. The growth inhibitory effect of ALT at higher dose is in agreement with the MTT assay results. IALT at 20 µM shows significant cellular growth inhibition with a significant increase (27%) in sub G0-G1 cells indicating initiation of apoptotic mechanism. At 200µM, SG increased G0-G1 cell population (12.43%, P>0.05) with concomitant decrease in G2-M (27.28%, P<0.01) and S phase cell population (87.23%, P<0.05), changes typical of cellular proliferation. The

17

Sub G0-G1 cell population however has increased (207.92%, P<0.05), indicating initiation of apoptosis. SG at 400µM, brought about a reduction (25.04%, P<0.05) in G0G1, increase in G2-M (245.73%, P<0.01) and S phase cells (19.83%, P<0.05 relative to control). At this dose there has been an increase in apoptotic cells mediated by SG relative to control as indicated by the sub G0-G1 cell (161.3%) population suggesting pervasive cellular growth inhibition.

3.3.4. Reverse transcriptase polymerase chain reaction analysis of mRNA for pS2 MCF-7 is an ER positive breast cancer cell line that is sensitive to estradiol induced cell growth and ER regulated gene expression. pS2 gene transcription is stimulated by estrogen in these cells and mRNA expression of its gene product was estimated by RTPCR in the cells treated with ALT, IALT and SG. Gel electrophoresis image of the transcribed copy DNA for pS2 and GAPDH from treated and untreated cells (Fig. 8) shows a clear induction of pS2 with IALT and SG and no induction for ALT as seen by the band intensity at 500bp.While at 2µL, solvent DMSO has shown no effect, there is some induction for 20µL DMSO albeit less intense than that of SG, indicating a positive effect for the latter even after discounting the solvent effect (Xianglin Wu et el., 2011).

4. Discussion Hexane and methanol extracts of Inula racemosa were prepared, characterized and ALT and IALT was isolated from the hexane extract. Stigmasterol-3-O-β-D-glucopyranoside has been isolated and characterized from IrA. It is significant to note that though stigmasterol has been isolated from several plants stigmasterol glycoside has been isolated from relatively fewer plant sources (Maitra et al., 2006), this being the first instance isolation of SG from Inula racemosa. Phytoestrogenic activity of phytosterols being well documented, isolation of SG from IrA may well be attestative to its estrogenicity reported herein.

18

During fetal and early postnatal development, hormonal milieu changes can induce dramatic structural and functional alteration in the reproductive tract (Newbold et al., 2001). Uterine tissues respond with rapid and vigorous growth to stimulation by estrogens particularly in laboratory rodents and they are appropriate targets for the in vivo screening of estrogen agonists and antagonists. Also the immature rat having an intact Hypothalamic-Pituitary-Gonadal (HPG) axis has greater scope for investigation than, an ovariectomized adult female, as it can respond to substances that interact with HPG axis rather than just the estrogen-receptor binders. Exogenous compounds elicit estrogenic or anti estrogenic effects in biological systems by mimicking endogenous estrogen by direct association with estrogen receptor (ER) or indirectly through perturbation in steroid synthesis pathways and hence up or down regulation of ER (Soto et al., 1998).The biological effects of estrogens are mediated by ERα and ERβ receptors which differ in their distribution, tissue density and expression in different tissues in the female reproductive tract (Mowa and Iwanaga, 2000), male reproductive tissues and in tissues outside of the reproductive system. In rat uterus, ERα is dominant, inducible by estradiol and is primarily responsible for the control of its uterine physiology (Wang et al., 2000). ERβ on the other hand has very low expression in uterus and is found predominantly in the vasculature. Thus in rats, a compound with weak estrogenic effect on uterine weight, might have more pronounced effect in vasculature where ERβ predominates (James et al., 2001). The demonstrated weak estrogenic activity of IrA and the atheroprotective affect against experimental atherosclerosis in guinea pigs in our earlier studies suggests a possible ER β mediated effect by the alcohol extract of Inula racemosa. It is widely accepted that in adult rats, the balance between ovarian follicle growth and follicular atresia is maintained atleast in part by cyclic variations in FSH concentrations. Macrophages are implicated in most ovarian events and Gaytan et al, 1998 studied the presence of ovarian macrophages in relation to follicular development and atresia in rats. They suggest the involvement of macrophages in the atretic process during prepubertal

19

development, whereas in adult rats only a small proportion of healthy growing follicles contained macrophages. The study observed that during follicular development in juvenile rats, when follicles reach 30-400 μm diameter, they are invaded by macrophages which initiate atretic process by oxidative damage. Beneficial modulation of antioxidant enzymes in vivo by IrA in our earlier study (Mangathayaru et al., 2009) supports the hypothesis that at the dose tested antioxidant principles in the extract have possibly neutralised the pro oxidant damage caused by macrophages in the pre pubertal animals. Follicular atresia being prevented, they have progressed to advanced stages of growth relative to CG. While the dose dependent cytotoxicity of SG to estrogen responsive MCF-7 cells as seen by the MTT assay and flow cytometric analysis connotes an anti-estrogenic effect, pS2 induction suggests an estrogenic effect. The maximum binding affinity of SG to both ERα and ERβ akin to ethinyl estradiol in silico albeit an ERβ dominance and the weak estrogenic effect of the parent extract IrA, in vivo proposes an anti-estrogenic effect due partly to its ERβ binding much similar to drugs like endoxifen (Fang et al., 2001). Differential tissue distribution of the ER subtypes, their differential regulation of estrogen responsive genes, similarity of binding pocket between ERα and ERβ, mobility and plasticity of the ER ligand binding domain (LBD) allowing compounds of extraordinary structural diversity mimicking natural estrogen agonists or antagonist to bind to ER subtypes, accounts for the complexity of estrogenic response of ligands. 5. Conclusion Demonstration of classical morphological changes induced by estrogen stimulation mediated by the alcoholic extract of Inula racemosa at both the tested doses, isolation of the antioxidant SG (Falodun et al., 2008) from IrA and its dose dependent growth inhibitory effect on estrogen sensitive MCF-7 cells through apoptotic induction and an upregulation of pS2 are suggestive of an anti-estrogenic effect through estrogen receptor binding affinity, typical of phytoestrogens that bind to ER but do not elicit a full estrogenic response. The observed estrogenic effect of IrA suggests a multi mechanistic

20

molecular action involving antioxidant as well as redox signalling pathways acting in consonance with their anti-estrogenic effects owing to the weak estrogen like competitive receptor binding of SG. Our findings suggest a possible phytoestrogenic vascular effect to the earlier reported atheroprotective activity reinforcing the synergistic, multiple, yet cardiospecific protective claims for I. racemosa roots in traditional medicine. Appendix A. Supplementary material Flow Cytometry histogram available as supporting information.

Acknowledgements Thanks are due to Dr Padma Gurmet, Research Officer, National Research Centre for Sowa-Rigpa (Amchi), Leh-Ladakh, India for supply of the authentic plant material of the sub-himalayan Inula racemosa. Author Contributions KMT designed the study, undertook in vivo studies, data interpretation and wrote the manuscript, DR and ST undertook the in silico and in vitro activity, SK gave histopathological interpretation and manuscript review and KB helped with phytochemical processing References

Ananthanarayanan,

V.,

Pins,

M.R.,

Meyer,

R.E.,

Gann,

P.H.,

2005,

Immunohistochemical assays in prostatic biopsies processed in Bouin's fixative. J.Clin. Pathol. 58, 322-324.

21

Arora, R.K., Maheswari, M.L., Chandel, K.P.S., Gupta, R., 1980, Mano (Inula racemosa): Little known aromatic plant of Lahaul valley, India. Econ. Bot. 3492, 175180. Carthew, P., Edwards, R.E., Nolan, B.M., Tucker, M.J., Smith, L.L., 1999, Compartmentalized uterotrophic effects of tamoxifen, toremifene, and estradiol in the ovariectomized Wistar (Han) rat. Toxicol. Sci. 48, 197-205. Charak., 1941, Charak Samhita 3rd ed, Nirnaya Sagar Press, 131. Christian, M.S., Hoberman, A,.M,., Bachmann, S., Hellwig, J., 1998, Variability in the uterotrophic response assay (an in vivo estrogenic response assay) in untreated control and positive control (DES-DP, 2.5 microG/kg, bid) Wistar and SpragueDawley rats. Drug Chem. Toxicol. 21(Suppl.), 51-100. Constantinides, P., Gutmann-Auersperg, N., Hospes, D., Williams, K., 1962, Estradiol and prednisolone in rabbit atherosclerosis. Arch Pathol 73, 277-280. Couse, J.F., Korach,K.S., 1999, Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20, 358–417. Falodun, A., Ali, S., Quadir, I.M., Choudhary, I.M.I., 2008, Phytochemical and biological investigation of chloroform and ethyl acetate fractions of Euphorbia heterophylla leaf (Euphorbiaceae). J. Med. Plants Res. 2, 365-369 Fang, H., Tong, W., Shi, L.M., Blair, R., Perkins, R., Branham, W., Hass, B.S., Xie, Q., Dial, S.L., Moland, C.L., Sheehan, D.M., 2001, ‘Selective Estrogen Receptor Modulators’ for a large diverse set of natural, synthetic and environmental estrogens. Chem Res Toxicol. 14, 280-94. Farhat, M.Y., Lavigne, M.C., Ramwell, P.W., 1996. The vascular protective effects of estrogen. FASEB. 10, 615-624.

22

Freshney, R.I., 1994. Culture of Animal Cells: A Manual of Basic Technique, WileyLiss, NY, 287–307 Gaytan, F., Morales, C., Bellido, C., Aguilar, E., Sanchez-Criado, J.E., 1998, Ovarian follicle macrophages. Is follicular atresia in the immature rat a macrophage -mediated event? Biol. Reprod. 58, 52-59. Gholaps, S., Kar, A., 2003, Effects of Inula racemosa and Gymnema sylvestre leaf extracts in the regulation of corticosteroid induced diabetes mellitus: involvement of thyroid hormones. Pharmazie 58, 413-415. Irene, B., Mary, J. M., Rosario, B. H., Miriam, C., Andrew, J. S. K., Natalia, A., Georgia, G., Daniela, M. Z., David, G. L., 2008, Synthesis, Biological Evaluation, StructuralActivity Relationship, and Docking Study for a Series of Benzoxepin-Derived Estrogen Receptor Modulators. Bioorg Med Chem 16, 9554-9573. James, M., McKim, J., Paul, C.W., William, J.B., Kathy, P.P., Robert, H.G., Robert, G.M., 2001, Potential estrogenic and anti estrogenic activity of the siloxane octamethylcyclotetrasiloxane (D4) and the linear siloxane hexamethyl disiloxane (HMDS) in immature rats using the uterotrophic assay. Toxicol. Sci. 63, 37-46. Losordo, D.W., Kearney, M., Kim, E.A., Jakanowski, J., Isner, J.M., 1994, Variable expression of estrogen receptor in normal and atherosclerotic arteries of premenopausal women. Circulation 89, 1501-1510. Maitra, S.K., Chatterjee, B.N., Chakravarty, D., Maiti, B.C., 2006, Chemical investigation of the roots of Xanthium strumarium. J. Indian Chem. Soc. 83, 513-516. Mangathayaru, K., Kuruvilla, S., Balakrishna, K., Venkhatesh, J., 2009, Modulatory effect of Inula racemosa Hook f. (Asteraceae) on experimental atherosclerosis in guinea pigs. J. Pharm. Pharmacol. 61, 1111-1118.

23

Mangathayaru, K., Divya, R., Srivani, T., Sarah, K., Balakrishna, K., 2017, Data set supporting the characterization of Inula racemosa Hook f root extract and its isolated compounds. J. Ethno Pharmacol. Data in Brief. Submitted Moskowitz, M.S., Moskowitz, A.A., Bradford, W.L., Wissler, R.W., 1956, Changes in serum lipids and coronary arteries of the rat in response to estrogens. Arch Pathol 61, 245-263. Mowa, C.N, Iwanaga, T., 2000, Differential distribution of oestrogen receptor-alpha and -beta mRNAs in the female reproductive organ of rats as revealed by in situ hybridization. J. Endocrinol.165, 59-66. Murkies, A.L., Wilcox, G., Davis, SR. Phytoestrogens. J Clin Endocrin Metab 1998; 83: 297-303 Musa, M.A., Khan, M.O., Cooperwood, J.S., 2007, Medicinal chemistry and emerging strategies applied to the development of Selective Estrogen Receptor Modulators. Curr. Med. Chem. 14, 1249-61. Newbold, R,R,, Banks, E.P., Bullock, B., Jefferson, W.N., 2001, Uterine adrenocarcnima in mice treated neonatally with genistein. Cancer Res. 61, 4325-4328. Nilsson, S., Koehler, K.F., Gustafsson, J., 2011, Development of subtype-selective oestrogen receptor-based therapeutics. Nat Rev Drug Discov. 10, 778-92. NISCAIR. Wealth of India, Raw Materials, 2002, First Suppl Ser, Vol III NISCAIRCSIR, New Delhi, p 337. Owens, J.W., Ashby, J., 2002, Critical review and evaluation of the uterotrophic bioassay for the identification of possible estrogen agonists and antagonists. In support of the validation of the OECD uterotrophic protocols for the laboratory rodent. Crit. Rev. Toxicol. 32, 445-520.

24

Puroshothaman, K.K., Krishnan, S., Narayanaswami, V., 1972, Pushkaramula (Inula racemosa Hook. f). J. Res. Indian Med. 7, 39-42. Reel, J.R., Lamb, J.C., Neal, B.H., 1996, Survey and assessment of mammalian estrogen biological assays for hazard characterization. Fund. Appl. Toxicol.34, 288-305. Sekhar, A.V., Gandhi, D.N., Rao, N.M., Rawal, U.D., 2003, An experimental and clinical evaluation of anti asthmatic potential of Devadaru compound (DC). Ind. J. Physiol. Pharmacol. 47, 101–107. Soto, A.M., Michaelson, C.L., Prechtl, N.V., Weill, B.C., 1998, Sonnenschein C, OleaSerrano F, Olea N. Assays to measure estrogen and androgen agonists and antagonists. Adv. Exp. Med. Biol. 444, 9-23. Srivastava, S., Gupta, P.P., Prasad, R., Dixit, K.S., Palit, G., Ali, B., Misra, G., Saxena, R.C., 1999,Evaluation of antiallergic activity (type I hypersensitivity) of Inula racemosa in rats. 43, Ind. J. Physiol. Pharmacol. 235-241. Tripathy, S.N., Upadhyay, B.N., Gupta, V.K.,1984, Beneficial effect of Inula racemosa (Pushkarmoola) in angina pectoris: a preliminary report. Ind. J. Physiol. Pharmacol. 28,73-75. Tripathy, Y.B., Pratibha, Y., Upadhyay, B.N., 1988, Assesment of adrenergic beta blocking activity of Inula racemosa. J. Ethnopharmacol. 23, 3-9. Wang, H., Eriksson, H., Sahlin, L., 2000, Estrogen receptors alpha and beta in the female reproductive tract of the rat during the estrous cycle. Biol. Reprod. 63, 1331-1340. Xianglin, Wu., Malayannan, S., Sarah, B.G., Zhifu, S., Vivian, N., Wilma, L. L., Matthew, P.G., James, N.I., Thomas, C.S.,John, R.H., 1998, Estrogen receptor-beta sensitizes breast cancer cells to the anti-estrogenic actions of endoxifen. J Endocrinol. 12, 234-239.

25

Yan, C.H., Li, F., Ma, Y.C., 2015, Plumbagin shows anticancer activity in human osteosarcoma (MG-63) cells via the inhibition of S-Phase checkpoints and downregulation of c-myc . Int. J. Clin. Exp. Med. 8, 14432-14439. Zhizhong, W., Yan, L., Chunzhi, A., Yonghua, W., 2010, In Silico Prediction of Estrogen Receptor Subtype Binding Affinity and Selectivity Using Statistical Methods and Molecular Docking with 2-Arylnaphthalenes and 2-Arylquinolines. Int. J. Mol. Sci. 11, 3434-3458.

Fig. 1. HPTLC profile of the alcohol extract of Inularacemosa and marker inulin. Solvent system - butanol: acetic acid: water (6.3:2.7:1). Derivatizing reagent: 20% sulphuric acid. Scanning wavelength: 297 nm. T1 – T5 Inulin (1 mg/mL in 70% ethanol) 2, 4, 6 &8 µL respectively, T6, T7 – IrA (50 mg/mL in 70% ethanol) 4µL & 6 µL, SF – solvent front

26

Fig. 2. Representative chromatogram from GC-MS analysis of the hexane extract of Inularacemosawith selected peaks identified; Peak 1, β-pinene (0.246%) Peak 2, βelemenene (0.396%) Peak 3, velencene (0.299%) Peak 4, Eudesma-5,11(13)-dien-8,12olide (alantolactone – 51.958%) Peak 5, Eudesma-4(14), 11(13)-dien-8,12-olide (Isoalantolactone - 34.280%)

Fig. 3. Photomicrographs of uterine sections from experimental animals (H & E) (A) Uterine layers with little glandular differentiation, vehicle control group, (B 1&B2) IrA treated groups (100, 250 mg/kg bw) uterine glands (black arrow) and glandular invagination (white arrow) – signs of initiation of follicular changes, (C1&C2) IrH treated groups (100, 250 mg/kg bw), well differentiated uterine layers (D) EE treated group, uterine glands in greater numbers in the endometrium , magnification x10, C1 x4

27

Fig. 4. Photomicrographs of sections from left ovary of experimental animals, (H&E) (A) x10, Control group, follicles in various stages of development. Numerous primordial follicles (arrow) seen in the periphery of the cortex, lining epithelium of the oviduct non-ciliated (insert), (B1&B2) x2, IrA treated groups (100, 250 mg/kg bw), larger follicles with antral cavities of various sizes, atretic follicle (red arrow) vascularization seen (black arrow), oviduct lining epithelium ciliated (insert)(C1&C2) x4, IrH treated groups (100, 250mg/kg bw), numerous atretic follicles, non-ciliated epithelial cells of oviduct (insert), (D) x4, EE treated group, greater number of larger follicles.

Fig. 5. Chem gauss scoring for relative ER binding affinity

28

Fig. 6 MTT Assay on MCF-7 cells. ALT, IALT (10&20µM) and SG (10- 400µM). Dose dependent decrease in cell viability observed with SG and IALT. Data shown (Mean±S.E.M) is representative of 3 independent experiments with similar findings. Data was treated with one way ANOVA followed by Bonferroni's Multiple Comparison Test.

Fig. 7 Effect of ALT, IALT & SG on cell cycle distribution of MCF-7 cells. The human breast cancer cell lines were exposed to the indicated concentrations of the compounds for 24 h followed by FACS assay. Data shown (Mean±S.E.M) is representative of 3 independent experiments. *P<0.05 relative to Control as measured by one way ANOVA followed by Bonferroni's Multiple Comparison Test.

29

Fig. 8. RT-PCR for mRNA expression of pS2. ALT, IALT (10µM), SG (200 µM) treated MCF-7 cells amplified for pS2 expression. Positive induction seen with IALT and SG, after discounting the solvent effect which was shown only at 20µL. Data shown (Mean±S.E.M) is representative of 3 independent experiments. **p<0.01, *P<0.05 verses DMSO (20 µL) as measured by one way ANOVA followed by post hoc Dunnet’s test

30

Table 1 Bodya and uterine weight of experimental animalsb Body weight (g) Groups

%

Uterine wet

weight/body

Initial

Final

I (vehicle control)

26.2 ± 2.4

34 ± 3

30

83.4 ±1.7

2.4 ±0.1

II (IrA-100mg/kg)

28.6 ± 3.2

36.1 ± 1.8

26

96.8* ±2.4

2.7* ±0.2

III (IrA-250mg/kg)

31.4 ± 2.7

40.2 ± 2.7

28

110.2* ±2.1

2.7* ±0.1

IV (IrH-100mg/kg)

29.2 ± 2.8

36.8 ± 2.2

26

91.8 ±3.2

2.5 ± 0.3

V (IrH-250mg/kg)

28.3 ± 3.1

36.3 ± 3.2

28

87.3 ±2.3

2.4 ± 0.1

VI (EE- 30 µg/kg)

35.1 ± 2.1

52.2 ± 1.9

49*

157* ±1.82

3* ± 0.2

a

increase

weight (mg)

Uterine

weight (mg/g)

immature female wistar foster dams were weighed on the Ist day of dosing and prior to necropsy, b

values represent mean ± SEM of 6 animals,

*

statistically different from controls (P< 0.05)

31

Table 2 Histomorphometric analysis of uterusa of experimental animalsb

Groups I (vehicle control) II IrA-100mg/kg III IrA-250mg/kg IV IrH-100mg/kg V IrH-250mg/kg VI EE- 30 µg/kg a

uterine diameter (µm)

uterine wall height (µm)

endometrial height (µm)

myometrial height (µm)

luminal epithelial cell height (µm)

857 ± 3.9

333.6 ± 1.2

165.4 ± 2.4

100.9 ± 1.7

15.2 ± 0.0

908.4* ± 4.4 298.8* ± 1.8 180.6* ± 2.2

108.8* ± 2.6

15.8* ± 0.4

921.8* ± 2.9 313.3* ± 1.0 193.1* ± 3.4

114.1* ± 2.1

15.6* ± 0.2

768.6* ± 2.8 306.4* ± 3.4

172.6 ± 2.6

112.2 ± 1.8

14.4 ± 0.6

706.6* ± 3.5 311.2* ± 0.6

180.4 ± 0.8

109.5 ± 1.2

13.3 ± 0.0

912.5* ± 4.7 324.3* ± 1.6 218.1* ± 0.9

135.1* ± 0.9

16.2* ± 0.1

numbers represent average of 30 measurements from 3 fields per animal, b values represent mean ± SEM

of 6 animals, * Significantly different from control (P < 0.05)

32

Table 3 Histomorphometric analysis of ovaries of experimental animalsa

Diameterb of

Primary follicleb

Ovary (µm)

oocyte diameter (µm)

PF

SF

TF

I (vehicle control)

1275.3 ± 3.7

27.8 ± 0.2

27

21

-

II (IrA-100mg/kg)

1898* ± 4.6

27.6 ± 0.2

46* 32*

1

III (IrA-250mg/kg) 2222.4* ± 3.8

28.7 ± 0.2

42* 30*

1

IV (IrH-100mg/kg)

1044.6 ± 3.2

12.6 ± 0.4

21

15

-

V (IrH-250mg/kg)

1224.5 ± 5.1

10.6 ± 0.0

9

10

-

VI (EE- 30 µg/kg)

2177.2 ± 4.4*

23.7 ± 0.0

17* 15*

4

Groups

Numberc of

PF-primary follicles, SF- secondary follicles, TF- tertiary follicles a

values represent mean ± SEM of 6 animals, b numbers represent average of 15 measurements from every

5th section from serially sectioned ovary from each animal,

c

follicle type per section, * significantly different from control (P

33

numbers represent average counts of each

< 0.05)